ID: 1170780567

View in Genome Browser
Species Human (GRCh38)
Location 20:19422040-19422062
Sequence TCTCTTTCCCCCAGTGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 317}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170780565_1170780567 1 Left 1170780565 20:19422016-19422038 CCATCCGGGACAAAGAAGTGGGA 0: 1
1: 0
2: 0
3: 10
4: 185
Right 1170780567 20:19422040-19422062 TCTCTTTCCCCCAGTGCTTGAGG 0: 1
1: 0
2: 1
3: 32
4: 317
1170780558_1170780567 20 Left 1170780558 20:19421997-19422019 CCTCAGCCTCAGAGTTGTCCCAT 0: 1
1: 0
2: 3
3: 18
4: 233
Right 1170780567 20:19422040-19422062 TCTCTTTCCCCCAGTGCTTGAGG 0: 1
1: 0
2: 1
3: 32
4: 317
1170780563_1170780567 2 Left 1170780563 20:19422015-19422037 CCCATCCGGGACAAAGAAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1170780567 20:19422040-19422062 TCTCTTTCCCCCAGTGCTTGAGG 0: 1
1: 0
2: 1
3: 32
4: 317
1170780566_1170780567 -3 Left 1170780566 20:19422020-19422042 CCGGGACAAAGAAGTGGGAGTCT No data
Right 1170780567 20:19422040-19422062 TCTCTTTCCCCCAGTGCTTGAGG 0: 1
1: 0
2: 1
3: 32
4: 317
1170780561_1170780567 14 Left 1170780561 20:19422003-19422025 CCTCAGAGTTGTCCCATCCGGGA 0: 1
1: 0
2: 1
3: 11
4: 105
Right 1170780567 20:19422040-19422062 TCTCTTTCCCCCAGTGCTTGAGG 0: 1
1: 0
2: 1
3: 32
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170780567 Original CRISPR TCTCTTTCCCCCAGTGCTTG AGG Intronic
902274182 1:15327414-15327436 TCCCTTTCTCCCAGTGCTAATGG - Intronic
902887454 1:19416083-19416105 TCTCTTTCCTCCACTGCCTCGGG - Intronic
903122887 1:21227822-21227844 GATCTTTGCCCCAGTGCTTCAGG - Intronic
903797963 1:25944476-25944498 TCTTCTCCCCCCAGGGCTTGAGG - Intergenic
904573147 1:31483081-31483103 TCTCTGACCACCAGTGCATGTGG - Intergenic
905447029 1:38034233-38034255 TCTGTCTCCCCCAGTACCTGAGG - Intergenic
905871743 1:41408247-41408269 TCACTTTCCCCCTCTGCCTGGGG - Intergenic
905929366 1:41776461-41776483 TCTCTTTCCACCAGTGGCCGTGG + Intronic
907163957 1:52393493-52393515 TCTCTGTCCCCCACTGATAGGGG + Exonic
907436366 1:54451695-54451717 CCTCTGTCCCCCAGGGCATGTGG - Intergenic
907997144 1:59644380-59644402 TCTCTTTAGTCCAGTGCTTCAGG - Intronic
908172287 1:61517381-61517403 TCTCTTTCCTCCAGTGGTATAGG + Intergenic
911718760 1:101166852-101166874 TCTCTTTCCCCTTGTTCTGGTGG + Intergenic
914917197 1:151826071-151826093 GCTCTCTCCCCCAGTGCTTCTGG + Intronic
915107690 1:153544725-153544747 CCTCTTTGCCCGAGTACTTGTGG + Exonic
916080134 1:161227080-161227102 TCTCTTTACCTCCGTGCCTGTGG + Intronic
916496922 1:165355325-165355347 TATCTGTCCGTCAGTGCTTGTGG - Intronic
916833160 1:168513772-168513794 TCTATTTCCCTCACTGCCTGTGG + Intergenic
917690391 1:177462431-177462453 TTTCTGTCCCCCAGTGGATGGGG + Intergenic
918194834 1:182211620-182211642 GCTCTTTCCCCATCTGCTTGTGG + Intergenic
918775284 1:188620851-188620873 TGACTTGCCCCCAGTCCTTGTGG + Intergenic
919088318 1:192948179-192948201 TCTCATTCCCAAAGTGCTTCAGG + Intergenic
919214585 1:194535490-194535512 CCGCATTCCCCCAGTGCATGTGG + Intergenic
919943980 1:202306784-202306806 TTTCTTCCTCCCAGTGCTCGGGG + Intronic
919965703 1:202522473-202522495 TCTCTTTCCCCTACTGATTAAGG - Intronic
920180624 1:204129871-204129893 TCTCCTTCCCCCAGTCCTCCAGG - Intergenic
920533898 1:206724707-206724729 ACTCTCTCCCCCAGTGACTGAGG - Intronic
