ID: 1170785533

View in Genome Browser
Species Human (GRCh38)
Location 20:19463890-19463912
Sequence GGGGCAGCCCTGGTAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 319}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170785522_1170785533 4 Left 1170785522 20:19463863-19463885 CCTACAGGGCTTTCCCAAGATTG 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1170785533 20:19463890-19463912 GGGGCAGCCCTGGTAGTGGGTGG 0: 1
1: 0
2: 3
3: 41
4: 319
1170785528_1170785533 -9 Left 1170785528 20:19463876-19463898 CCCAAGATTGCTGGGGGGCAGCC 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1170785533 20:19463890-19463912 GGGGCAGCCCTGGTAGTGGGTGG 0: 1
1: 0
2: 3
3: 41
4: 319
1170785529_1170785533 -10 Left 1170785529 20:19463877-19463899 CCAAGATTGCTGGGGGGCAGCCC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1170785533 20:19463890-19463912 GGGGCAGCCCTGGTAGTGGGTGG 0: 1
1: 0
2: 3
3: 41
4: 319
1170785521_1170785533 12 Left 1170785521 20:19463855-19463877 CCTTGTCACCTACAGGGCTTTCC 0: 2
1: 0
2: 1
3: 29
4: 193
Right 1170785533 20:19463890-19463912 GGGGCAGCCCTGGTAGTGGGTGG 0: 1
1: 0
2: 3
3: 41
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170785533 Original CRISPR GGGGCAGCCCTGGTAGTGGG TGG Intronic
900188361 1:1343258-1343280 GGGGAAGCCCTGGGGGGGGGGGG - Intronic
900252641 1:1679057-1679079 GGGGCAGCCTTCGAGGTGGGAGG - Intronic
900396710 1:2456084-2456106 GGGGCAGCATTGGCTGTGGGTGG + Intronic
900401701 1:2475435-2475457 GGGGCAGCTGTGGGAATGGGAGG - Intronic
900410916 1:2512233-2512255 GGGGCAGCCATGGTTGGAGGCGG + Intronic
900498335 1:2987097-2987119 GGGTCACCCCTGGGAATGGGGGG - Intergenic
900716201 1:4146341-4146363 GTGGCAGGCCTGGTAGTGAGTGG - Intergenic
901028845 1:6294397-6294419 AGGGCAGCACTGGCATTGGGTGG - Intronic
901083650 1:6597683-6597705 AGGGCAGCTCTGGCAGTGCGAGG + Intronic
901469845 1:9448636-9448658 CAGGCAGCCCAGGGAGTGGGAGG + Intergenic
901660748 1:10796440-10796462 GCGGCAGCCCCGGGGGTGGGGGG + Intronic
902627008 1:17682723-17682745 TGGGCATTCCTGGTGGTGGGTGG + Intronic
903170290 1:21548218-21548240 GTGGCAGCCCTGGAAGCGGAGGG - Intronic
903594550 1:24484271-24484293 GGGGAACCCCTGGCAGTGGGAGG - Intergenic
903846766 1:26283556-26283578 GGGGCAGGAGTGGCAGTGGGAGG + Intronic
904392732 1:30196492-30196514 GGGGCAGGCCTGGGGGTGGGAGG - Intergenic
904412279 1:30331679-30331701 GGGGCTGCCCTGGTGGTAGAGGG - Intergenic
904613876 1:31739442-31739464 CAGGCAGCCCTGGCAGGGGGAGG - Exonic
905048923 1:35031786-35031808 GCGGCCGCAGTGGTAGTGGGCGG - Intronic
905240568 1:36578409-36578431 GAGGCAGCCCTAGCAGTGAGTGG - Intergenic
905250366 1:36644328-36644350 GGGGCTGCCCAGGTCGTGGGAGG - Intergenic
905920354 1:41715096-41715118 GAAGCAGCCCAGGCAGTGGGGGG - Intronic
907199486 1:52714192-52714214 GGCGCAGCCATGGGAGTGGGTGG + Intergenic
907509874 1:54950192-54950214 GGTGCAGGCCTGTGAGTGGGGGG + Intergenic
907560023 1:55379621-55379643 GGGGCATCCTTGGTAGTGGATGG - Intergenic
907574834 1:55517046-55517068 GAGGCAGCCCTGCTGGTGAGTGG + Intergenic
908850042 1:68366680-68366702 GGGGCATCCAGGGCAGTGGGAGG + Intergenic
910170380 1:84370811-84370833 GGGACAGCTGTGGGAGTGGGTGG + Intronic
912002590 1:104853656-104853678 GGGGCCGCAGTGGTAGGGGGCGG + Intergenic
912690425 1:111800791-111800813 GGGGCATCCCTGGTTGGGGCTGG + Intronic
