ID: 1170780072

View in Genome Browser
Species Human (GRCh38)
Location 20:19417430-19417452
Sequence CAGTTGTACAAGATGTCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170780072 Original CRISPR CAGTTGTACAAGATGTCAAG TGG Intronic
902784815 1:18726106-18726128 CTGTTTTATAAGATGTCTAGAGG - Intronic
903099655 1:21017890-21017912 CAGTTTTGCAAGATGAAAAGAGG + Intronic
903484570 1:23680110-23680132 CACTTGCAGAAGAGGTCAAGTGG - Intergenic
904452624 1:30625129-30625151 CAGGTGTACTATATGTAAAGTGG - Intergenic
906093313 1:43201360-43201382 CAGTGGTACTAGATGTCAGAGGG + Intronic
908339992 1:63167509-63167531 AAATTGTACAAGCTGTGAAGCGG - Intergenic
911015551 1:93328385-93328407 CAGTTGAGCAAGATGTTAAGGGG + Intergenic
911723440 1:101216069-101216091 GAGTTGTCTGAGATGTCAAGGGG + Intergenic
916160967 1:161914345-161914367 CAGATTTGCAAGATGTTAAGGGG - Intronic
917708028 1:177654431-177654453 CAGTAGTAAAAGACTTCAAGAGG + Intergenic
917876619 1:179292433-179292455 CAGTTGTAGAAGAGGCCAAACGG + Intergenic
921585311 1:216939466-216939488 TAGTAGTCAAAGATGTCAAGAGG + Intronic
1063779121 10:9300824-9300846 CACTTGTACAGAATGTGAAGAGG + Intergenic
1065102442 10:22344475-22344497 CAATTTCACCAGATGTCAAGTGG - Intergenic
1065926394 10:30437050-30437072 AAGATGTACAAGATCTCAGGAGG + Intronic
1067714560 10:48679675-48679697 CAGTTGTTCAAGTTGGCAGGTGG - Intergenic
1067900878 10:50240294-50240316 GAGTTTTACAAGATGTTAAAAGG - Intronic
1068152690 10:53154330-53154352 CAGTGGGACAAGATGTGGAGGGG + Intergenic
1068383370 10:56289799-56289821 CAGTTGTAAAAGTTTTCTAGTGG + Intergenic
1070567583 10:77615400-77615422 CAGTTGGAGATGATGTCAAAAGG - Intronic
1072893554 10:99346267-99346289 CAGTTGTCCAAGATGGGATGAGG + Intronic
1076174412 10:128356210-128356232 TAGTTGTTAAAGATGGCAAGTGG + Intergenic
1078306050 11:10187389-10187411 AAGTTGTAAAAGGTGCCAAGTGG - Intronic
1086121190 11:83305884-83305906 CAGTTTTACAAAATTTTAAGAGG + Intergenic
1087540443 11:99510961-99510983 CAGTGGAACAAGATGTAAAGGGG + Intronic
1087879311 11:103396231-103396253 CACTTGTACAAGGTGTTATGGGG - Intronic
1088470110 11:110181543-110181565 CTGGTGGACAAGAGGTCAAGGGG + Intronic
1090024556 11:123156611-123156633 CAGCTGTACAAAATGGCAATGGG - Intronic
1092634311 12:10425087-10425109 CAGTGGGACAAGATGTGGAGGGG - Intronic
1092635357 12:10440492-10440514 CAGTGGGACAAGATGTGGAGGGG - Intronic
1095614432 12:44171662-44171684 CAGTGGTCCAACATGTCAAGAGG + Intronic
1097275080 12:57807594-57807616 CAGATGTACAAGATGTGATGTGG + Exonic
1097579946 12:61442965-61442987 CAGTTGTGTAAGATTCCAAGAGG + Intergenic
1099028739 12:77498215-77498237 CAGATATACAAGGTATCAAGGGG - Intergenic
1100373346 12:93990150-93990172 CAGTTTTACAAGATGTGAAGAGG + Intergenic
1101349365 12:103914256-103914278 CAGTTTAACAAGATGACTAGGGG - Intergenic
1106387239 13:29299734-29299756 CCGTAGTTCAAGATTTCAAGGGG - Intronic
1107419245 13:40231257-40231279 CAGTTTTACTAGATTTGAAGGGG + Intergenic