920840637 1:209551020-209551042 TCTAATTTCCCCAGTGATTGTGG + Intergenic
921821619 1:219623244-219623266 TTTCTTTCCCACAGTTCTGGGGG - Intergenic
923176161 1:231467796-231467818 TTTCTTTTCCGCAGGGCTTGAGG + Intergenic
923936397 1:238765118-238765140 TATCTTTCCCCCATTGGCTGGGG + Intergenic
1063720773 10:8579270-8579292 GCACTTACACCCAGTGCTTGAGG + Intergenic
1063961480 10:11309664-11309686 GCTCTTTCGGCCAGTCCTTGAGG + Intronic
1063985767 10:11499784-11499806 TCTCTCTCACACAGTTCTTGAGG - Intronic
1064278386 10:13928749-13928771 TCCCTCTGCCCCAGTGCTAGGGG + Intronic
1064784922 10:18883803-18883825 TCTCTTTCTCACTGTGTTTGTGG + Intergenic
1065441982 10:25762335-25762357 TCTATTTCACACAGTGCTGGAGG - Intergenic
1066372651 10:34830248-34830270 TCTTTCCCCCTCAGTGCTTGGGG + Intergenic
1068024325 10:51623966-51623988 TCTCTTGGCCCCAGGGGTTGTGG - Intronic
1068530184 10:58176837-58176859 TCACTTTCTCACAGTTCTTGGGG - Intergenic
1070458477 10:76641757-76641779 TCTTATTCCCCCAGTGATGGAGG + Intergenic
1071611891 10:87039173-87039195 ACCCTTTCCCCCAGTCATTGGGG + Intergenic
1072735037 10:97873529-97873551 CCTCTTTCCCCAACTGCTTATGG - Intronic
1074135730 10:110624976-110624998 TCTCTTGAGCCCAGGGCTTGGGG + Intergenic
1074901224 10:117817813-117817835 TCGCTACCCCACAGTGCTTGGGG - Intergenic
1075224204 10:120611301-120611323 TCTCCTTCCACCTGTTCTTGGGG + Intergenic
1076015457 10:127024108-127024130 CCTCTTTGCACCAGTGCTGGAGG + Intronic
1076414775 10:130277844-130277866 TCTGTCTCCCCCTGTGATTGTGG + Intergenic
1076478153 10:130766842-130766864 TTTATTTCTCCCAGTGCTGGAGG - Intergenic
1077004363 11:345330-345352 TTTCTTTCTCCCACTGCTTTTGG + Intergenic
1077277609 11:1721686-1721708 TGGCTTGCCCCCAGTGCTCGAGG + Intergenic
1077429860 11:2511018-2511040 TCTCTTTTCCCCATTGGTGGTGG + Intronic
1077517182 11:3008997-3009019 TCCCTTTCCCCCAGGGAGTGTGG - Intronic
1078074505 11:8145921-8145943 TCACTTACCCACAGTGCATGAGG - Intronic
1079721986 11:23826821-23826843 TTTCTGTCATCCAGTGCTTGTGG + Intergenic
1081312686 11:41592971-41592993 TTTCTTTCTCCCAGTTCTTCAGG - Intergenic
1081623956 11:44635589-44635611 TCTCTATCCCCCAGCACCTGGGG + Intergenic
1082310183 11:50636467-50636489 TCTTTTTCCCAAAGTGCATGAGG - Intergenic
1082944088 11:58739969-58739991 TCCCATTCCCCCACTGCATGTGG - Intergenic
1083698034 11:64455678-64455700 TCAGTTTCTCCCAGGGCTTGGGG - Intergenic
1084533957 11:69746021-69746043 TCTCTTTGCCCCTGCACTTGGGG - Intergenic
1085505277 11:77055234-77055256 TCTCTTTGCCCCAGGGCTGCAGG + Intergenic
1087492757 11:98848981-98849003 CCCCATTCCCCCAGTGCATGTGG - Intergenic
1088792127 11:113235354-113235376 TCTCTTTCTCCAAGGGGTTGGGG + Intronic
1089333916 11:117709600-117709622 TTTATTTCCCCCATTGCATGGGG + Intronic
1091059441 11:132447875-132447897 TCTCTTTCTCCCAGAGCTCCAGG + Intronic
1092013857 12:5140144-5140166 CCCCATTCCCCCAGTGCATGTGG + Intergenic
1092070432 12:5627281-5627303 TCTTTCTCCCCCACTGCCTGAGG + Intronic
1096379030 12:51139722-51139744 TCCCTTGCCCCCAGGCCTTGGGG + Intronic
1097023345 12:56035984-56036006 TCTCAGTCCCACAGTGCCTGGGG - Exonic
1097493182 12:60296056-60296078 ACACTTTTCCCCAGTTCTTGAGG - Intergenic
1098531189 12:71543476-71543498 GCTCTTTCCCACAGTACTTCTGG - Intronic
1099808875 12:87555298-87555320 TCTCTCTGCCCCAGTGATTCAGG - Intergenic
