ID: 1170781798

View in Genome Browser
Species Human (GRCh38)
Location 20:19431845-19431867
Sequence CTTAAAACCCTGACATTTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170781798_1170781800 22 Left 1170781798 20:19431845-19431867 CCGAGAAATGTCAGGGTTTTAAG 0: 1
1: 0
2: 4
3: 24
4: 239
Right 1170781800 20:19431890-19431912 TGAAAATAAGAAAGACTTTCTGG 0: 1
1: 0
2: 6
3: 57
4: 691
1170781798_1170781801 26 Left 1170781798 20:19431845-19431867 CCGAGAAATGTCAGGGTTTTAAG 0: 1
1: 0
2: 4
3: 24
4: 239
Right 1170781801 20:19431894-19431916 AATAAGAAAGACTTTCTGGATGG 0: 1
1: 0
2: 4
3: 43
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170781798 Original CRISPR CTTAAAACCCTGACATTTCT CGG (reversed) Intronic
902436621 1:16402141-16402163 CTTAACTCCCCGACACTTCTGGG - Intronic
902742930 1:18452491-18452513 CTTGAGTCCCTGAGATTTCTGGG - Intergenic
902779408 1:18694776-18694798 ACTAAGACCCTTACATTTCTGGG + Intronic
902812348 1:18895661-18895683 CTTGCAACCCTGACATCTCCTGG - Intronic
903719372 1:25393158-25393180 CTAAAAATCCTGCCAATTCTGGG - Intronic
905120700 1:35679629-35679651 CTTCAAACCCCCACATCTCTAGG + Intergenic
905828014 1:41041625-41041647 CTTAAAACTCTGACAATTCTAGG + Intronic
906223372 1:44100891-44100913 CTAAAAACCCTCACATTTTTAGG + Intergenic
909151507 1:72011595-72011617 CTCAAAAAGCTGACATTTTTGGG + Intronic
909750155 1:79149417-79149439 TAAAAAACCCTGGCATTTCTAGG + Intergenic
910826040 1:91408190-91408212 CTTGAAACCTCAACATTTCTTGG - Intergenic
910898418 1:92092810-92092832 CTTATATCCCAGACATTTTTTGG + Intronic
911048339 1:93648091-93648113 CTTAAAATTCTGAAATATCTGGG + Intronic
918246460 1:182664099-182664121 ATTAAACCTCTTACATTTCTAGG + Intronic
918296526 1:183162275-183162297 CTTAAAACACTTTCTTTTCTTGG - Intergenic
918655507 1:187020993-187021015 CTTAAAACCATACCATTTCATGG + Intergenic
918816204 1:189187892-189187914 CTTTAAACCCTTGGATTTCTTGG + Intergenic
919411761 1:197253806-197253828 CTTAAAACCTTGATAGTTTTTGG - Intergenic
919484712 1:198132227-198132249 CTTAAAACACTGTCATTTCTTGG - Intergenic
920508851 1:206536071-206536093 ATCAAAACCCTGGTATTTCTGGG + Intronic
921325489 1:213983433-213983455 CTTAAAACCCTGCCACAGCTTGG + Intronic
922311625 1:224397997-224398019 CTTACTACCCTGAATTTTCTTGG + Intronic
922847590 1:228700662-228700684 CCTAAAATTCTGACATGTCTTGG - Intergenic
923257836 1:232236452-232236474 TTTAAAACACTGGCACTTCTTGG + Intergenic
923321772 1:232841533-232841555 ATTAAAAACCTTGCATTTCTGGG + Intergenic
1062796658 10:349769-349791 CAAAAAACCCTGGCAATTCTGGG + Intronic
1063938275 10:11101509-11101531 CTTGAAACCCTCTCATGTCTTGG - Intronic
1064524718 10:16242721-16242743 CTGAAAATTATGACATTTCTTGG + Intergenic
1064803561 10:19104674-19104696 CTTAAAACCCTGAAATATATGGG - Intronic
1064867661 10:19899879-19899901 CTTCAAATCTTGATATTTCTTGG + Intronic