1110295720 13:73862228-73862250 TAGTTTTACAACATGTAAAGGGG + Intronic
1112089723 13:96069954-96069976 CAGTTATAAAAGATGTAATGGGG + Intergenic
1113497763 13:110745903-110745925 CATTTGTCAAAGATGTCAAAAGG + Intergenic
1114800545 14:25770667-25770689 CAGTTTTGCAAGATGAAAAGAGG + Intergenic
1117120751 14:52565919-52565941 CAGTTGTATAATTTGTAAAGTGG + Intronic
1118159667 14:63275800-63275822 CAGGTGGAGATGATGTCAAGCGG - Intronic
1120719985 14:87880274-87880296 TATTGGTACAAGATGTCAAGAGG - Intronic
1121093228 14:91197493-91197515 CAGTTTTGCAAGATGAAAAGAGG - Intronic
1125436765 15:39654023-39654045 CAGTGGGACAAGATGTAGAGTGG - Intronic
1128046893 15:64626468-64626490 CAGAAGTACAAAATGTCGAGAGG - Intronic
1131793072 15:95985887-95985909 CAGTTGTACAAATTGTCCATAGG + Intergenic
1131891886 15:96981786-96981808 CATTTTTACAAGATCTCAGGAGG + Intergenic
1135248448 16:20878711-20878733 CAGTGGTATAACATCTCAAGAGG - Intronic
1135682681 16:24471816-24471838 CACTTGTACAAGCTTTCAGGCGG + Intergenic
1137030929 16:35523439-35523461 AAGTTTTACAAAATGTAAAGTGG - Intergenic
1142133031 16:88439429-88439451 CAGTTGCACAAGAAGTCAAGTGG - Exonic
1144381931 17:14708160-14708182 CAGTTGAACATCATGTCAAAAGG - Intergenic
1147530812 17:41275609-41275631 CAGTTGTATAAAAGGTCCAGAGG + Intergenic
1148294210 17:46486102-46486124 TAGTTTTACAAGATGAAAAGAGG - Intergenic
1148316393 17:46703816-46703838 TAGTTTTACAAGATGAAAAGAGG - Intronic
1148541582 17:48484934-48484956 CAGTTGTTCAAGATGAAAAAAGG - Intergenic
1151042606 17:70881038-70881060 CAGTTGGACAAAATGTAATGAGG - Intergenic
1153549267 18:6243911-6243933 AAGTTGTACCACATGTCTAGAGG - Intronic
1155635788 18:27953740-27953762 CAGTTGTAGATGAGGTTAAGCGG - Intronic
1156517194 18:37690341-37690363 CAGTAGGACAAGATGTGGAGGGG + Intergenic
1156797474 18:41064714-41064736 CCTTTTTACAGGATGTCAAGTGG - Intergenic
1158772973 18:60543898-60543920 GAGTGGTACAAGATATCAACTGG - Intergenic
1159095599 18:63897933-63897955 CAGTTGGACAAATTGTAAAGGGG - Intronic
1159852276 18:73538639-73538661 AAGTTGTACTAAATGTGAAGTGG + Intergenic
1162755313 19:12854861-12854883 CAGATGTTCCAGATGTCTAGTGG + Intronic
1163337132 19:16680416-16680438 CACTTGTAGAAGAGGTCCAGGGG - Exonic
1165332441 19:35148333-35148355 CACTTGCACATGATGTCATGAGG - Intronic
1168397538 19:56061800-56061822 CATTTGGAAAAGTTGTCAAGTGG + Exonic
1168576679 19:57517356-57517378 GAGTTTTACAAAATGTAAAGCGG - Intronic
925719679 2:6814756-6814778 CAGTTTTGCAAGATGAAAAGAGG + Intergenic
926861475 2:17314738-17314760 CAGTTGTACAGAGTGTCCAGAGG - Intergenic
927834396 2:26381292-26381314 CACTTGTGCAAGATGAAAAGCGG + Intronic
931234950 2:60405479-60405501 CAGCTGAACATGATGTCAAAGGG + Intergenic
933841258 2:86287884-86287906 CATTTGTAGAAGATGTAAACAGG - Intronic
941605701 2:167594096-167594118 CAGGTGTTCAACATGACAAGAGG + Intergenic
942819168 2:180090606-180090628 CAGTGGGATAAGATGTGAAGGGG + Intergenic
943630692 2:190248555-190248577 CAGTTGTACAAGAAGACTTGTGG + Intronic