1100298036 12:93280942-93280964 TTTATTTCCCCCAGTTCTTGAGG + Intergenic
1102285569 12:111653573-111653595 TTTCTTTCCCCCAGTGCCTTAGG - Intronic
1103491782 12:121327022-121327044 TTTCTTTCCTCTAATGCTTGAGG - Intronic
1103852064 12:123939888-123939910 TGTCCTTCCCCCAGGGCCTGTGG + Intronic
1104634984 12:130432753-130432775 TCTGTTTCTCACAGTGCTGGGGG - Intronic
1104755122 12:131264478-131264500 CCTCTGCCCCCCAGTGCTTTAGG + Intergenic
1106475507 13:30094949-30094971 TCTATTTCCCACAGTGCTAGAGG + Intergenic
1107431928 13:40348065-40348087 TCTGTTTCCCTCAGTTCTTTGGG - Intergenic
1109502008 13:63249959-63249981 TCCCATTTCCCCAGTGCCTGTGG - Intergenic
1109616020 13:64834856-64834878 TCTCTTTCTCACAGTCCTAGAGG - Intergenic
1109665338 13:65527757-65527779 TTTCTTTCCCACACTTCTTGTGG + Intergenic
1110474025 13:75892131-75892153 CCTCTTTCCACTAATGCTTGTGG + Intergenic
1110524671 13:76522178-76522200 CCCCATTCCCCCAGTGCCTGTGG + Intergenic
1110630374 13:77698887-77698909 GCTCTTTTCCCCAGTGTTTTCGG + Exonic
1111228177 13:85303810-85303832 TGACTCTCCTCCAGTGCTTGAGG + Intergenic
1112203514 13:97301674-97301696 TTTCTTTCCCCCGGGGCTGGCGG - Intronic
1112304773 13:98264026-98264048 ACACTTTTGCCCAGTGCTTGGGG - Intronic
1112515635 13:100050604-100050626 CCCCATTCCCCCAGTGCATGTGG - Intergenic
1113358499 13:109606246-109606268 TCTCTTCAGCCCAGTGCTTTTGG + Intergenic
1113913944 13:113860105-113860127 TCTCTTCTCCCCACTGCTGGTGG - Intronic
1116079408 14:40154408-40154430 TCTCTATCCCCCTGTGGCTGAGG - Intergenic
1121039246 14:90731469-90731491 TTTCTTTTCCCCAAAGCTTGTGG - Intronic
1123472938 15:20568335-20568357 GCCCTTTCCCCCTGTGCTTTGGG + Intergenic
1123645067 15:22432018-22432040 GCCCTTTCCCCCTGTGCTTTGGG - Intergenic
1123733241 15:23163327-23163349 GCCCTTTCCCCCTGTGCTTTGGG + Intergenic
1123751374 15:23360702-23360724 GCCCTTTCCCCCTGTGCTTTGGG + Intronic
1124283744 15:28384620-28384642 GCCCTTTCCCCCTGTGCTTTGGG + Intronic
1124298953 15:28526993-28527015 GCCCTTTCCCCCTGTGCTTTGGG - Intronic
1124521243 15:30407996-30408018 GCCCTTTCCCCCTGTGCTTTGGG - Intronic
1124563832 15:30797709-30797731 GCCCTTTCCCCCTGTGCTTTGGG + Intergenic
1124959428 15:34383532-34383554 GCCCTTTCCCCCTGTGCTTTGGG - Intronic
1124976054 15:34529753-34529775 GCCCTTTCCCCCTGTGCTTTGGG - Intronic
1125178325 15:36851780-36851802 TCTCATTCCCCCAGCACTTTTGG + Intergenic
1125222608 15:37356699-37356721 TGTCTTTCTCCCAGGGTTTGGGG + Intergenic
1126679241 15:51187825-51187847 TCTCTATCCACCAGTGATTCTGG - Intergenic
1127773284 15:62247116-62247138 GCCCTTTCCCCCTGTGCTTTGGG - Intergenic
1127774599 15:62255128-62255150 GCCCTTTCCCCCTGTGCTTTGGG - Intergenic
1129058002 15:72835808-72835830 TATCTTTCACCCAGGGCATGGGG - Intergenic
1129729921 15:77924484-77924506 TCTCTTGCTCCTAGTGCCTGGGG + Intergenic
1130043301 15:80424210-80424232 TCTCTCACCCACAGTCCTTGCGG - Intronic
1132071897 15:98785777-98785799 TCTCTTTCCTTTACTGCTTGAGG - Intronic
1132846867 16:2004752-2004774 TCTCTGTCCCCCAGAGCAGGTGG + Intronic
1133162136 16:3919133-3919155 TCTTTTTTCCTAAGTGCTTGAGG + Intergenic
1136230288 16:28881832-28881854 TCTCTTTGCCCCAGTGTTACAGG + Intronic
1137730269 16:50684376-50684398 TCTCTTTCCCACAGTTTTGGAGG + Intergenic
