ID: 1170774977

View in Genome Browser
Species Human (GRCh38)
Location 20:19367262-19367284
Sequence CTCCTGTGACCACTATCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170774977_1170774979 -2 Left 1170774977 20:19367262-19367284 CCTCTGGATAGTGGTCACAGGAG 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1170774979 20:19367283-19367305 AGCCGATTGGCTCCCCAAAGAGG 0: 1
1: 0
2: 1
3: 3
4: 50
1170774977_1170774984 23 Left 1170774977 20:19367262-19367284 CCTCTGGATAGTGGTCACAGGAG 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1170774984 20:19367308-19367330 TTCCTTACCAGTTTTAAATCTGG 0: 1
1: 0
2: 1
3: 15
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170774977 Original CRISPR CTCCTGTGACCACTATCCAG AGG (reversed) Intronic
900189423 1:1347048-1347070 CTCCTGAGGCCACCAGCCAGAGG + Intronic
900294675 1:1942956-1942978 GACCTCTGACCACTACCCAGAGG + Intronic
901956127 1:12787234-12787256 CTCCTGTGACCACAAACCCAAGG + Intergenic
901979507 1:13023303-13023325 CTCCTGTGACCACAAACCCAAGG + Intronic
902002576 1:13205635-13205657 CTCCTGTGACCACAAACCCAAGG - Intergenic
902021810 1:13351399-13351421 CTCCTGTGACCACAAACCCAAGG - Intergenic
907913708 1:58849553-58849575 CTCCTGTGACTTCTATGCACTGG - Intergenic
907930833 1:58998282-58998304 CCCATGTGGACACTATCCAGGGG - Intergenic
910057944 1:83054132-83054154 CACCTGAGGGCACTATCCAGTGG + Intergenic
915466950 1:156103636-156103658 CTCCTGTGTCCCCTCTCCGGGGG + Intronic
917880438 1:179330267-179330289 GTCCTGTGACCCCCACCCAGAGG - Intronic
921395090 1:214660561-214660583 CTCCTGTATTCAGTATCCAGTGG - Intronic
922107061 1:222521736-222521758 GTCCTGTGGCCCCGATCCAGAGG + Intergenic
924105458 1:240644839-240644861 GTCCTGTGGCCCCTATCCAGAGG - Intergenic
924740626 1:246792623-246792645 CTGCTGTGGCCAGTATTCAGTGG - Intergenic
1066083209 10:31952732-31952754 CTGCTGTGACAACTAGCAAGAGG - Intergenic
1070618356 10:77987060-77987082 TCCCTGTGAGCACTCTCCAGGGG - Intronic
1071880136 10:89888517-89888539 GTCCTGTGACCCCCTTCCAGAGG + Intergenic
1072792276 10:98327011-98327033 CCCCAGAGACCACTGTCCAGCGG - Intergenic
1077035329 11:491642-491664 ATCCTGTGTCCACTGCCCAGTGG - Intergenic
1079366390 11:19813834-19813856 TTCCTGTGACCATTATAAAGTGG + Intronic
1082036040 11:47646046-47646068 GTCCTGTGGCCTCCATCCAGAGG - Intergenic
1085226987 11:74930602-74930624 CCCATATAACCACTATCCAGAGG + Intronic
1087918475 11:103837616-103837638 CTCCTTTGCCCACTTTTCAGTGG - Intergenic
1089155970 11:116402901-116402923 CTCCTGCCACCACTCCCCAGAGG + Intergenic
1090435859 11:126685847-126685869 CTCCAGTGGCCCCGATCCAGTGG - Intronic
1090993605 11:131843240-131843262 CTCCTGTCTCCCCTCTCCAGAGG + Intronic
1091323903 11:134669993-134670015 GTCCTGTGAACACTCTCCAGGGG + Intergenic
1092275610 12:7058802-7058824 GTCCTGTGACCCCCACCCAGAGG + Intronic
1097540497 12:60936556-60936578 CTCCTGTGACCTTGACCCAGTGG + Intergenic
1097655621 12:62358939-62358961 CTCCTGTGACCAATCCCCTGTGG + Intronic