1067129863 10:43553509-43553531 CCTAAAATCCTGGCATTTTTGGG - Intergenic
1068084568 10:52359138-52359160 CTTAAACCACTGCCATTTCTAGG - Intergenic
1068506295 10:57903974-57903996 ATTAAGACCATGAAATTTCTTGG + Intergenic
1072259853 10:93659409-93659431 TTAAAAACTCAGACATTTCTTGG - Intronic
1073914857 10:108390410-108390432 CTTAAAACAATGTCATTTATTGG - Intergenic
1074067749 10:110033070-110033092 CTTTAAAACCTGACTTTTATAGG + Intronic
1074397026 10:113106530-113106552 CTTGAAATCCTGATTTTTCTCGG + Intronic
1075099301 10:119494932-119494954 CTTAACATCCTGATATTTATGGG + Intergenic
1075618333 10:123907613-123907635 CCAAAAGCTCTGACATTTCTGGG + Intronic
1075932501 10:126311463-126311485 CTAAAACCCCTGTAATTTCTCGG + Intronic
1076566011 10:131400079-131400101 CCTAAAATCCTGATCTTTCTGGG - Intergenic
1077636288 11:3843375-3843397 CTCTGAACCCTGTCATTTCTGGG - Intergenic
1078996835 11:16710522-16710544 CTTGAAACCCTGAGTTCTCTTGG + Intronic
1079591532 11:22189013-22189035 CTTTGAATCCTGACATTTTTAGG - Intergenic
1079846667 11:25480420-25480442 CTTACAATCCTGACTTTTCAAGG + Intergenic
1081138137 11:39464937-39464959 CATAAAAACATGACAGTTCTGGG - Intergenic
1082214916 11:49558209-49558231 CTTAAACCCCTGACAATGATTGG - Intergenic
1085790186 11:79490845-79490867 CTTAAAATTCTGAAATTACTTGG + Intergenic
1086551729 11:88060245-88060267 ATTAAAATCCTGACATCCCTGGG + Intergenic
1087318474 11:96632327-96632349 CTTAAAGCCCTGACATTCAAGGG + Intergenic
1087590546 11:100182680-100182702 TTTAAAACTATAACATTTCTAGG + Intronic
1091394578 12:146022-146044 CGTCAAACCCTGATATGTCTTGG - Intronic
1094379202 12:29824533-29824555 CTTTATACACTGACATTTCCAGG + Intergenic
1094740966 12:33288207-33288229 TGTAAAACCCTGAAAGTTCTGGG + Intergenic
1095529661 12:43171750-43171772 GTTAAAAAGCTGACAGTTCTAGG - Intergenic
1097588789 12:61547925-61547947 CTCAGAACCCTGACATCACTGGG - Intergenic
1098143236 12:67472013-67472035 CTTAAATGCCTGGCAGTTCTTGG - Intergenic
1099363324 12:81734873-81734895 CTTATAGCTCTGACTTTTCTGGG + Intronic
1099426232 12:82526546-82526568 ATTAATACTCTGACATTTTTAGG + Intergenic
1100098069 12:91068126-91068148 GTTAAAACCCTGAAATTATTTGG - Intergenic
1101109531 12:101472432-101472454 ATTAAAACCCTGATATTTCTAGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1102296286 12:111739395-111739417 CTTCAAACACTTACATTTCAAGG + Intronic
1103314039 12:120037433-120037455 CTTACAAGCCTGAAAATTCTCGG - Intronic
1104305278 12:127604788-127604810 CTGACCACCCTGACATTTTTAGG - Intergenic
1104372445 12:128235736-128235758 CTTGAAATCCTGAAATTTCAGGG + Intergenic
1105924412 13:24994157-24994179 CATCAATCCCTGTCATTTCTGGG - Intergenic
1108430617 13:50349656-50349678 CTTAAAACCCTAACTTGTTTAGG - Intronic
1111038954 13:82719281-82719303 ATTAAGAACCAGACATTTCTAGG + Intergenic