1138180067 16:54935177-54935199 TCTCTTCCCCCAAGTGGCTGTGG - Intergenic
1138810021 16:60139075-60139097 GCTCTTTCCTTCAGGGCTTGGGG - Intergenic
1140016906 16:71196427-71196449 TCTCTTGCCCTCAGTGCTCATGG + Intronic
1140121221 16:72084526-72084548 TGTCTTTCCCCCATTGGCTGGGG - Intronic
1140737685 16:77912772-77912794 TTTCTTTCCCACAGTTCTGGAGG + Intronic
1141649115 16:85383836-85383858 CCTCTTTCCTACAGAGCTTGGGG + Intergenic
1142004775 16:87684487-87684509 TCCCATTCCCACAGTCCTTGGGG + Intronic
1142715877 17:1746764-1746786 ACTCTTTCCCACTGTGCTGGAGG + Intronic
1143106468 17:4532895-4532917 TCCTGTTCCCCCAGTGCATGGGG + Intronic
1143661361 17:8326610-8326632 TCTCTTTCCTCTGTTGCTTGTGG - Intergenic
1143798321 17:9356650-9356672 TCTCTTTCCCCATCTGCTTCTGG + Intronic
1144003635 17:11079060-11079082 TCTCTTTCCCCTTGTTTTTGTGG - Intergenic
1144155105 17:12492551-12492573 TCTCTCTCCCACACTGCTGGAGG + Intergenic
1145200374 17:20939325-20939347 TCTATTTCACACAGTGCTGGAGG - Intergenic
1146301567 17:31693705-31693727 CCTGTTTGCCCCAGAGCTTGGGG + Intergenic
1147489507 17:40851853-40851875 ACTCTTTCCACCAGAGCTGGGGG - Intergenic
1148415990 17:47506991-47507013 CCTCTTTCACCCAGTGATTCTGG + Intergenic
1148891252 17:50808937-50808959 TCTCTCTCCCCCAGTACCTAAGG - Intergenic
1150430196 17:65109086-65109108 TCTCCTCACCCCAGAGCTTGAGG + Intergenic
1150893283 17:69179579-69179601 TTTCTTTTCCCCAGTGTTTTGGG - Intronic
1151234516 17:72709476-72709498 GCTCTTTCACCTATTGCTTGAGG + Intronic
1152709402 17:81863217-81863239 TCCCTTCCCCCCAGTGCCAGCGG + Intergenic
1152932016 17:83114801-83114823 TCCCTCTCCCTCAGTGCTTCTGG - Intergenic
1153091227 18:1346271-1346293 TCTTTGTTGCCCAGTGCTTGTGG - Intergenic
1153115711 18:1652994-1653016 TCTCTCTCTCCCAGTCCTTGTGG + Intergenic
1153704709 18:7733814-7733836 CCCCATTCCCCCAGTGCATGTGG + Intronic
1154421750 18:14236564-14236586 CCTCATCCCCCCAGTGCATGTGG + Intergenic
1154933886 18:21031133-21031155 CCTCTTTCCCCCAGGGCTTGCGG - Intronic
1156986533 18:43356898-43356920 ACTCTTTATCCCAGTGCTTGGGG - Intergenic
1157129854 18:44996641-44996663 TCCCTTTCCCCCAGAGTATGTGG - Intronic
1160019756 18:75171406-75171428 TCTCTCTTCCCCAGTGCAGGTGG + Intergenic
1161028569 19:2047746-2047768 TCCCTTTCGCTCAGTGCCTGGGG + Intronic
1161558470 19:4957654-4957676 TCTCTTCCCCCCTGTGCTGTGGG + Intronic
1161601491 19:5186564-5186586 GCTCTCTCCCGCAGTGCTGGTGG - Intronic
1161642206 19:5431355-5431377 TCATTTTCCTCCAGTGCTGGAGG + Intergenic
1162223277 19:9197848-9197870 TCTCTCTCGCCCACTCCTTGGGG - Intergenic
1162362053 19:10226539-10226561 CCTCTTTCCTCCAGTCCTTTGGG + Intronic
1162378362 19:10317851-10317873 TCGCTTTCCCTCAGGGCTGGGGG - Intronic
1164309976 19:24037031-24037053 TCTCTATCACCCTGGGCTTGTGG + Intronic
1164790880 19:30979435-30979457 TCTCAATCCCCATGTGCTTGAGG + Intergenic
1165428816 19:35759999-35760021 TCTTTTTCCCCCAGGGCTGCTGG - Intronic
925374823 2:3376798-3376820 TATCTGTCCCTCAGTGCTTTAGG + Intronic
925784753 2:7421170-7421192 TGTCTTTCCACCAGTGCCTGTGG + Intergenic
925975594 2:9139932-9139954 CATCTTTCCCTCAGTGCTGGTGG - Intergenic
926044749 2:9702397-9702419 TGTCTTTCCCCAAGTCCCTGTGG + Intergenic
926389651 2:12375434-12375456 TCTCCTGCCCCCAGTGCTCTTGG + Intergenic
928600865 2:32902001-32902023 TCTCTTTCCCAGGATGCTTGTGG - Intergenic