1100601265 12:96113445-96113467 CTCCAGTGACCATGGTCCAGCGG + Intergenic
1101721758 12:107356463-107356485 ATGCTGTGACCACTATGGAGAGG + Intronic
1102146382 12:110658096-110658118 CTCCTGGGACCACTTTCCCTTGG + Intronic
1104027828 12:125041638-125041660 CTCCTGTTACCAGTATCTTGTGG + Intergenic
1104830442 12:131747368-131747390 CTCCTGTGACCAGAGACCAGAGG + Intronic
1105021838 12:132821958-132821980 CTCCTGTGACCAGCACACAGAGG + Intronic
1108259803 13:48645158-48645180 CACCTGGGACCATCATCCAGAGG + Intergenic
1108788697 13:53939824-53939846 CTCCTGTGTGCCCTCTCCAGAGG + Intergenic
1114135168 14:19839844-19839866 ATCCTTTGGCCACTTTCCAGTGG - Intergenic
1114191818 14:20445185-20445207 CTCCTGTTACCATAAACCAGTGG - Intergenic
1114441309 14:22750574-22750596 ATCCTGTGAGCACCATCAAGCGG - Intergenic
1116706402 14:48307791-48307813 CTGCAGTTACCACTATCCAAGGG - Intergenic
1117077729 14:52121632-52121654 GTCCTGTGGCCCCCATCCAGAGG + Intergenic
1119334754 14:73823642-73823664 CTCCTGTGACCTAAATCCTGAGG + Intergenic
1122500780 14:102197959-102197981 CTCCTGTGACCCCTCTCAGGAGG + Intronic
1124411791 15:29443174-29443196 CTCCTGTGGTCACTCTTCAGTGG + Intronic
1127042013 15:54987674-54987696 GTCCTGTGGCCCCTACCCAGAGG - Intergenic
1129182687 15:73887038-73887060 GTCCTGTGACCACAATCCTCAGG + Intronic
1131075329 15:89491902-89491924 CTGCAGTGAGCACTGTCCAGGGG - Intronic
1133127881 16:3657914-3657936 CATCAGTGACCACTATCCAGTGG + Exonic
1134864029 16:17588767-17588789 CTGCTTTGACCAACATCCAGAGG + Intergenic
1135356339 16:21772162-21772184 GTCCTGTGGCCCCTACCCAGAGG - Intergenic
1135454830 16:22588306-22588328 GTCCTGTGGCCCCTACCCAGAGG - Intergenic
1137608866 16:49805649-49805671 CTCCAGTGACCAGTCTGCAGAGG + Intronic
1140203092 16:72910614-72910636 CTCCTGTGTCCATTAAACAGAGG - Intronic
1142441308 16:90099680-90099702 CTGCTGTGTCCAGTTTCCAGAGG - Intergenic
1142552377 17:748816-748838 CTGCTGTGCCCATTATCCTGTGG - Intronic
1142552468 17:749383-749405 CTGCTGTGCCCATTATCCTGTGG - Intronic
1142552485 17:749517-749539 CTGCTGTGCCCATTATCCTGTGG - Intronic
1143088459 17:4434201-4434223 CTGCTGTGCCCACCAGCCAGGGG + Intronic
1143336652 17:6176501-6176523 CTCCTGGCACCACCAGCCAGTGG + Intergenic
1145049337 17:19647766-19647788 CTTCTGTGAGCACTATTCATGGG + Intergenic
1146267939 17:31465387-31465409 CTGCTGTGACCTCTTTCCATTGG + Intronic
1151941502 17:77295347-77295369 GTCCTGTGACCAGAGTCCAGGGG + Intronic
1154459292 18:14563820-14563842 ATCCTTTGGCCACTTTCCAGTGG - Intergenic
1156223751 18:35081554-35081576 CCCCTATTACCACTTTCCAGAGG - Intronic
1156504168 18:37578323-37578345 CACCTGTGGCCACTACCTAGAGG - Intergenic
1156866608 18:41895688-41895710 TTCCTGTGGCCCCTACCCAGAGG + Intergenic
1157793503 18:50554787-50554809 CCCAGGTGACCAGTATCCAGTGG - Intergenic
1160665831 19:327719-327741 TACCTGTGACCACTACCCTGGGG - Intronic
1160946773 19:1647427-1647449 CGCCTGTGGCCACGATCCACAGG + Intronic