1111212920 13:85103707-85103729 ATTAAAACTATGAAATTTCTAGG + Intergenic
1112281018 13:98063335-98063357 CTTAAAAACCTGCCATTTCCTGG - Intergenic
1112489893 13:99852700-99852722 CCTAAAACACTGACAATTTTTGG - Intronic
1114871990 14:26669766-26669788 ATTAAAAGCCTGATATTTCGGGG + Intergenic
1114951111 14:27754943-27754965 CATAAAACTCTTGCATTTCTTGG - Intergenic
1114979917 14:28149939-28149961 ATTAAAATCCTCATATTTCTGGG + Intergenic
1116705328 14:48289295-48289317 CATAAAAACCTTACCTTTCTTGG + Intergenic
1116719614 14:48478276-48478298 TTTAAAAGCAGGACATTTCTTGG - Intergenic
1118055970 14:62080228-62080250 CTTGAGATCCTGCCATTTCTGGG - Intronic
1118408662 14:65452960-65452982 CTATCAACCCTGTCATTTCTGGG + Intronic
1118923503 14:70171083-70171105 CTGAAAACCCTGACACTTTGTGG + Intronic
1119368517 14:74117041-74117063 CTTAAATCTCTGAATTTTCTAGG + Intronic
1120390018 14:83894509-83894531 CATAGAACCTGGACATTTCTAGG + Intergenic
1121775002 14:96584634-96584656 CTCAAAACCCGGACATTTGTGGG + Intergenic
1124530319 15:30499922-30499944 CTTAAAACTATGAAATTTTTTGG + Intergenic
1124768340 15:32507766-32507788 CTTAAAACTATGAAATTTTTTGG - Intergenic
1125780612 15:42263077-42263099 TTAAAAACCCTGATTTTTCTGGG + Intronic
1128694126 15:69747663-69747685 AATAAAATCCTGACCTTTCTTGG + Intergenic
1128997730 15:72309206-72309228 CTTAAAACCCTTTCCTGTCTGGG - Intronic
1129745036 15:78012711-78012733 CTTAAAATATTGACTTTTCTTGG + Intronic
1130776404 15:86988847-86988869 CAGAAAACCCTGTCAATTCTGGG - Intronic
1130905555 15:88238257-88238279 ATTAAAATCCTCATATTTCTTGG - Intronic
1131306968 15:91253529-91253551 GTTAAAACACTGAGATTTCAGGG - Intronic
1134275212 16:12769878-12769900 CTTTAAATCCTGGCATTTCTTGG + Intronic
1135850072 16:25955451-25955473 CTTAAAACTCTAACTTTTATGGG - Intronic
1136651992 16:31680834-31680856 CTCAAGACGGTGACATTTCTTGG + Intergenic
1137753708 16:50885302-50885324 CATTAAACACTGAGATTTCTGGG - Intergenic
1138777070 16:59735829-59735851 CTTAAAAGTCTGACATGTTTTGG + Intronic
1138935852 16:61721769-61721791 CTAAAGTCCCTGAAATTTCTAGG - Intronic
1140291409 16:73662146-73662168 GTTAAAACCCTGATATTACAAGG + Intergenic
1140888258 16:79263166-79263188 CTTATAACCCTGGTATATCTAGG + Intergenic
1141871919 16:86792775-86792797 CTAAGAAGACTGACATTTCTGGG + Intergenic
1143716796 17:8778271-8778293 CTTAAAAATATCACATTTCTGGG + Intergenic
1144271229 17:13618186-13618208 CTTATAAACCTAAAATTTCTAGG - Intergenic
1145259606 17:21346953-21346975 ATTCAAGCCATGACATTTCTTGG - Intergenic
1145317012 17:21740995-21741017 ATTCAAGCCATGACATTTCTTGG + Intergenic
1145842163 17:28004544-28004566 CTTGAAACACTGACTTTACTTGG - Intergenic
1146514683 17:33480002-33480024 TTTAGAACCCGGAGATTTCTGGG - Intronic
1148485875 17:47990737-47990759 CATAAAAGCCTGACCCTTCTTGG - Intergenic
1150639770 17:66941727-66941749 ATTAAAACCCTGAGATTTGGGGG + Intergenic