912768572 1:112439826-112439848 AGGCCAACCCTGGAAGTGGGTGG - Intronic
912804400 1:112744007-112744029 GGGCCAGCCCTGGGGCTGGGAGG + Intergenic
912886522 1:113480343-113480365 GGGGCTGGCCTGGTACTGGGGGG + Intronic
916278663 1:163023934-163023956 GGGGCTGGCTTGATAGTGGGTGG + Intergenic
917495649 1:175537871-175537893 GGTGCAGAACTGGTGGTGGGGGG + Intronic
917628467 1:176869789-176869811 AGGGCAGCCCTGGCAGTGGGTGG + Intronic
918555927 1:185799489-185799511 GGACCAGCCCTGATTGTGGGGGG + Intronic
918597213 1:186307334-186307356 GGTGCAGACTTGGTAGTGGTGGG - Exonic
920365021 1:205443781-205443803 GGGCCAGCCCCTGAAGTGGGGGG + Intronic
920795304 1:209131107-209131129 GGGGCAGCGGTGGTGGCGGGCGG + Intergenic
921934798 1:220786772-220786794 GGGGCGGCGCGGGGAGTGGGAGG - Exonic
922404439 1:225298029-225298051 GGGTCACCCCTGGTGGTGGGAGG - Intronic
923559520 1:235028058-235028080 GGGGCAGAGCTGCTGGTGGGGGG - Intergenic
923625021 1:235606760-235606782 GGGGAAGTCCTGGCTGTGGGAGG + Intronic
924398925 1:243656411-243656433 GGGGGAGCCTTGGTATTGTGGGG + Intronic
1063339959 10:5253643-5253665 GGGGCAGGCCTGGGAGTGAGGGG + Intergenic
1063343777 10:5293008-5293030 GGGGCAGGCCTGGGAGTGAGGGG - Intergenic
1065981739 10:30904501-30904523 GGGGCAGAAGTGGAAGTGGGAGG - Intronic
1066020665 10:31297489-31297511 GGCTAAGCCCAGGTAGTGGGAGG + Intergenic
1066179316 10:32944287-32944309 CTGGCAGCGCTGCTAGTGGGCGG - Intronic
1066207973 10:33208420-33208442 GCAGCAGCACTGGCAGTGGGTGG - Intronic
1066262005 10:33738274-33738296 GTGTCAGCCCTGGTAGTGACCGG + Intergenic
1067251731 10:44592568-44592590 GGGGCTGACCTGGGAGTGGAGGG + Intergenic
1067744217 10:48923159-48923181 GGGGCAGAACTGGTTGTGTGGGG - Intronic
1070604761 10:77890912-77890934 GGGGGAGCCCTGGGAGGGTGTGG - Intronic
1071600742 10:86957705-86957727 GGGCCAGCCAGGGTAGTTGGGGG - Exonic
1073433699 10:103503173-103503195 GGGCCAGCCCAGGAAGTGGGAGG + Intronic
1074410844 10:113227256-113227278 GGGCCAGCCCTCCAAGTGGGTGG + Intergenic
1075088667 10:119430709-119430731 TGGGCAGCCCTGGTCGTGTGTGG + Intronic
1075140399 10:119828903-119828925 GGGGCAGCCCTGGTTCTGTGTGG - Exonic
1075664648 10:124221847-124221869 CGTGCAGCCCTGGCAGTGTGCGG - Intergenic
1076225220 10:128769326-128769348 GGTGCAGCCCTGATAGGGGACGG + Intergenic
1076532794 10:131155797-131155819 GGAGCAGCCCAGGGAGTGGGGGG - Intronic
1076533158 10:131159013-131159035 GGGGCTGCAGTGGAAGTGGGTGG - Intronic
1076652890 10:132002188-132002210 GGTGCAGCCTTGGTGGTAGGTGG - Intergenic
1076898295 10:133325014-133325036 GGGGGACCCCTGGTTCTGGGCGG - Intronic
1077046640 11:549635-549657 GGCGCTGCCCTCATAGTGGGTGG - Intronic
1077141849 11:1028191-1028213 GGGGCAGCCAGGGGAGTGGGGGG + Intronic
1077330356 11:1981471-1981493 CGGGCAGCCCTGGAAGTGCTGGG + Intronic
1077460273 11:2705616-2705638 GGGGCAGCTGTGGAAGTGGCAGG - Intronic
1077554280 11:3218463-3218485 CCGGCAGCCCTGGTAGCAGGCGG + Exonic
1078340840 11:10497121-10497143 GGGGCAGCTCTGGGAGTCAGTGG + Intronic
1078901949 11:15650304-15650326 GGGGCCGCCCTGGGACTCGGTGG + Intergenic
1079320572 11:19448211-19448233 GGGCCAGCCCTGGGAGGTGGCGG + Intronic
1079320745 11:19449542-19449564 GGGCCAGCCCTGGGAGGTGGCGG - Intronic
1080611294 11:33906322-33906344 GGGGCTGCCCTGGATGTGGCAGG + Intergenic