1163202304 19:15777931-15777953 CTCCTGAGCCCACTATCCAGGGG - Intergenic
1168552719 19:57311150-57311172 CTCCTAGGACCTCTATGCAGAGG + Intergenic
926127032 2:10278130-10278152 CTCCTCTGACCCCAGTCCAGGGG - Intergenic
927020575 2:19012583-19012605 TTCCTGTGCTCACTATTCAGTGG + Intergenic
931847680 2:66221675-66221697 ATCCAATGACCACTATTCAGTGG + Intergenic
932184323 2:69679337-69679359 CTCCTTTGCCCACTTTTCAGTGG + Intronic
936493884 2:113000330-113000352 CAGCTATAACCACTATCCAGGGG - Intergenic
937295668 2:120808397-120808419 CTCCTGTGACCTCTCCCCAGTGG + Intronic
940158230 2:150681875-150681897 TTCCTATGACCAATACCCAGTGG - Intergenic
943686357 2:190822772-190822794 CTCCTGTGACTCCCATTCAGAGG + Intergenic
948214872 2:236221152-236221174 CTCCAGCCCCCACTATCCAGTGG + Intronic
1170391666 20:15881439-15881461 GTCCTGTGGCCCGTATCCAGAGG - Intronic
1170774977 20:19367262-19367284 CTCCTGTGACCACTATCCAGAGG - Intronic
1172367891 20:34363682-34363704 CGCCTGGGGCCACTCTCCAGCGG + Intronic
1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG + Intronic
1173906596 20:46634275-46634297 TTCGTGTGCCCACTTTCCAGAGG + Intronic
1177450234 21:21256797-21256819 CTCCTGTGATCATCATCCAGAGG + Intronic
1182834989 22:33334644-33334666 CTCCCTTGACCACTATGCATGGG - Intronic
1183311718 22:37113351-37113373 CTCAGGTGACCAAGATCCAGCGG + Intergenic
1184439730 22:44501876-44501898 CTAATGTGCCCAGTATCCAGGGG - Intergenic
1185273205 22:49937977-49937999 CTCCTGTCACCACTAGCCATGGG - Intergenic
952536997 3:34321685-34321707 CTCCTGAGGCCACTTTTCAGAGG - Intergenic
952851817 3:37735657-37735679 GTCCTGTGACCCCTACCCAAGGG + Intronic
953009224 3:39008452-39008474 CTCCTTTCACCAAAATCCAGAGG - Intergenic
960938677 3:122919478-122919500 CTCCTCTGCCCAGGATCCAGGGG - Intronic
963549570 3:146702801-146702823 CTGCTGAGGCCACTACCCAGGGG - Intergenic
963590257 3:147248241-147248263 ATCCTGTAACAACTATGCAGGGG + Intergenic
964780269 3:160329505-160329527 CTTCTTTCACCACTCTCCAGAGG + Intronic
964869404 3:161296831-161296853 GTCCTGTGAAAACTATCAAGTGG - Intergenic
967277305 3:187789122-187789144 CTCATGTAACCTCTATCTAGAGG - Intergenic
968124126 3:196145929-196145951 CCTCTGTGGCCACTACCCAGAGG - Intergenic
968361565 3:198150656-198150678 CTGCTGTGTCCAGTTTCCAGTGG - Intergenic
975313035 4:72924928-72924950 CTCCTGTGACCACCACCCCTAGG + Intergenic
975668198 4:76754571-76754593 GTCCTGTGAGCAGTAGCCAGAGG - Exonic
975719848 4:77238865-77238887 CTTTTGTGACCTCAATCCAGTGG + Intronic
977679896 4:99786905-99786927 GTCCTGTGGCCCCTACCCAGAGG + Intergenic
978035002 4:103981933-103981955 CTCATGTTTCCACTATCCAAAGG + Intergenic
981536918 4:145809728-145809750 GTCCTGTGGCCCCCATCCAGAGG + Intronic
981808627 4:148747119-148747141 CTTCTGTGAGCACTATCCAAGGG + Intergenic
997828586 5:137129598-137129620 GTCCTGTGGCCCCTACCCAGAGG - Intronic
998276355 5:140758065-140758087 CTTTTGTCACCACTATCCTGAGG + Intergenic
1000321650 5:160139211-160139233 CTCCAGTGCCCCATATCCAGTGG + Intergenic