944629903 2:201613310-201613332 CAGTTGTATGAGGTGTCAATTGG - Intronic
947256569 2:228172393-228172415 CAGTTGTGCAAGTAGTCAGGAGG - Intronic
1170780072 20:19417430-19417452 CAGTTGTACAAGATGTCAAGTGG + Intronic
1172411360 20:34725865-34725887 CAGTTGTCTAAGATCTCTAGGGG + Intronic
1174539733 20:51279518-51279540 CAGTGATATAAGATGTCAAAAGG - Intergenic
1174730066 20:52907395-52907417 CAGTTAAACAATATGTGAAGAGG + Intergenic
1178026633 21:28475512-28475534 CATTTGAACAAGATGCCCAGGGG + Intergenic
1180732247 22:17990886-17990908 CAGTAGTAAAAGAGGTCAAGGGG - Intronic
1181181788 22:21073655-21073677 CACTTGTTCAAGATGACAAATGG - Intergenic
1181516937 22:23419885-23419907 TAGTAGTAAAAGAGGTCAAGGGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
950621168 3:14206437-14206459 CAATTCTCAAAGATGTCAAGGGG - Intergenic
951200191 3:19868007-19868029 CAGTTGTATAAGAGGACAACAGG - Intergenic
953045298 3:39289359-39289381 AAGTTGTACAAAGGGTCAAGAGG + Intergenic
953952781 3:47204615-47204637 AATTTGTAAAAGATGTCAAAAGG - Intergenic
957453929 3:80416436-80416458 CAGATCTACAGGATGACAAGAGG + Intergenic
958974003 3:100645181-100645203 CAGTTGTATAAGGTGTTAGGAGG + Intronic
959739381 3:109698591-109698613 CAGTTGTAGCAAATGTCAAGTGG + Intergenic
967143988 3:186590451-186590473 CTGTTGTACAATGTTTCAAGTGG + Intronic
977351769 4:95897650-95897672 AAGTTGTAAAAGTAGTCAAGTGG + Intergenic
979051372 4:115937761-115937783 CAGTTGTATAAAATGTCACATGG + Intergenic
981464001 4:145045475-145045497 CAGTTTTACAAGATGACATGGGG - Intronic
983736323 4:171066894-171066916 CAATTCTACAAGATGAAAAGAGG - Intergenic
985298134 4:188457404-188457426 CAGTTGTAAAAGTAGCCAAGTGG + Intergenic
988367109 5:30314485-30314507 CAGTTCTTCAAGGAGTCAAGGGG - Intergenic
990117421 5:52405674-52405696 CAGCTCTAAAAGATGTTAAGAGG + Intergenic
992501006 5:77343977-77343999 CAGTGGGACAAGATGTGGAGGGG - Intronic
993877428 5:93324451-93324473 CAGTTGTACTGAATGTCAATAGG - Intergenic
994994370 5:107041078-107041100 CAACTCTACAAGATGTAAAGGGG + Intergenic
996645921 5:125816902-125816924 CAGTTTTCCAAGATGTCTAAAGG + Intergenic
1000401382 5:160831790-160831812 CAGTTCTATAGGATGTCAAGAGG + Intronic
1000732822 5:164857238-164857260 CAGATGTGAAAGATGTGAAGTGG + Intergenic
1004057969 6:12160284-12160306 CAGTTTCACATGATGTTAAGAGG + Intronic
1005559490 6:27023714-27023736 CAGAAGTACAAGAAGGCAAGTGG - Intergenic
1006839012 6:37016162-37016184 CATTTTTACAAGATGCCCAGAGG - Intronic
1014142325 6:117958034-117958056 CAGTGGGACAAGATGTGGAGTGG + Intronic
1015942691 6:138467606-138467628 CAGTAGGACAAGATGTGGAGGGG + Intronic
1019847600 7:3521807-3521829 CAGTTGTACAAGGTTTGGAGAGG + Intronic
1021163694 7:17307364-17307386 CATTTGTATAAGAAGTCAAATGG + Intronic
1021325696 7:19264723-19264745 CAATTCTATAAGATGTCAAATGG - Intergenic
1021496628 7:21281916-21281938 AAGTTGGACAAGTTGTGAAGGGG + Intergenic
1021777714 7:24069950-24069972 AAGCTGTACAGGAAGTCAAGAGG - Intergenic
