ID: 1170780821

View in Genome Browser
Species Human (GRCh38)
Location 20:19423863-19423885
Sequence TCGTATCATGCACTCTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170780821_1170780829 9 Left 1170780821 20:19423863-19423885 CCACAACAGAGTGCATGATACGA 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1170780829 20:19423895-19423917 GCACCCAAGCCTGGAGGGGTAGG 0: 1
1: 1
2: 1
3: 27
4: 250
1170780821_1170780830 10 Left 1170780821 20:19423863-19423885 CCACAACAGAGTGCATGATACGA 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1170780830 20:19423896-19423918 CACCCAAGCCTGGAGGGGTAGGG 0: 1
1: 0
2: 2
3: 29
4: 316
1170780821_1170780835 15 Left 1170780821 20:19423863-19423885 CCACAACAGAGTGCATGATACGA 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1170780835 20:19423901-19423923 AAGCCTGGAGGGGTAGGGGAGGG 0: 1
1: 1
2: 10
3: 93
4: 831
1170780821_1170780825 0 Left 1170780821 20:19423863-19423885 CCACAACAGAGTGCATGATACGA 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1170780825 20:19423886-19423908 TGGAGGTAGGCACCCAAGCCTGG 0: 1
1: 0
2: 0
3: 12
4: 188
1170780821_1170780828 5 Left 1170780821 20:19423863-19423885 CCACAACAGAGTGCATGATACGA 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1170780828 20:19423891-19423913 GTAGGCACCCAAGCCTGGAGGGG 0: 1
1: 0
2: 2
3: 17
4: 170
1170780821_1170780838 24 Left 1170780821 20:19423863-19423885 CCACAACAGAGTGCATGATACGA 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1170780838 20:19423910-19423932 GGGGTAGGGGAGGGGTGTGCAGG 0: 1
1: 0
2: 17
3: 179
4: 1802
1170780821_1170780827 4 Left 1170780821 20:19423863-19423885 CCACAACAGAGTGCATGATACGA 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1170780827 20:19423890-19423912 GGTAGGCACCCAAGCCTGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 157
1170780821_1170780826 3 Left 1170780821 20:19423863-19423885 CCACAACAGAGTGCATGATACGA 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1170780826 20:19423889-19423911 AGGTAGGCACCCAAGCCTGGAGG 0: 1
1: 1
2: 1
3: 13
4: 170
1170780821_1170780831 11 Left 1170780821 20:19423863-19423885 CCACAACAGAGTGCATGATACGA 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1170780831 20:19423897-19423919 ACCCAAGCCTGGAGGGGTAGGGG 0: 1
1: 0
2: 1
3: 44
4: 376
1170780821_1170780836 16 Left 1170780821 20:19423863-19423885 CCACAACAGAGTGCATGATACGA 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1170780836 20:19423902-19423924 AGCCTGGAGGGGTAGGGGAGGGG 0: 1
1: 0
2: 5
3: 116
4: 1137
1170780821_1170780839 29 Left 1170780821 20:19423863-19423885 CCACAACAGAGTGCATGATACGA 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1170780839 20:19423915-19423937 AGGGGAGGGGTGTGCAGGAAAGG 0: 1
1: 0
2: 14
3: 192
4: 1984
1170780821_1170780834 14 Left 1170780821 20:19423863-19423885 CCACAACAGAGTGCATGATACGA 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1170780834 20:19423900-19423922 CAAGCCTGGAGGGGTAGGGGAGG 0: 1
1: 0
2: 5
3: 61
4: 541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170780821 Original CRISPR TCGTATCATGCACTCTGTTG TGG (reversed) Intronic
905530492 1:38674931-38674953 AAGTCTCATGAACTCTGTTGGGG - Intergenic
907972316 1:59395216-59395238 ACGTGTCATGCACTCTGTACCGG - Intronic
908097671 1:60757280-60757302 TTGTATCCTGCACAGTGTTGTGG - Intergenic
909974985 1:82035487-82035509 GGGTATCATGCAATTTGTTGAGG + Intergenic
916197619 1:162239627-162239649 TCATATCAGGCAATCTCTTGGGG - Intronic
916674829 1:167056213-167056235 ACATATCAGGCATTCTGTTGTGG - Intronic
918970738 1:191414906-191414928 TCATATCAAGCACTATGTTTGGG - Intergenic
923906852 1:238394552-238394574 TAGCATCATCCAATCTGTTGAGG - Intergenic
1068233924 10:54207617-54207639 TGGTATCAGGCACCCTGTGGAGG + Intronic
1069255684 10:66329298-66329320 TGGTATCATCCAATCTATTGAGG - Intronic
1072752157 10:97988977-97988999 GAGCATCATGCAATCTGTTGAGG + Intronic
1077879290 11:6335547-6335569 TAGTATCTTGCACTTTGTTGTGG - Intergenic
1080804089 11:35636030-35636052 AAGAATCATGCACTCTGGTGTGG - Intergenic
1082708408 11:56521621-56521643 TGGCATCATGCAATCTGCTGAGG - Intergenic
1086965795 11:93026865-93026887 GGGTATCATCCAATCTGTTGAGG + Intergenic
1091001895 11:131916810-131916832 TCCTTTCACTCACTCTGTTGTGG + Intronic