1004854663 6:19736735-19736757 CTGCTGTGGCCACACTCCAGAGG - Intergenic
1007198272 6:40082446-40082468 CACCTGGGACCACTCTCAAGGGG + Intergenic
1007210063 6:40186267-40186289 GTCCTGTGGCCCCTACCCAGGGG - Intergenic
1011904380 6:92344336-92344358 CTTGTGTTCCCACTATCCAGAGG + Intergenic
1013631925 6:111994079-111994101 CTCCTATGCCCAGTATCAAGAGG - Intergenic
1018539398 6:164862353-164862375 GTCCTGTGTCCACTATACACAGG + Intergenic
1019254120 7:38064-38086 CTGCTGTGTCCAGTTTCCAGTGG + Intergenic
1019694665 7:2438524-2438546 CTCCCATGCCCATTATCCAGGGG + Intergenic
1019998211 7:4738791-4738813 CTCCTCTGACCAGTATCTCGGGG + Intronic
1020080899 7:5285158-5285180 CTCCTGTGTCCACTTCACAGGGG + Intronic
1021421022 7:20444687-20444709 GTCCTGTGACCACCACCCAGAGG + Intergenic
1023281898 7:38579293-38579315 CTCCAGTGGCCACTCTCCACTGG + Intronic
1024041517 7:45559723-45559745 GTCCTGTGACCCCCACCCAGAGG + Intergenic
1024661538 7:51500069-51500091 CACCAGTGACCACAAGCCAGAGG - Intergenic
1024720737 7:52135285-52135307 GTCCTGTGGCCCCCATCCAGAGG - Intergenic
1026167884 7:67927259-67927281 CTCCTCTCTCCACTGTCCAGAGG - Intergenic
1027511143 7:79081709-79081731 CTCCTGTCCCCAGTATCAAGAGG + Intronic
1031362860 7:120867912-120867934 CTCCTTTGATAAATATCCAGTGG + Intergenic
1032218683 7:129977651-129977673 CTCCTGTGATCACCTTCTAGAGG - Intergenic
1032525067 7:132573799-132573821 CTCCTGTGAGCACTAGGCATGGG - Intronic
1033668036 7:143462093-143462115 GTCCTGTGGCCCCTATCCAGAGG - Intergenic
1036902319 8:12679566-12679588 CTCCTGTCACCTGTATCAAGGGG - Intergenic
1037906369 8:22718195-22718217 CTCCTGGGTCCTCTCTCCAGAGG - Intronic
1040822144 8:51573401-51573423 CTCCTCTGACACCTTTCCAGTGG - Intronic
1042588203 8:70366208-70366230 CTCTTGTGACCACATTCTAGGGG + Intronic
1047665965 8:127091424-127091446 CTGCTGTGTCCACTTTCCATTGG - Intergenic
1049565407 8:143335405-143335427 TTCCTGTGACCTTTGTCCAGAGG - Intronic
1049770414 8:144377898-144377920 CTGCTGAGACCACTGACCAGTGG - Intronic
1052835895 9:33249680-33249702 CTCCTGCCACCATTATCAAGAGG - Intronic
1059364908 9:113779329-113779351 ATCATGTGACAACTGTCCAGGGG - Intergenic
1060185975 9:121564498-121564520 GTCCTTGGACCACTAGCCAGTGG - Intergenic
1061058709 9:128239649-128239671 GTCCTGTGCCCACTAAGCAGTGG + Intronic
1062093307 9:134689903-134689925 CTCCTGTGCCCACGAGCAAGAGG - Intronic
1062746283 9:138214477-138214499 CTGCTGTGTCCAGTTTCCAGTGG - Intergenic
1203532509 Un_GL000213v1:159911-159933 ATCCTTTGGCCACTTTCCAGTGG - Intergenic
1188050869 X:25484193-25484215 TTTCTATGACCTCTATCCAGAGG - Intergenic
1189119736 X:38381585-38381607 ATCCTGTGGCCACTTTCCATCGG + Intronic
1189160995 X:38808434-38808456 TTCCTGTGTACACTAGCCAGTGG - Intergenic
1190917169 X:54819638-54819660 CTCCTGTGACCACTGCCCTTTGG + Intergenic
1192254298 X:69442839-69442861 CTGCTGTGGCCACAAGCCAGGGG + Intergenic
1199555980 X:149109266-149109288 CTCCTATGGCCTCTACCCAGAGG + Intergenic