1022019611 7:26385618-26385640 CAGTTTTAAAAGATGTCATCAGG - Intergenic
1030918330 7:115345938-115345960 CAGTTGTAGAAGGTGTCAACTGG + Intergenic
1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG + Intergenic
1034299171 7:150000382-150000404 CAGTTCTAGAAAATGGCAAGAGG - Intergenic
1034741347 7:153476397-153476419 CAGGTGTCCAAGCTGGCAAGAGG - Intergenic
1034806844 7:154096391-154096413 CAGTTCTAGAAAATGGCAAGAGG + Intronic
1037073266 8:14679382-14679404 TAGTGGTACAAGATGTACAGGGG + Intronic
1039237614 8:35519481-35519503 CCTTTGTACAACATATCAAGAGG - Intronic
1040498269 8:47985548-47985570 AAGTTGTAAAAAATGTCAAAAGG - Intergenic
1041535899 8:58925370-58925392 CAGTTGCCCAAGATGCCAAAAGG + Intronic
1042653092 8:71065020-71065042 CAGTTGTTCAATTTGTTAAGTGG + Intergenic
1043206257 8:77446069-77446091 CAGTTACACATGATGTCATGAGG + Intergenic
1045474851 8:102544102-102544124 TAGTTGTTAAGGATGTCAAGTGG + Intergenic
1045518773 8:102884857-102884879 CAGCTGTACAAGATAACATGAGG + Intronic
1048308734 8:133301839-133301861 CAGGTGTGCAAGATGCCAGGAGG - Intronic
1049019694 8:139947539-139947561 TAATTATACAAGATTTCAAGGGG - Intronic
1051188421 9:14485211-14485233 CTATTGGACAAGATGTCATGAGG - Intergenic
1051600569 9:18868704-18868726 CAGTTGGGCAAAATCTCAAGAGG + Intronic
1055046353 9:71929338-71929360 CGGTTGGACAAGATCTCAAATGG + Intronic
1055334646 9:75220990-75221012 CAGTTCTAGAAGATATCATGAGG + Intergenic
1055928964 9:81540206-81540228 CAGATGTAGAAGGTGTCTAGAGG - Intergenic
1056242514 9:84662451-84662473 CAGTGGGACAAGATGTGGAGTGG - Intergenic
1058434555 9:104950359-104950381 CAGTGGGACAAGATGTGAGGTGG - Intergenic
1062478097 9:136739447-136739469 GCGTTGTTCCAGATGTCAAGTGG - Exonic
1185576583 X:1179504-1179526 CAGTTGAAGAAAATGTCAAAAGG + Intergenic
1186039867 X:5463926-5463948 CAGTTCATCTAGATGTCAAGTGG - Intergenic
1187636624 X:21236955-21236977 CAGTTGGACAAGATCTGGAGAGG + Intergenic
1188071007 X:25718276-25718298 CAGATGTACAAGTGGGCAAGTGG + Intergenic
1189241970 X:39532279-39532301 CAGACGTGCAAGATGACAAGTGG + Intergenic
1193221706 X:78934574-78934596 CAATTGTAGAAGATGTTAGGGGG + Intergenic
1193586751 X:83331791-83331813 CTGTAGTACTAGATTTCAAGTGG + Intergenic
1195947261 X:110228531-110228553 CAGATGTTCAAGATGCAAAGAGG + Intronic
1196028003 X:111062968-111062990 CAGTAGTTGAAGATGTCATGTGG - Intronic
1196041318 X:111207691-111207713 CAGTTGGACAAGATATAGAGAGG + Intronic
1196832043 X:119783409-119783431 CAATTGTACAAGATAGCGAGGGG + Intergenic
1198866271 X:141126639-141126661 CAAATGTACAAGATGGGAAGTGG + Intergenic
1199031186 X:143002412-143002434 TATTTGTACTTGATGTCAAGTGG - Intergenic
1201760689 Y:17534621-17534643 CAGTTGTACAAAAAGTAAAAAGG - Intergenic
1201840863 Y:18371369-18371391 CAGTTGTACAAAAAGTAAAAAGG + Intergenic
1202025107 Y:20513200-20513222 CAGTGGAACAAGATGTGGAGGGG + Intergenic
1202360020 Y:24097851-24097873 TAGTGGTTCAAGTTGTCAAGGGG + Intergenic
1202510757 Y:25572263-25572285 TAGTGGTTCAAGTTGTCAAGGGG - Intergenic