1080944773 11:36958643-36958665 GGGGCTGTCCCAGTAGTGGGTGG - Intergenic
1082798297 11:57394637-57394659 GGGTCAGACCTGGTACTGAGGGG + Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083596097 11:63918881-63918903 GGGGCAGCCCTGGAGTAGGGAGG - Intergenic
1083720562 11:64601672-64601694 GGGGCAGCCCTGGGGGAGAGTGG - Exonic
1083855016 11:65389020-65389042 GGGGCAGCTATGGTGGTGAGGGG + Intronic
1084766120 11:71309717-71309739 GGGGCAGACCTGGGATTGGGAGG + Intergenic
1086401573 11:86465286-86465308 GGTGCAGGCCTGGGGGTGGGAGG + Intronic
1090400683 11:126446714-126446736 GGGGCACCTCTGGCAGGGGGCGG - Intronic
1090653196 11:128824536-128824558 GGCTCAGCCCTGGGGGTGGGGGG + Intergenic
1091284774 11:134402501-134402523 GGGGGAGCCCTGGAAGTAGGAGG - Intronic
1202813335 11_KI270721v1_random:36650-36672 CGGGCAGCCCTGGAAGTGCTGGG + Intergenic
1091589928 12:1836910-1836932 GGGGCACCGCTGGGAGAGGGCGG + Intronic
1097140619 12:56899972-56899994 GGAGCAGCAGTGGTGGTGGGGGG + Intergenic
1097306666 12:58076424-58076446 TTTGCTGCCCTGGTAGTGGGTGG + Intergenic
1103412360 12:120721543-120721565 GGAGCAGCACTGGTGGTGGATGG - Exonic
1104376373 12:128267726-128267748 GGGGCAGCTCTGGGTCTGGGGGG - Intronic
1104980936 12:132572839-132572861 GGAGCAGCCCTGGGAGGTGGTGG + Intronic
1105986642 13:25573691-25573713 GTGGCAGCCCTGGTGCTGGGTGG + Intronic
1106342216 13:28841372-28841394 GTGGCAGTCATGGTAGTTGGAGG + Intronic
1108556942 13:51602920-51602942 GGGGCAGAGCTGGGAGTAGGGGG - Intronic
1110470693 13:75856431-75856453 GGGGCACTCCTGGGGGTGGGGGG - Intronic
1113749620 13:112768182-112768204 AGGGCCGCCCTGGCAGTGGCCGG - Intronic
1113778889 13:112964348-112964370 GGGGCAGCCCGGGTATTGCTAGG - Intronic
1114549807 14:23526211-23526233 GTGGCAGCAGTGGTGGTGGGTGG + Exonic
1114557781 14:23571635-23571657 GGGCCAGACCTGGTAGTCTGGGG - Intronic
1115868931 14:37778620-37778642 GGGGAGGCCCTGGTGGAGGGAGG + Intronic
1118437397 14:65784253-65784275 GGGGCAGGTGGGGTAGTGGGTGG + Intergenic
1118994486 14:70823483-70823505 GGGGCAGAGGTGGGAGTGGGAGG - Intergenic
1120974308 14:90235379-90235401 AGGCCAGCCCCGGGAGTGGGTGG + Intergenic
1122294545 14:100697914-100697936 GGGGCAGGGCTGGGAGGGGGCGG + Intergenic
1122366200 14:101196171-101196193 GGCGCAGCCCTGCCAGGGGGTGG - Intergenic
1122419481 14:101566411-101566433 GGGGCTGTCCTGGTTGAGGGAGG - Intergenic
1122603532 14:102932862-102932884 GGGGCAGGACTGGTGGGGGGGGG + Exonic
1122672607 14:103384217-103384239 AGGTAAGCCCTTGTAGTGGGGGG - Intergenic
1122736490 14:103846914-103846936 GGGGTCGCCCTGGGAGTCGGCGG - Intronic
1122783588 14:104153890-104153912 TGGGCAGCCCTGCTGGTGGATGG + Intronic
1122799364 14:104221989-104222011 GGGGCAGCCCTGGTGGGTGTGGG + Intergenic
1122834741 14:104425188-104425210 GGGGATGCCCAGGGAGTGGGGGG - Intergenic
1122919213 14:104873192-104873214 GGCTCAGTCCTGGGAGTGGGCGG + Intronic
1124155763 15:27224119-27224141 GGAGCAGCCCGGGAAGTTGGAGG - Intronic
1124210805 15:27763757-27763779 GAGGTTGCCCTGGTACTGGGTGG + Intronic
1125887654 15:43240693-43240715 GGGACAGCCTTGGTGGGGGGTGG + Intronic
1128353342 15:66906730-66906752 GGGGCTGGCCTGGTCGTGGCTGG - Intergenic
1129332789 15:74836411-74836433 AGGGCAGGCCTAGAAGTGGGTGG + Exonic
1129386594 15:75199710-75199732 TGGGCAGACCTGGTAGTGGTAGG + Intronic