1150886705 17:69094975-69094997 ACAATAACCCTGACATTTCTTGG + Intronic
1158636046 18:59159023-59159045 CTTAATATAATGACATTTCTGGG + Intergenic
1164389915 19:27809604-27809626 ATTAAAATCCTCATATTTCTGGG - Intergenic
1164612670 19:29643445-29643467 CTTAAAATCTTAACATGTCTCGG + Intergenic
1164889943 19:31814729-31814751 GTTAAAGCCCTGCCTTTTCTTGG + Intergenic
1164990612 19:32679970-32679992 CCCAAAACCCTGAGATTTATAGG + Intergenic
1165660055 19:37570143-37570165 CTTTAATGCCTGACATCTCTGGG + Intronic
1167620146 19:50556078-50556100 CATAGAAGCCTGACAATTCTCGG - Intronic
927701810 2:25273918-25273940 ATGAAAACCCCGACATTTCTGGG - Intronic
930307900 2:49699560-49699582 TTTGAAACCATGACATTCCTGGG + Intergenic
934486248 2:94714740-94714762 CATAAAACTCTTGCATTTCTTGG + Intergenic
935061972 2:99616143-99616165 CTTAAAACGCTCCCATTGCTTGG - Intronic
936558324 2:113515089-113515111 CTGCAAGCCCTGACATTCCTTGG + Intergenic
937551469 2:123097599-123097621 CTTAAAACCCCTAAATGTCTTGG - Intergenic
940687470 2:156871425-156871447 TTTAAAACCTGAACATTTCTGGG + Intergenic
941048017 2:160698253-160698275 TTTATATCCCTGACACTTCTTGG + Intergenic
941539081 2:166759899-166759921 TATAAAAACATGACATTTCTAGG - Intergenic
941609327 2:167641640-167641662 CTTAAAGCGCTGTCTTTTCTTGG + Intergenic
942242331 2:173974217-173974239 ATTAAAACTGTGGCATTTCTTGG + Intergenic
944329901 2:198453479-198453501 TTTAAAACACTCACCTTTCTTGG + Intronic
944741341 2:202615788-202615810 CTTACTACCCCGACAATTCTAGG + Intergenic
945358523 2:208867409-208867431 CTTTGGCCCCTGACATTTCTTGG - Intergenic
947505657 2:230706526-230706548 CTTATAACCCTGAGATCTGTGGG + Intergenic
947945616 2:234099395-234099417 CTTCAATCCTTGACATTTATTGG - Intergenic
1170056808 20:12214387-12214409 TTTAAAACGCTGAAAGTTCTGGG - Intergenic
1170079666 20:12459391-12459413 CTAAAGGCCCTAACATTTCTAGG - Intergenic
1170781798 20:19431845-19431867 CTTAAAACCCTGACATTTCTCGG - Intronic
1171035836 20:21712558-21712580 CTTAAAACCCTGAGGTTTCGAGG - Intronic
1171338729 20:24410410-24410432 ATTAAATCCTTGGCATTTCTAGG + Intergenic
1172210610 20:33195539-33195561 CTTAAAAAGCTGAGATTTCAAGG + Intergenic
1178554359 21:33574952-33574974 CTTAAAATCCTAACCTTTTTTGG + Intronic
1179593049 21:42423708-42423730 CTTTTATGCCTGACATTTCTGGG + Intronic
1182060893 22:27396497-27396519 CTGAAAACCCTGTGTTTTCTGGG + Intergenic
1182655203 22:31884517-31884539 CTTTAAACCCTTACCTTGCTTGG + Intronic
1182676304 22:32042446-32042468 CATCAAACCCTGACCTTCCTGGG - Intergenic
1182825467 22:33260961-33260983 TTGAAAACCCTGACATTTCTGGG - Intronic
1184005904 22:41708833-41708855 CTTAAGACCCAGACATCTGTTGG - Intronic
1184068545 22:42134451-42134473 GTTAAAACCTGGACATTTCACGG + Intergenic
1184446901 22:44553386-44553408 CTGAAAACCTTGAAAATTCTAGG + Intergenic