1093849820 12:24021780-24021802 TCGTATCATCCAATGTGATGTGG + Intergenic
1095636296 12:44437552-44437574 TCATACCATACAATCTGTTGAGG + Intergenic
1100282364 12:93130020-93130042 GTGTATCATGCCCTCTGTGGTGG - Intergenic
1101236140 12:102792253-102792275 TCCCATCATCCAATCTGTTGAGG - Intergenic
1102081593 12:110102621-110102643 TAGTATCCTGCCCTCAGTTGTGG - Intergenic
1108382991 13:49872088-49872110 TCGTATGATGCAGTCCTTTGTGG + Intergenic
1114339921 14:21732334-21732356 TTGTACCATGGACTATGTTGAGG + Intergenic
1116807910 14:49511406-49511428 GAGTATCATCCAATCTGTTGAGG - Intergenic
1117245398 14:53879862-53879884 TCTTATCAGGCACTCAGTTAAGG + Intergenic
1117632248 14:57706115-57706137 TTGATTCAAGCACTCTGTTGAGG - Intronic
1120712461 14:87807002-87807024 TGGTGTCATCCAATCTGTTGAGG - Intergenic
1127365738 15:58287984-58288006 TGGTATCATGTACTTAGTTGTGG - Intronic
1130114390 15:80993805-80993827 TCATATTATGCACTTTTTTGTGG - Intergenic
1140146666 16:72317865-72317887 TGGAATCATGCTCTTTGTTGGGG + Intergenic
1141739574 16:85881972-85881994 TTGTGTCATGGACTCTGTAGTGG - Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1144419105 17:15079742-15079764 TGGCATCATCCAATCTGTTGAGG - Intergenic
1151932384 17:77240860-77240882 TCTTATCATGCGCACAGTTGAGG - Intergenic
929018166 2:37522859-37522881 TGGTATCTTGGACTCTCTTGGGG - Intergenic
937667099 2:124500102-124500124 GGGTATCATCCACTCCGTTGAGG - Intronic
947955475 2:234186597-234186619 TCCTTTCATGCACTCAGTTCTGG - Intergenic
1170780821 20:19423863-19423885 TCGTATCATGCACTCTGTTGTGG - Intronic
1171420389 20:25013803-25013825 TGGTATCATGCACTGGGTAGTGG - Intronic
1177385145 21:20398967-20398989 TGGTCTCATACACTGTGTTGAGG - Intergenic
1182247464 22:28970752-28970774 ATGTATCATGCACTCTTTTTTGG - Intronic
956524385 3:70141436-70141458 GGGTATCATCCAATCTGTTGAGG - Intergenic
957998781 3:87726407-87726429 TCGTAGCATGCACTTTCCTGGGG - Intergenic
958864551 3:99485754-99485776 TCGGATCGTGCAATGTGTTGGGG - Intergenic
967090203 3:186128432-186128454 CCGTGTCAAGCACTCTGCTGGGG + Intronic
968709430 4:2102251-2102273 GTGGATCCTGCACTCTGTTGGGG - Intronic
969225228 4:5792337-5792359 TAGTATCATGCACTCTCTTTTGG - Intronic
970338614 4:15081149-15081171 TCCTATAATGCACTTTTTTGGGG + Intergenic
971487703 4:27176962-27176984 TCTTATCTTGCTCTCTCTTGTGG + Intergenic
976844382 4:89471221-89471243 TGGCATCATGCAGTCTGTTGAGG + Intergenic
980603768 4:135061981-135062003 CCCAATCATGCACTGTGTTGTGG + Intergenic
984891754 4:184500181-184500203 AGGCATCATCCACTCTGTTGAGG - Intergenic
993326155 5:86539585-86539607 TCTTTTCATGCTCACTGTTGTGG - Intergenic
993383316 5:87233079-87233101 GGGCATCATGCAGTCTGTTGAGG - Intergenic
998604298 5:143617709-143617731 GCTTATCATGCAGTTTGTTGTGG + Intergenic
1000577830 5:162996984-162997006 TCTTTTCCTGCACTGTGTTGAGG + Intergenic
1001534370 5:172488453-172488475 TCGTGACTGGCACTCTGTTGCGG + Intergenic
1012924482 6:105253917-105253939 ACGCATCATCCACTCCGTTGAGG + Intergenic
1015332992 6:132003320-132003342 GGGGATCATGCAATCTGTTGAGG + Intergenic
1017484889 6:154893376-154893398 TCGTATCATGAACTCTTTAGGGG + Intronic
1017697219 6:157028857-157028879 TCTTACCATCCACTGTGTTGTGG + Intronic
1025855049 7:65269319-65269341 TCCTATCAGGCACGCAGTTGGGG + Intergenic
1029782814 7:102751780-102751802 TAGTATCTTGCAGTCTGTTAAGG + Exonic
1032305637 7:130731132-130731154 TTGTATCATTCACTCTCTTGAGG + Intergenic
1040039607 8:42902842-42902864 TCGTATCAGGCATTGTGCTGAGG + Intronic
1043920623 8:85979430-85979452 GAGTATCATCCAATCTGTTGAGG - Intergenic
1044639648 8:94365321-94365343 TTGTATCATCCAATCTTTTGAGG - Intergenic
1053436766 9:38080748-38080770 TCGCACCATGCACTCTGTCCTGG + Intergenic
1053511596 9:38692675-38692697 TCGTATCATGCACGCCGATAGGG - Intergenic
1059075742 9:111192094-111192116 GGGTATCATCCAATCTGTTGAGG - Intergenic
1186311973 X:8330096-8330118 TCATAGCATGCACTGTGTTCTGG + Intergenic
1187310916 X:18141524-18141546 GAGCATCATGCAATCTGTTGAGG - Intergenic
1190736717 X:53260344-53260366 TCCTCTCATTCACTCTGTTCCGG - Intronic
1192592905 X:72375667-72375689 TGGCATCATCCAATCTGTTGAGG - Intronic
1197765469 X:130057029-130057051 TCGTATTGTGCACTCTGAGGGGG - Exonic
1199313499 X:146349085-146349107 TCCTATCATTCTCTCTCTTGTGG + Intergenic