1132331173 15:101013349-101013371 GAGGCCGCCCTGGTTGTGGGCGG + Intronic
1132676635 16:1123823-1123845 GGGGCAGCGCAGGCAGTCGGGGG - Intergenic
1132958934 16:2611675-2611697 GGGGCTGCCCTGGTTGTCTGGGG + Intergenic
1133129182 16:3665701-3665723 GGTGCAGCCCAGGGAGTGGCAGG - Intronic
1133230015 16:4361955-4361977 GGGGCAGCCCTGGTGGGGTGGGG + Intronic
1133236731 16:4390874-4390896 GGGGCAGCTGTGGTCCTGGGCGG - Intronic
1134091979 16:11396411-11396433 GGGGCCGCCCAGGCAGTTGGGGG + Intronic
1136248185 16:28986821-28986843 GGGGCAGCAGTGCTAGTGGCCGG - Exonic
1136414714 16:30096131-30096153 TGGGCTGGCCTGGGAGTGGGGGG + Exonic
1136618268 16:31411371-31411393 GGGGCAGCCCTGACAGTGTTGGG + Exonic
1137531498 16:49281488-49281510 CGAGCAGCCCTGGGGGTGGGGGG - Exonic
1137673211 16:50291334-50291356 GGGGCAGCTCTGGGGGTGGAGGG + Intronic
1137738515 16:50742403-50742425 GGGGAAGCCCCGGTGGGGGGGGG - Intronic
1141525212 16:84606768-84606790 GGTGCAGCCCTGGGAGGCGGGGG - Intronic
1141655938 16:85416547-85416569 GGGGGAGCCCGGGTTGAGGGTGG + Intergenic
1142071104 16:88091652-88091674 GGGCCAGCCCTGCTAGAGGAGGG + Intronic
1142593629 17:1019087-1019109 TGGGCAGACCTGGTGCTGGGAGG + Intronic
1142596422 17:1031978-1032000 GGGGCGGCCCTGGGCCTGGGAGG - Intronic
1143370078 17:6434167-6434189 GGGACAGCCCTGGGTGTCGGTGG - Intronic
1143452080 17:7042412-7042434 GGCACAGCCCTGGTTGGGGGCGG - Exonic
1144642154 17:16943604-16943626 GGGGCAGCCATGGGAGAAGGGGG - Intronic
1144784511 17:17824221-17824243 GGGGCTGCCCTAGAAGGGGGAGG - Intronic
1144848278 17:18231269-18231291 GGGGCTGGCCTGGCAGGGGGAGG - Intronic
1144849166 17:18235456-18235478 GGGCCAGCTCTGGGAGGGGGTGG - Exonic
1144856040 17:18268454-18268476 CCGGCAGCCCTGGGAGTGGGTGG - Intergenic
1144968487 17:19092584-19092606 GGCACAGCCCTGGGGGTGGGTGG + Intergenic
1144979430 17:19159479-19159501 GGCACAGCCCTGGGGGTGGGTGG - Intergenic
1144988792 17:19218753-19218775 GGCACAGCCCTGGGGGTGGGTGG + Intronic
1147035534 17:37677118-37677140 GAGTCAGGCATGGTAGTGGGTGG - Intergenic
1147381693 17:40060103-40060125 GGGACAGCCCTGGTGGTGGTGGG + Intronic
1147424933 17:40341966-40341988 GGGGCAGCCTGGGAAGGGGGAGG - Intronic
1148026966 17:44595197-44595219 GGGGCCACCCTGGGAGAGGGTGG - Intergenic
1148476493 17:47932105-47932127 GGGGCACCCCCTGTAGTCGGGGG - Intergenic
1149582689 17:57762259-57762281 GACACAGCCCTGGAAGTGGGTGG - Intergenic
1151186853 17:72371139-72371161 AGGGCAGGACTGGTTGTGGGTGG - Intergenic
1151404980 17:73880308-73880330 GTGGCAGCCCTAGGAGTTGGAGG - Intergenic
1151814934 17:76467110-76467132 TGGGCAGCCCTGGGAATGGGTGG + Intronic
1151962025 17:77410555-77410577 GCGGCAGCCCAGGCAGTGTGAGG - Intronic
1152072015 17:78138678-78138700 GTGGGAGCCCAGGTAGTGGAGGG - Exonic
1152091646 17:78250749-78250771 GGGGCAGCTCTGGGAGGGAGTGG + Intergenic
1152274126 17:79344437-79344459 GCAGCAGCTCTGGTAGGGGGTGG - Intronic
1152642277 17:81454228-81454250 GGGGGAGCCCAGGATGTGGGGGG + Intronic
1152804834 17:82350660-82350682 GGAGCAGTCATGCTAGTGGGGGG - Intergenic
1154092300 18:11377042-11377064 GGGACAGCCCTGGTATTTTGTGG + Intergenic
1157208044 18:45717275-45717297 GGGGCATCCCAGGTGGTTGGTGG - Intergenic
1157901188 18:51519611-51519633 GGAGCAGCACTGTCAGTGGGGGG - Intergenic
1159787116 18:72727323-72727345 GGAGAAGAACTGGTAGTGGGTGG - Intergenic