1185086590 22:48744197-48744219 CCTTAGTCCCTGACATTTCTTGG + Intronic
949693981 3:6672791-6672813 ATTGAAACCCTGACATACCTGGG + Intergenic
951630406 3:24714037-24714059 TTTAAAACACTGAGATTTCCTGG + Intergenic
954295097 3:49670095-49670117 CTTAACACCCTTGCCTTTCTGGG + Exonic
955875439 3:63485287-63485309 CTGAAAAACCTGAACTTTCTGGG - Intronic
956148254 3:66214017-66214039 CCGTAAACTCTGACATTTCTGGG - Intronic
956240910 3:67129736-67129758 ATTATGACCCTGACATTTGTGGG - Intergenic
956862627 3:73339542-73339564 CCTAAAAGCATGAAATTTCTTGG + Intergenic
957199390 3:77112542-77112564 CTTAAATCCTTGATCTTTCTCGG - Intronic
957236194 3:77595278-77595300 CTTAAAAGTCTGAGAATTCTAGG + Intronic
957484091 3:80834857-80834879 CTCAAAAGCCTAACATTTCTAGG - Intergenic
958143002 3:89587596-89587618 TTTACTACCCTGACAATTCTAGG - Intergenic
958436762 3:94106528-94106550 TCTAAAACACAGACATTTCTAGG - Intronic
960435363 3:117619903-117619925 CTTATCACTCTGACATTTGTAGG - Intergenic
965330910 3:167373363-167373385 CTTAAAATACAGTCATTTCTAGG - Intronic
965890035 3:173501068-173501090 CATAAAACTCTGAGATATCTTGG - Intronic
966367885 3:179210484-179210506 CTTCAATCACTGACATATCTGGG - Exonic
967410641 3:189163544-189163566 CTTAAAACCCTAACATTCATAGG + Intronic
967537634 3:190625157-190625179 CTTAAAACACTGACCATTATAGG + Intronic
969107410 4:4818174-4818196 TTTAAAAAGCTGACACTTCTTGG + Intergenic
970265649 4:14281466-14281488 CTTAAAATACTAACATTTCAGGG + Intergenic
971822313 4:31573819-31573841 CTTAATTCCCTGACATTTCGAGG + Intergenic
973235473 4:47898375-47898397 ATTAAAACCATGCCAATTCTAGG + Intronic
973685734 4:53367637-53367659 CTTAAAACCCAGACAGTGTTTGG - Intergenic
974642418 4:64648393-64648415 TTTCAAACTCTGCCATTTCTGGG + Intergenic
975171391 4:71235700-71235722 CTAAAAACGCTGTCATTCCTTGG + Intronic
976588474 4:86825288-86825310 TTTGAAAGCCTGACATTTCTGGG - Intronic
976850443 4:89539183-89539205 ACTAAAACACTGACCTTTCTTGG + Intergenic
976880930 4:89924313-89924335 TTTAAAACACTGAAAATTCTGGG + Intronic
978440051 4:108724601-108724623 CTTAAAAATCTGATATGTCTTGG + Intergenic
978689739 4:111492641-111492663 CTCAAGACCCTATCATTTCTTGG + Intergenic
979420251 4:120495318-120495340 CTTAAAAGACAGATATTTCTAGG - Intergenic
979620455 4:122793079-122793101 CCTAAAACTCTGATATGTCTTGG + Intergenic
981335267 4:143562301-143562323 CTTTGAACCCTGACATTTTTAGG - Intergenic
988478542 5:31609954-31609976 TTTATATCTCTGACATTTCTGGG - Intergenic
989819039 5:45772166-45772188 CTCAAAACCCCAACATTTCTTGG + Intergenic
990926011 5:61023643-61023665 TTTAAAACCCTCACATATATAGG + Intronic
991002543 5:61796899-61796921 GTTAAGTCCCTGACATTTCAGGG - Intergenic
991156211 5:63439535-63439557 CTCAAAACACAGAGATTTCTGGG + Intergenic
992149590 5:73889914-73889936 TTTAAAAACTTTACATTTCTGGG - Intronic