929709077 2:44248086-44248108 TCTCTTTCCCCTTGTGCTGGTGG - Intergenic
930194826 2:48498880-48498902 TTTATTTCTCCCAGTTCTTGAGG + Intronic
931262645 2:60633616-60633638 TCTCTTTACCCCAGTTTTTAGGG - Intergenic
932715604 2:74099250-74099272 CCTCTCTCCCCCACTGCTTGGGG + Intronic
932831946 2:74998764-74998786 TCCCATTTCCCCAGTGCATGTGG + Intergenic
933244566 2:79961351-79961373 ACTCTATCACCCAGTGCTTGAGG + Intronic
933390907 2:81665393-81665415 GCTCTTTCCGCCTGTTCTTGGGG + Intergenic
934496387 2:94804552-94804574 CCCCATCCCCCCAGTGCTTGTGG - Intergenic
936013882 2:108943325-108943347 TTTCTATCCCTCAGAGCTTGGGG + Intronic
936802112 2:116282648-116282670 TCTCCTCCCCCCACAGCTTGAGG - Intergenic
937261442 2:120588864-120588886 TCTCTTGGCCCCAGTGCACGTGG - Intergenic
938259305 2:129883867-129883889 TCCCTTTCCAGCAGTGCTTTGGG + Intergenic
938366523 2:130738659-130738681 CCTATGTCCCACAGTGCTTGGGG + Intergenic
939274167 2:139978483-139978505 TCTTCTTTCCCCTGTGCTTGGGG - Intergenic
940343254 2:152602916-152602938 CCTGTTTCACCCAGTGCGTGGGG + Intronic
940381867 2:153024528-153024550 TGTTTTTACCCCAGTGCCTGTGG + Intergenic
940396735 2:153198451-153198473 TCTCATTCCTTCAGTGCTTCAGG + Intergenic
940576322 2:155508894-155508916 TCTCAATCCTCCATTGCTTGGGG + Intergenic
941266818 2:163372767-163372789 TCTCTTTCCATGGGTGCTTGTGG - Intergenic
941321095 2:164055600-164055622 TTTCTTTTCCCCAGTGCCAGTGG - Intergenic
941385126 2:164842111-164842133 TTTCCTTCCCCCAGGGCTTCGGG + Intronic
941925283 2:170888225-170888247 AATCTTTCCCCCAGGGCTGGGGG + Intergenic
942177281 2:173346137-173346159 TGTCTTTCCCCCATTGGCTGGGG - Intergenic
943403446 2:187448122-187448144 ACTCTTTCCCACCTTGCTTGTGG - Exonic
945500434 2:210566255-210566277 TCCCTTTTCCCCAGTGATGGAGG - Intronic
945567059 2:211413972-211413994 CCCCATTCCCCCAGTGCATGTGG + Intronic
947810093 2:232998667-232998689 TGTCTTTCCCACAGTGGCTGTGG + Intronic
948925490 2:241094161-241094183 TCCCTTTTCCCCATTGCGTGTGG + Exonic
948972636 2:241441308-241441330 TCTCATTCCCCGAGGGATTGAGG + Exonic
1170586812 20:17741069-17741091 TCCCTCTCCCACAGTGCCTGTGG - Intergenic
1170780567 20:19422040-19422062 TCTCTTTCCCCCAGTGCTTGAGG + Intronic
1170963077 20:21042632-21042654 TCTCTTGCCCTCAGTGCTCCTGG - Intergenic
1171190448 20:23155391-23155413 TGTCTTTCCCCCATTGACTGGGG - Intergenic
1171213584 20:23335550-23335572 TGTGGCTCCCCCAGTGCTTGGGG + Intergenic
1171302145 20:24072613-24072635 TCTCTAACACCCAGGGCTTGGGG - Intergenic
1174235700 20:49089629-49089651 TCTCCTTCAGCCAGTGCTTTGGG + Exonic
1174765559 20:53250406-53250428 TCTCTTGCCCCAACTGCTGGTGG + Intronic
1175961832 20:62641338-62641360 TTTCCTTCCTCCAGGGCTTGGGG - Exonic
1177530752 21:22355170-22355192 TCTCACTCCCCCAGTACCTGAGG - Intergenic
1179253589 21:39696074-39696096 CGTTTTTCCCCCAGTGCTTTGGG - Intergenic
1179283528 21:39955095-39955117 TCTCTTTTCCCCATTTCTTCTGG + Intergenic
1179600591 21:42475101-42475123 AATCTTTCCCCAAGTGCTTGTGG - Intronic
1179796193 21:43785515-43785537 TCTCTTTTCCCCCGGGCTAGAGG - Intergenic
1181511140 22:23389175-23389197 TCTCTGTCCCTGAGTGCATGGGG - Intergenic
1181902461 22:26168160-26168182 TCTCTGTCCCCCAAAGCCTGAGG + Intergenic
1182542213 22:31049930-31049952 TTTTTTTCCCCAAGTGCGTGAGG - Intergenic