1160131111 18:76225722-76225744 GGGGCAGCACTGGGAGGAGGAGG - Intergenic
1160874586 19:1291141-1291163 GGGACAGCCCTGGGAGGGGCAGG + Intronic
1160900909 19:1427963-1427985 GAGGCAGCCCCGGAATTGGGGGG + Intronic
1160979845 19:1811927-1811949 GGGGCATCCCAGTTAGTGAGGGG - Intronic
1161299843 19:3537353-3537375 GGGGCGACCCTGGCAGTGGTTGG + Intronic
1161675829 19:5648421-5648443 GAGGCAGCTCAGGTAGTGGTAGG + Intronic
1161787028 19:6333127-6333149 GAGGCAGCTGTGGTAGGGGGAGG - Intronic
1162176298 19:8832573-8832595 GGGGCGGGGCTGGTTGTGGGCGG + Intronic
1163408013 19:17135741-17135763 TGGGCAGCCATGGTGGTGGGAGG + Intronic
1164495244 19:28754508-28754530 GAGGCTGCACTGTTAGTGGGTGG - Intergenic
1165243752 19:34486100-34486122 GGTGTGGCCCTGGGAGTGGGTGG - Intronic
1165925208 19:39321879-39321901 GGGGCAGGACTAGTAGGGGGTGG - Intergenic
1166078190 19:40426035-40426057 GGGGCAGCCACGAGAGTGGGCGG - Intergenic
1166812428 19:45522407-45522429 GGGGCAAACCTGGGGGTGGGGGG - Exonic
1167315079 19:48758082-48758104 GGGGCAGGCCTGGTAGTGGCAGG - Exonic
1167359209 19:49020920-49020942 TGGGCAGGCCTGGTAGAGGGAGG - Intergenic
1167366903 19:49059167-49059189 TGGGCAGGCCTGGCAGAGGGAGG - Intronic
1167483449 19:49746613-49746635 GGGGCAGCCCTGGGACGTGGCGG + Exonic
1202689606 1_KI270712v1_random:77750-77772 GAGGCAGACCTTGGAGTGGGCGG + Intergenic
926195735 2:10762710-10762732 CGGGCAGCCATGGAGGTGGGAGG - Intronic
926205066 2:10830028-10830050 GTGTCAGCCAAGGTAGTGGGGGG - Intronic
927003163 2:18820831-18820853 GGGGCAGTCGAGGAAGTGGGAGG - Intergenic
927189790 2:20509739-20509761 GGGGCAGGTATGATAGTGGGAGG - Intergenic
927322894 2:21768950-21768972 GGGGGAGCCGGGGTGGTGGGGGG + Intergenic
929201659 2:39243630-39243652 GGTGCTGCCCAGGGAGTGGGCGG - Intergenic
931486827 2:62702425-62702447 TGGGCAATCCTGGAAGTGGGAGG + Intronic
932780089 2:74554240-74554262 GGGGCGGCCCCGGTGGTGGCGGG + Exonic
934728030 2:96637865-96637887 GGGGCAGCCGGGGTCCTGGGCGG - Intronic
934892695 2:98084677-98084699 GGGGCAGCCTTGGGAGAGGTAGG - Intergenic
935084955 2:99835865-99835887 GGTGCAGCACTGGCGGTGGGAGG + Intronic
935184872 2:100722930-100722952 GGGGCAGACGTGGAGGTGGGCGG - Intergenic
935240246 2:101171616-101171638 GGGGCAGGGGTGGTGGTGGGGGG - Intronic
935707897 2:105872279-105872301 AGGGCAGGCCTGGTGGCGGGGGG - Intronic
937087732 2:119182374-119182396 TGTGCAGACCTGGAAGTGGGCGG + Intergenic
937449466 2:121989862-121989884 GGGCCAGCCCTGGGAATAGGGGG + Intergenic
937920226 2:127123652-127123674 GGGGCAGCGCTTGCAGTGAGCGG - Intergenic
938072103 2:128314230-128314252 GGGGCAGACCAGGTAGGGGTGGG - Intronic
938139611 2:128784850-128784872 GGGGCAGCCAAGGTAGGGGCAGG + Intergenic
938647777 2:133349259-133349281 AGGGCAGCCAGGGTAGTGGCTGG - Intronic
942108922 2:172660702-172660724 GGGGCAGCCCTGGTCGAAGCAGG + Intergenic
943511838 2:188836045-188836067 GGGGCAGCTGTGGTGCTGGGAGG - Intergenic
945840987 2:214887890-214887912 GGGGCGGAGCTTGTAGTGGGCGG + Intergenic
1169138953 20:3215592-3215614 GGGCCTGCCCTGGGAGTTGGAGG + Intronic
1169872498 20:10262907-10262929 GGGCCTGCCCTGGGGGTGGGCGG + Intronic
1169909556 20:10636407-10636429 GGGACACCCCTGGTATTGGGAGG - Intronic
1170134553 20:13058556-13058578 GATGCAGCCTTGGTAGTGGGGGG + Intronic
1170785533 20:19463890-19463912 GGGGCAGCCCTGGTAGTGGGTGG + Intronic