992614029 5:78532771-78532793 CTTTTCACCCTGACAATTCTAGG + Intronic
994756154 5:103796096-103796118 CTTAAAATTCTGACATGTCTTGG + Intergenic
994776881 5:104046444-104046466 CTTGAAACCTTCACATTTCAAGG - Intergenic
996213624 5:120841189-120841211 CCTAAAACCCTCCCATTTCTTGG - Intergenic
996301146 5:121987608-121987630 TTTAGAACCCAGACATTTCTTGG + Intronic
998827105 5:146113825-146113847 CTTAAAAACCAGAAACTTCTAGG + Exonic
1000221523 5:159219156-159219178 CATAGAACCCTGACAAGTCTGGG - Intergenic
1001367404 5:171157147-171157169 CTAAAAACCCAGATATTTCTTGG - Intronic
1003372070 6:5538173-5538195 CTTAAAACCCTGTCAGACCTGGG + Intronic
1003855893 6:10274167-10274189 GTTGAAACCTTGACATTTTTTGG - Intergenic
1003927730 6:10892591-10892613 CTTAAAACTCTGCCATTACCAGG - Intronic
1004167595 6:13270541-13270563 CTAAAACCCCTGGAATTTCTGGG - Intronic
1004737954 6:18427122-18427144 CTTAAGGCAGTGACATTTCTAGG - Intronic
1007950340 6:45866610-45866632 TTTAAATCCTTTACATTTCTTGG - Intergenic
1008327236 6:50197610-50197632 CTTAAAACACTGAAATATCCAGG - Intergenic
1009905002 6:69859451-69859473 CTTAAACCCCTGGGATCTCTTGG + Intergenic
1009946326 6:70346087-70346109 ATTATAATCCTTACATTTCTTGG + Intergenic
1011118903 6:83927957-83927979 CCTAAATCCCTGAAATTTCCTGG - Intronic
1012362615 6:98402279-98402301 CTAAAACACCTGACTTTTCTTGG + Intergenic
1012846336 6:104394180-104394202 CTTAAAACCATCTCATATCTAGG - Intergenic
1014571165 6:123009772-123009794 CTTAAAGTGCTGAGATTTCTAGG + Intronic
1014635902 6:123846181-123846203 CTTTCAACCCTATCATTTCTAGG + Intronic
1015100042 6:129466880-129466902 CTTAAAACTCTTAGAGTTCTCGG - Intronic
1016582905 6:145649446-145649468 CTTAAGTCCCTGACTTTTTTAGG - Intronic
1017226077 6:152022558-152022580 CTTAAAAGGCTGACTTTTCAGGG + Intronic
1017605328 6:156127183-156127205 CTTAACACCCTGAAATGTATGGG + Intergenic
1019385212 7:751518-751540 CTTTAAATCCTGACATATCATGG + Intronic
1019789021 7:2998387-2998409 CTTAAAGCCCAGACATGCCTGGG + Intronic
1020214650 7:6180303-6180325 CACAAAACACTGACATTTCTTGG + Intronic
1020669212 7:11085617-11085639 CTTAAAACACTATCTTTTCTTGG + Intronic
1021425323 7:20493583-20493605 TTTGAAACCCTAAGATTTCTCGG - Intergenic
1022258660 7:28683516-28683538 CATCAGACCCAGACATTTCTGGG + Intronic
1022331144 7:29380535-29380557 CTTAATACTCTTACATTTCTAGG + Intronic
1023913381 7:44570706-44570728 CTAAAAACACAGGCATTTCTGGG + Intronic
1027624517 7:80529970-80529992 CTTAAAACCTTTTCATTACTTGG - Intronic
1028406975 7:90485839-90485861 CTTAAAACCCTGCTAGATCTTGG + Intronic
1028666917 7:93355767-93355789 CCTATAACCCTCTCATTTCTGGG + Intronic
1030430447 7:109440145-109440167 CATAAAATCCTGATTTTTCTGGG + Intergenic
1031272890 7:119675909-119675931 CTTAAAACCATGACATGTCAAGG - Intergenic
1036019264 8:4824922-4824944 CGTAAAGCCAAGACATTTCTCGG + Intronic