1184038153 22:41928294-41928316 TCTCTGCTCCCCAGTGTTTGGGG + Intergenic
1184433077 22:44453042-44453064 TCTTTCTTCCCCAGTGCTGGTGG - Intergenic
1184883502 22:47327482-47327504 CCTCTTGCCCTCAGTGCTTCTGG - Intergenic
1185088453 22:48753130-48753152 CCTCCTTCCCTCAGTGCATGGGG - Intronic
949785252 3:7733442-7733464 CCCCATTCCCCCAGTGCATGTGG + Intronic
949879914 3:8653033-8653055 TCTCTTTCTCCAAGTGGATGTGG - Intronic
953396860 3:42580210-42580232 TCTCTCTCTCTCAGTGCATGTGG - Intronic
953475843 3:43205367-43205389 TCTCTTTCCCCTTGTGCCTGTGG + Intergenic
953659378 3:44880461-44880483 TCTCCTTCCCAGAGTGCTTGTGG - Intronic
955931189 3:64058456-64058478 TCTCTCTCCACAAGTCCTTGGGG + Intergenic
956934361 3:74082957-74082979 TCAATTTCCCTCAGTGCTTTTGG - Intergenic
957353247 3:79052766-79052788 TCTTTTTTCCCAAGTGCATGTGG + Intronic
958182466 3:90077608-90077630 TGTCTTTCCCCCAAGGCTGGTGG + Intergenic
959002943 3:100985772-100985794 TTTGTCTCCCTCAGTGCTTGAGG - Intronic
961269606 3:125679401-125679423 TCTCTTTCCCCACCTGCTGGTGG + Intergenic
962445263 3:135458080-135458102 TCTCTTTCTTCCAATGCTTTTGG + Intergenic
964526346 3:157619031-157619053 TCTCTTTCCCCCATGGCTAATGG + Intronic
968044115 3:195614039-195614061 TCTCTTCTCCCCAACGCTTGAGG + Intergenic
970010801 4:11456949-11456971 TTTCTGTCCCCCAGTACTTATGG + Intergenic
971111831 4:23593538-23593560 TCTTCTTCCCTCAGTGCTTCTGG - Intergenic
971304004 4:25464552-25464574 TCACTTAACCCCAGTGCTTTGGG + Intergenic
971927149 4:33026577-33026599 TTTTTTTCCCCAAGTGTTTGTGG - Intergenic
973686100 4:53371333-53371355 TGTCATTCCCCCGGTTCTTGTGG - Intergenic
973840661 4:54857135-54857157 TCTCTCTCCCCCAGTCATTCTGG - Intergenic
976236307 4:82900870-82900892 TCTCCTTCCACCAGTGCGTATGG + Exonic
976731978 4:88271974-88271996 TCTCTTTCCCCCAGTGTTGCAGG + Intronic
976812389 4:89111215-89111237 TCTCACCCCCCCAGTGCTGGGGG - Intronic
977683847 4:99825140-99825162 TCTCTGTCCCCATGTGCTTCTGG + Intronic
981298518 4:143160499-143160521 TCTCTTTCTAACAGTGCTTAGGG - Intergenic
981993450 4:150952636-150952658 TCTCTTTCTCTCTGTGCGTGGGG + Intronic
982344246 4:154339178-154339200 TCTCTTGCCCTCAGTGCTCCTGG - Intronic
982626903 4:157778944-157778966 TCTTTTTCCCCCAGAGGTTGAGG - Intergenic
982655834 4:158148718-158148740 TCTCTTGCCCCCTCTGCCTGGGG - Intronic
983438794 4:167754119-167754141 TCTTTTTCCCCTTGTGCTTTTGG - Intergenic
983872993 4:172843474-172843496 TTTCTTTCCCTCAGTGCAGGAGG - Intronic
984703385 4:182832735-182832757 GCTATTACCCCCAGTGCTAGGGG + Intergenic
985654187 5:1121514-1121536 TCTCTTTCCACGATTACTTGAGG - Intergenic
986318454 5:6607833-6607855 TCTCTTTCTCCCAGTTCCTGTGG - Intronic
990100415 5:52178331-52178353 TTTCTTTCTCCCAGTTCTGGAGG + Intergenic
991277147 5:64862788-64862810 TTTCTTTCTCTCAGTTCTTGAGG + Intronic
991970408 5:72135569-72135591 TCTTTTTCTTCCAGTGCTTTGGG - Intronic
992129216 5:73674711-73674733 TCTCTTCTCCCCAGAGGTTGGGG - Intronic
992482237 5:77163619-77163641 TTTCTTTTCCCCAGTTCTTTGGG + Intergenic
994188378 5:96840395-96840417 TCTCTTTCCCCCAGTGAATCAGG + Intronic
994599463 5:101884229-101884251 TCTCTTTCCTCTAATGTTTGAGG - Intergenic
995661089 5:114484162-114484184 TCTCTCTACCTCAGTGCTTTAGG - Intronic
995881069 5:116845284-116845306 TTCCTTTCCCCCAGGGGTTGGGG + Intergenic