1172525101 20:35595995-35596017 GGGGTAGCCAGGGTAGTAGGTGG - Intergenic
1173332618 20:42087800-42087822 GGGGCAGAGGTTGTAGTGGGTGG + Intronic
1176126120 20:63475653-63475675 GGGGGAGCCCGGGCAGTAGGCGG - Intergenic
1177427917 21:20949139-20949161 TGGGCAGCCCTGCTGGTGGGTGG - Intergenic
1179090532 21:38261163-38261185 GGAGCTGCCCTGGTGTTGGGCGG + Intronic
1179586102 21:42375195-42375217 GGGGGAGGCGTGGAAGTGGGAGG - Intronic
1179586747 21:42378205-42378227 TGGGCAGCACTGCCAGTGGGTGG + Intronic
1180093411 21:45543553-45543575 GGGGTTGCCCTGCTGGTGGGCGG - Intronic
1180150270 21:45943742-45943764 GGAGCACTCCTGGTGGTGGGGGG + Intergenic
1181021914 22:20108028-20108050 GGGGCAGCCCTAGGACTGTGTGG + Intronic
1181311900 22:21949468-21949490 GAGGCAGCCCTGGGAGTGCCTGG + Intronic
1181431100 22:22882397-22882419 GGGGAAGCCCCAGTAGAGGGAGG - Intronic
1181572491 22:23775147-23775169 GGGGAAGCCCTGGAGGTGGGAGG + Intronic
1182293002 22:29296332-29296354 ACGGCAGCCTTGGCAGTGGGTGG - Exonic
1182476751 22:30580722-30580744 TGGGCAGCCCTGGTGGTGCGAGG - Intronic
1183268637 22:36846953-36846975 GGGGCAGCACAGGTGCTGGGAGG + Intergenic
1183301273 22:37060306-37060328 GCGTCAGCCCTGGCAGTGGTGGG - Intronic
1183516980 22:38272572-38272594 GGGGCGGCCCCGGGAGAGGGAGG - Intronic
1183744110 22:39683708-39683730 GGGGCAGGTCTGGGTGTGGGGGG - Intronic
1184155636 22:42664998-42665020 GAGGCAGCCTGGGTAGAGGGCGG - Intergenic
1184351294 22:43945793-43945815 GGGGCAGCCCTGGTGACTGGTGG + Intronic
1184416915 22:44357567-44357589 GGGGCAGACATGGTATTGTGTGG - Intergenic
1185187526 22:49411273-49411295 GGGACAGCAGTGGCAGTGGGGGG - Intergenic
1185363625 22:50424126-50424148 TGAGCAGCCCTGGCTGTGGGTGG + Intronic
949845040 3:8361359-8361381 GGACCAGCCCTGGAAGTGGGAGG + Intergenic
950610664 3:14124790-14124812 CGGGCAGGCCTGGGAGGGGGCGG - Exonic
953019045 3:39102605-39102627 GGGGCAGGTCTGGGTGTGGGCGG - Intronic
953584420 3:44186854-44186876 GGGGGAGCCAAGGTATTGGGAGG - Intergenic
954144071 3:48625679-48625701 GGTGGGGCCCTGGTGGTGGGTGG - Intergenic
954294435 3:49666252-49666274 GGGCCAGCACTGGTTGTGGGAGG + Intronic
956068362 3:65420383-65420405 GTGGCAGGCCTGGCAGTGAGGGG - Intronic
961652502 3:128423905-128423927 GGGGCAACCCTTGCAGCGGGTGG + Intergenic
961657759 3:128452720-128452742 GGGGCTGCCCTGGGGGTGGCGGG - Intergenic
962425252 3:135263717-135263739 GTGCAAGCCCTGGTAGGGGGTGG + Intergenic
963051274 3:141146094-141146116 GAGGCAGCTCTGGAAGAGGGTGG - Intronic
963228773 3:142889057-142889079 GGGGCGGCCCAGGTAGCCGGGGG + Exonic
963549674 3:146703320-146703342 GGAGCAGCTCTGGCAGAGGGTGG - Intergenic
968086878 3:195877781-195877803 GAGGCAGGCCTGGGAGGGGGTGG + Intronic
968515479 4:1013796-1013818 CGGTCAGCCATGGCAGTGGGCGG + Intronic
968881724 4:3303581-3303603 GAGCTTGCCCTGGTAGTGGGGGG + Intronic
968944296 4:3655458-3655480 GGGACAGCCCTGGGGGAGGGAGG - Intergenic
968952531 4:3702372-3702394 GGGTCAGTCCGGGCAGTGGGAGG - Intergenic
968952548 4:3702420-3702442 GGGTCAGTCCGGGCAGTGGGAGG - Intergenic
969639620 4:8389048-8389070 GGGGCAGCAGTGGTGGTGGGAGG - Intronic
969871407 4:10107234-10107256 GGGCCAGCTCTGGCAGTGGGAGG + Intronic
970094154 4:12443631-12443653 GGGGCAGCCCAGGTAAAAGGAGG - Intergenic