1036951032 8:13139457-13139479 CCCAATACCCTGACTTTTCTAGG - Intronic
1036980441 8:13464147-13464169 CTTAAAACCCTGGGCTTTTTAGG + Intronic
1040277463 8:46021316-46021338 CTTTTAAGCCTGACATGTCTTGG + Intergenic
1040585141 8:48733937-48733959 CTTAAAACACTTTCATTTCTGGG - Intronic
1042838960 8:73104563-73104585 TTTAATATTCTGACATTTCTTGG - Intronic
1042842639 8:73139560-73139582 CCTAACACCCTGATAGTTCTGGG + Intergenic
1044379494 8:91517539-91517561 CTGATACTCCTGACATTTCTTGG - Intergenic
1044630869 8:94277657-94277679 CTTAAAAGGTGGACATTTCTGGG - Intergenic
1045389654 8:101702828-101702850 CTTGGAAGGCTGACATTTCTTGG - Intronic
1048090094 8:131231216-131231238 CTTATACCACTGACATTTCAAGG - Intergenic
1048274550 8:133056492-133056514 CTTGAAACCCTGTCCTTTCCAGG + Intronic
1049352896 8:142173533-142173555 CTCACAACCCTGAAATTCCTGGG - Intergenic
1049894541 9:101177-101199 CTGCAAGCCCTGACATTCCTTGG - Intergenic
1050529046 9:6572068-6572090 CATAAAACTATGAAATTTCTGGG + Intronic
1052479142 9:28999586-28999608 CTTCAAACTTTGTCATTTCTAGG + Intergenic
1053042516 9:34886528-34886550 CTTAAAACACTTTCCTTTCTTGG + Intergenic
1053443032 9:38131264-38131286 TTTAAAACTCTGACCTTTCTTGG - Intergenic
1053671551 9:40369585-40369607 CATAAAACTCTTGCATTTCTTGG - Intergenic
1053735747 9:41101167-41101189 CTGCAAGCCCTGACATTCCTTGG - Intergenic
1053921358 9:42995954-42995976 CATAAAACTCTTGCATTTCTTGG - Intergenic
1054382661 9:64509634-64509656 CATAAAACTCTTGCATTTCTTGG - Intergenic
1054513067 9:66006725-66006747 CATAAAACTCTTGCATTTCTTGG + Intergenic
1054692630 9:68330231-68330253 CTGCAAGCCCTGACATTCCTTGG + Intronic
1058227368 9:102381984-102382006 CTTAAAACCCTGGCATTTAGTGG - Intergenic
1060508322 9:124214765-124214787 TTTGCAGCCCTGACATTTCTGGG + Intergenic
1061477662 9:130879536-130879558 TTTAAAACCCACACAGTTCTTGG - Intronic
1062120829 9:134833226-134833248 CTGAAAAACCTGACACTTCCAGG - Intronic
1062620546 9:137419203-137419225 CTAAAAATTCTGACATGTCTTGG + Intronic
1188323642 X:28772511-28772533 CTAAATACCCTCACATTTCCTGG - Intronic
1191812549 X:65204758-65204780 CTTAAAAACCTCACATATTTTGG + Intergenic
1192221247 X:69198769-69198791 CTAAAGACCCTGACATTCCCTGG + Intergenic
1193236066 X:79109358-79109380 TTTAAAACCTTGACATTTTAAGG + Intergenic
1193905607 X:87239960-87239982 ATTAAAACCCTGAAATAACTGGG - Intergenic
1195948702 X:110243577-110243599 CTTGAAACCCAGACATTCTTAGG + Intronic
1196608778 X:117687301-117687323 CTTAAATCTTTGACATTTCAAGG + Intergenic
1196960499 X:120994893-120994915 TTTAATACCATGACATTCCTTGG + Intergenic
1197183676 X:123563215-123563237 CTTCCAACCTTGACATTCCTAGG + Intergenic
1197702621 X:129610639-129610661 GTTAAACCCCTGAGATTTCAGGG - Intergenic
1199051387 X:143240498-143240520 CTTAAAGACCAGTCATTTCTTGG + Intergenic
1200052556 X:153442740-153442762 CTTAAAACCCTGGCCTTGGTTGG - Intergenic