997360220 5:133290339-133290361 CCTCATTCGCCCAGTGCTGGCGG - Intronic
997956562 5:138283198-138283220 TCTCTTTCCCCTAGACCTTCTGG + Intergenic
999284727 5:150387605-150387627 TCCCTTTCCCTCTGGGCTTGTGG + Intronic
1000340428 5:160273016-160273038 TCTTTTTCCATCAGCGCTTGTGG - Intronic
1000369018 5:160517311-160517333 TCTCTGTCCCACAGTGCCTGGGG + Intergenic
1001419900 5:171578542-171578564 TCTCTTTCTTCAAGTGCTTAGGG + Intergenic
1001502841 5:172252331-172252353 CCTCTGTGTCCCAGTGCTTGAGG + Intronic
1002526882 5:179820037-179820059 TCTCCTTGCCCCAGTTCTGGCGG + Intronic
1003193017 6:3890755-3890777 TTTATTTCCCCCAGTTCTGGAGG + Intergenic
1004337031 6:14773190-14773212 ACTCTTACCCACAGTGCATGAGG + Intergenic
1006191969 6:32215014-32215036 TCTGTTTCCACCAGTTTTTGTGG + Intronic
1006409821 6:33866569-33866591 TCTCCTTCCCTCAGTTCTTGAGG + Intergenic
1006586900 6:35121043-35121065 TCTCTTTCCCCCTGTGTCAGAGG - Exonic
1007095093 6:39208068-39208090 TCCCTCTCCCCCTGTGCCTGTGG + Intronic
1007619380 6:43202863-43202885 TCTTTTTGTCCCAGTGCCTGTGG + Intronic
1009463069 6:63937181-63937203 TCTGTTTTCCCCACTACTTGAGG - Intronic
1009790682 6:68398288-68398310 TCTCTTTCCCGTCATGCTTGCGG - Intergenic
1009839688 6:69053151-69053173 GCTCTGTCACCCAGTGCTGGAGG - Intronic
1010492906 6:76495569-76495591 TCTTTTTTCCCAAGTGCATGTGG - Intergenic
1010569891 6:77463778-77463800 TCTCTTACCCCAGTTGCTTGAGG + Intergenic
1011025939 6:82869159-82869181 TTTCTTTCCCCTAGTGCTTCTGG + Intergenic
1014728887 6:125007596-125007618 TCTGTTTTCTTCAGTGCTTGGGG + Intronic
1015262788 6:131257528-131257550 ACTCTTTCCCCCACTTCTTGGGG + Intronic
1017187476 6:151616709-151616731 TCTCTTTCTCACAGTTCTGGAGG + Intronic
1018841956 6:167523891-167523913 TCACTTTCCACCAGGGCTTCCGG + Intergenic
1023587186 7:41742919-41742941 TCTTTCTCCCACAGTGGTTGGGG + Intergenic
1023773091 7:43577606-43577628 CCCCATTCCCCCAGTGCTTGTGG + Intergenic
1025095287 7:56091645-56091667 CCCCTTTCCCCCACTGCTTCTGG + Intronic
1026679289 7:72453106-72453128 TTTCTTTCCCCCAGCCCTAGTGG + Intergenic
1026939115 7:74276754-74276776 TCTCTGTCCCCCACTCCTTTGGG - Intergenic
1029519222 7:101049530-101049552 TCTATTTCTCCCAGTTCTAGGGG + Intronic
1030027400 7:105337767-105337789 TTTCTTTCTCACAGTGCTAGAGG - Intronic
1030496652 7:110309015-110309037 ACCCTTTCCCTCAGTGCATGTGG + Intergenic
1031042491 7:116853036-116853058 TGTCTTTATCCCAGTGCTTTGGG - Intronic
1031248493 7:119349528-119349550 TATTTTGCCCCAAGTGCTTGAGG - Intergenic
1031767563 7:125801107-125801129 TATCTCTCCCCCAGTGGTAGTGG + Intergenic
1032748830 7:134815376-134815398 TCTTTTTTCCCCAGTGCTAGTGG + Intronic
1034274887 7:149819703-149819725 TCTCTTTCCCACAGTGCCCGGGG + Intergenic
1034839246 7:154380616-154380638 TCTCTTTGCTCCAGTGCTATGGG + Intronic
1035449050 7:158963498-158963520 TCTCTGTGCCCCTGTGCCTGGGG + Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1036034530 8:5004507-5004529 TCCCAAGCCCCCAGTGCTTGTGG + Intergenic
1037103583 8:15078012-15078034 TCCCAGTCCCCCAGTGCATGGGG - Intronic
1038015706 8:23512894-23512916 ACTCTTTCCTCCTCTGCTTGGGG - Intergenic
1038797539 8:30723121-30723143 TCCCTTTGCCCCAGGGCCTGGGG - Intronic
1040490683 8:47919018-47919040 TCACTTACCCTCAGTGCTTCAGG - Intronic
1041358943 8:57030071-57030093 CCTCTGTCTCCCAGTGTTTGTGG + Intergenic