972110143 4:35547731-35547753 AGGGCATCCATGGTAGTTGGAGG + Intergenic
972396798 4:38664574-38664596 GGTGCAGCGCTGGTGTTGGGGGG + Intronic
978621941 4:110641410-110641432 GGGCCAGCCCTGGAGGTGCGTGG + Intronic
978795192 4:112701758-112701780 GGGGCAGCACTGGAAGTTTGAGG + Intergenic
981400952 4:144313430-144313452 GGGGAAGAACTGGTGGTGGGTGG + Intergenic
983432074 4:167663290-167663312 GGCTCAGCCCTGGTAGGAGGAGG + Intergenic
983908161 4:173206045-173206067 GGGGCTGGCCTGGCACTGGGTGG + Intronic
985041189 4:185893398-185893420 GCTCCAGCCCTGCTAGTGGGTGG - Intronic
985723164 5:1501315-1501337 GGGGCAGCCCTGGTGGACGCTGG + Intronic
985961188 5:3304603-3304625 GTGGCAGGGCTGGGAGTGGGGGG - Intergenic
988342137 5:29986356-29986378 GAGCCAGGCCTGGTGGTGGGTGG + Intergenic
988698710 5:33650622-33650644 GGGTCAGCCCTGGCAATGGAAGG - Intronic
989028673 5:37094007-37094029 GGTGGAGCGCTGGCAGTGGGGGG + Intergenic
992527572 5:77628039-77628061 GGGGGAGCCCTGGTAGGTGCTGG + Intergenic
995374961 5:111463681-111463703 GGGTCTGGGCTGGTAGTGGGGGG - Intronic
997427017 5:133810204-133810226 GGGGCAACCCTAGTAGTTAGTGG - Intergenic
998128057 5:139637571-139637593 GCGGCAGCCCAGGGAGTGTGTGG - Intergenic
998176708 5:139905670-139905692 GGGCCAGCTCTGGTGGGGGGGGG + Intronic
1001060769 5:168486762-168486784 GGGGGAGGCCTGGGAGAGGGTGG - Intronic
1001101046 5:168814495-168814517 GGGGCAGGACTGGTTGTTGGTGG + Intronic
1002103326 5:176868116-176868138 TGGGCAGCCCTGGGGGCGGGAGG - Exonic
1002525472 5:179813321-179813343 GGGGCCGCCTGGGTAGCGGGAGG + Intronic
1002789632 6:427706-427728 GGGGCAGCCCCGGTGCGGGGAGG - Intergenic
1003183791 6:3813391-3813413 GGGGAAGCCCTGGTCGTCTGGGG + Intergenic
1004688182 6:17968251-17968273 GGGACAGCCCTGTGAGTGGCAGG - Intronic
1005424948 6:25692783-25692805 GGGGCTGCCTTGGTTGGGGGTGG + Intronic
1006453246 6:34117496-34117518 GTGGCAGCTGAGGTAGTGGGTGG - Intronic
1009385320 6:63079744-63079766 GGGGCATCCAAGGAAGTGGGAGG + Intergenic
1011100007 6:83709431-83709453 GGGGGAGCCCTGGGCGTTGGGGG + Intronic
1013491481 6:110650668-110650690 AGGGCAGTCCTGGCAGAGGGAGG + Intronic
1013603830 6:111730180-111730202 GGCGCAGTGCTGGGAGTGGGCGG + Intronic
1016609513 6:145972676-145972698 GGCGCTGCCCTGCTAGTGGACGG - Intergenic
1017166779 6:151415901-151415923 GGGACAGTCCGGGTAGGGGGAGG + Intronic
1017233706 6:152098495-152098517 GGGACCGCCCTGGTAGGAGGTGG + Intronic
1017324706 6:153131426-153131448 GGGGCCGCCCGGGGAGGGGGCGG - Intergenic
1018378820 6:163239625-163239647 GGGGCAGCCGTGGGAGCAGGAGG - Intronic
1018391536 6:163345152-163345174 GGGGCAGCCCAGGAAGAGTGTGG + Intergenic
1018952548 6:168388709-168388731 GAGCCAGGCCTGCTAGTGGGAGG + Intergenic
1019381738 7:727505-727527 GGGGAAGCAGTGGTGGTGGGAGG - Intronic
1019712774 7:2525019-2525041 GGGGCCGCCCTGGAAGGGGCTGG + Intronic
1019778339 7:2925525-2925547 GGGGGAGCCCTGGAAGAGAGGGG + Intronic
1019781011 7:2939709-2939731 GGGCCAGCGCGGGCAGTGGGAGG - Intronic
1019985185 7:4650453-4650475 GGGGGAGCTCTGGAAGTGAGAGG - Intergenic
1020125160 7:5529493-5529515 GGGGCAGCCCCGGGAGCGGGCGG - Intronic
1020358830 7:7305358-7305380 GGGGCAGCCTTGGAAGCTGGAGG - Intergenic
1022103580 7:27183409-27183431 GGGGCAGCCCAGGTGCTGGAAGG - Intronic
1023896099 7:44434241-44434263 GGGGCAGACCTGGCAGCTGGGGG - Intronic