1042063849 8:64851413-64851435 CCTCTATCCCCCACTGCATGCGG + Intergenic
1043146816 8:76668938-76668960 TCTCTTTCTCTTAGTGTTTGGGG + Intergenic
1043358081 8:79437477-79437499 TCTCTTTTCCCTAGTGTTTCAGG - Intergenic
1044495766 8:92879382-92879404 TCTCTTTCATTCACTGCTTGAGG - Intergenic
1045354139 8:101370274-101370296 TCACTATCCCCCAGTGCTCTGGG + Intergenic
1047012489 8:120687140-120687162 CCTCTTTTTCCCAGTGTTTGGGG - Intronic
1047378124 8:124324312-124324334 TTTCTTTCCCCTAGAGCTTTTGG + Intronic
1048005576 8:130416815-130416837 GCTCTTTCCCACAGTGGTTGTGG - Intronic
1048137007 8:131756347-131756369 TCTTTTTCCCACAGAGGTTGTGG - Intergenic
1048219810 8:132530847-132530869 TCTCTTTCACCCATTCCTTTGGG + Intergenic
1048643011 8:136385585-136385607 TCTTTTTCCACCAGTGCTTCTGG - Intergenic
1048862489 8:138734126-138734148 TCTATTTCCCGCAGAGCTTTCGG - Intronic
1050059236 9:1687871-1687893 TCTGTATTCCCCAGTCCTTGGGG + Intergenic
1050912460 9:11089718-11089740 TCTCTTTTCCCCAGTAATGGGGG - Intergenic
1052536905 9:29759470-29759492 TCTCTTTCACCCATCCCTTGAGG - Intergenic
1053660755 9:40275895-40275917 CCCCATCCCCCCAGTGCTTGTGG + Intronic
1053911133 9:42905240-42905262 CCCCATCCCCCCAGTGCTTGTGG + Intergenic
1054523855 9:66100389-66100411 CCCCATCCCCCCAGTGCTTGTGG - Intergenic
1054680507 9:67911888-67911910 CCCCATCCCCCCAGTGCTTGTGG + Intergenic
1055938068 9:81621979-81622001 TGTCTTTACCACAGTGTTTGGGG + Intronic
1056537324 9:87540892-87540914 TCTCTTTCCCCGAGTTCATCTGG + Intronic
1056776499 9:89516662-89516684 TTTCTTTCTTCCAGTGCTTGGGG - Intergenic
1057538503 9:95941440-95941462 TCTCTTTCCTCCAGGGCTGGTGG + Exonic
1058637303 9:107049127-107049149 TCTCTTTCCCACAGTGAATTCGG - Intergenic
1059963197 9:119587687-119587709 TCTCTTGTCCCCAGTGCTTCTGG + Intergenic
1060059264 9:120444462-120444484 TCTCCTACCCCCAGTGCATGAGG + Intronic
1060550538 9:124482808-124482830 TCTCGTTGCCCAGGTGCTTGTGG + Exonic
1060810402 9:126608788-126608810 TCTCCTTCAACCAGGGCTTGAGG - Intergenic
1061887076 9:133596533-133596555 TGTCTCTCCCCCATGGCTTGAGG - Intergenic
1062044032 9:134417017-134417039 TCTCCATCACCCAGTGCTGGTGG + Intronic
1062100538 9:134726077-134726099 ACTCTCTTCCCCAGTGGTTGAGG + Intronic
1062167220 9:135113863-135113885 TCACTGTCACCCAGTGCTGGAGG + Intronic
1062211381 9:135366098-135366120 TCTGGTCTCCCCAGTGCTTGGGG + Intergenic
1062443697 9:136584563-136584585 TCTCTCTACCCCACTGCTGGGGG + Intergenic
1062496132 9:136832612-136832634 TCAGTTTCCCCCAGTGTTTTTGG + Intronic
1203785757 EBV:126532-126554 TCTCTTTCACCACGTACTTGCGG - Intergenic
1186032527 X:5385495-5385517 TTTCTTTCCCCCAGGGCCAGAGG + Intergenic
1187214928 X:17266978-17267000 TCTCTTTCTCCCTCTGCCTGTGG - Intergenic
1188042952 X:25391266-25391288 TCTCTTTCACCCAGTGTTTAGGG + Intergenic
1188179318 X:27034581-27034603 TCCCATTCCCCCAGTGCATGTGG + Intergenic
1188374479 X:29410936-29410958 TCTCTTTCCTTCAGTCCTTTTGG + Intronic
1189978909 X:46489640-46489662 TCTTTTTCCCTAAGTGCATGTGG - Intronic
1190912986 X:54789089-54789111 TCTCATTCCCCCACTGCTGTGGG + Intronic
1192118265 X:68432071-68432093 TCTCCTTCCCCCATTGTGTGTGG - Intronic
1202301318 Y:23418286-23418308 TCTCTTTCCCCTACTGATTAAGG - Intergenic
1202569493 Y:26252312-26252334 TCTCTTTCCCCTACTGATTAAGG + Intergenic