1027587739 7:80078621-80078643 GTGGGAGGGCTGGTAGTGGGGGG + Intergenic
1029597844 7:101547100-101547122 GGGGCAGACCTGGCAGTGCTGGG - Intronic
1029743379 7:102503577-102503599 AGGGCAGCCCTGGGAATGGAGGG - Intronic
1029761368 7:102602738-102602760 AGGGCAGCCCTGGGAATGGAGGG - Intronic
1030902936 7:115147562-115147584 GGGCCAGCCCTGGCAGGAGGAGG - Intergenic
1034129023 7:148698907-148698929 GGGGCAGCCCCGGTAGCTGAGGG + Exonic
1034494143 7:151410080-151410102 GGCGCAGCCCGAGAAGTGGGAGG - Intronic
1035454937 7:159002001-159002023 CGGGCAGCCCTGGAGGTCGGGGG - Intergenic
1036088114 8:5635705-5635727 AGGTCAGCCTTGGTAGGGGGAGG + Intergenic
1036527764 8:9551139-9551161 GTGGCAGCCCAGGCAGTGAGAGG - Intergenic
1036730013 8:11254316-11254338 GGGGCAGCCCTGTTAGTCCTGGG + Intergenic
1037407573 8:18559827-18559849 GAGCAAGCCCTGGTATTGGGAGG - Intronic
1037815480 8:22109542-22109564 GGGGCCGCCCTGGAACTGGGGGG + Intergenic
1038536037 8:28353275-28353297 GGGGCTGGCCTGGGGGTGGGGGG + Exonic
1038848443 8:31251465-31251487 CGGGCAGCACTGGCAGTGGTGGG + Intergenic
1039882019 8:41630931-41630953 TGGGCAGGCCTGGCTGTGGGAGG - Intergenic
1040569110 8:48592422-48592444 GGGGCAGACCTGGAAGGGGAAGG + Intergenic
1040982001 8:53253427-53253449 GGAGCATCCTGGGTAGTGGGTGG + Intergenic
1041082674 8:54228188-54228210 GTGGCAGCCCAGGTGGTGAGAGG + Intergenic
1042392853 8:68256014-68256036 GGTGAAGCCATGGGAGTGGGTGG + Intergenic
1044115163 8:88327027-88327049 GGAGCAGCCCAGGCAGCGGGGGG + Intronic
1045343231 8:101272634-101272656 GGAGCAGGCAAGGTAGTGGGTGG - Intergenic
1045601612 8:103723587-103723609 TGGGCTGGCCTGGTACTGGGTGG + Intronic
1046702449 8:117416942-117416964 AGGGCAGCACTGGTAGTGAGAGG - Intergenic
1049199525 8:141333251-141333273 GGGGCAGGCCTGGAGGCGGGAGG + Intergenic
1049339711 8:142105591-142105613 GTGAGAGCCCTGGTGGTGGGTGG - Intergenic
1049598142 8:143494073-143494095 GGGGAAGCCTGGGGAGTGGGAGG + Intronic
1049797376 8:144502961-144502983 GTGGCAGCCCTGGTGGCAGGTGG - Intronic
1051418859 9:16870972-16870994 GGGGCTGCCCTGCTCGCGGGAGG + Intergenic
1052348780 9:27436979-27437001 GGGGAAGAGCTGGGAGTGGGGGG + Intronic
1052348789 9:27436998-27437020 GGGGAAGACCTGGGGGTGGGGGG + Intronic
1053619332 9:39799445-39799467 GGAGCAGCAGTGGTAGTGGTGGG - Intergenic
1053895166 9:42735883-42735905 GGAGCAGCAGTGGTAGTGGTGGG + Intergenic
1054264825 9:62907984-62908006 GGAGCAGCAGTGGTAGTGGTGGG + Intergenic
1056052963 9:82789140-82789162 GGGGCAGACCTAGAAGTGGGAGG - Intergenic
1056578816 9:87875637-87875659 GGGGCAGCCCAGGCAGAGAGGGG + Intergenic
1056992013 9:91421538-91421560 GGGGCGGGTCTGGTAGTGGCGGG - Intronic
1057666135 9:97046936-97046958 GGGGCAGCACTGGTGTGGGGAGG - Intergenic
1060015278 9:120081290-120081312 GAGGCTGGCCTTGTAGTGGGTGG - Intergenic
1060485104 9:124041557-124041579 GGTCCAGTCCTGGGAGTGGGGGG - Intergenic
1061483604 9:130909171-130909193 GGGGCAGAGCTGGTGGTGGAGGG - Intronic
1061829237 9:133280213-133280235 GGTCCAGCCCTGATACTGGGTGG + Intergenic
1061861823 9:133472311-133472333 GGGGGAGCCCTGGTGTGGGGGGG - Intronic
1062311891 9:135942774-135942796 GGGGCTGCCCTGGGAGGGCGGGG + Intronic
1062468492 9:136691942-136691964 GGGGCAGCCTTGGTAGTGGAGGG - Intergenic
1062578813 9:137220918-137220940 GGGGCCGCCGTGGCAGTGGCGGG + Exonic
1185479739 X:437482-437504 GAGGCGGCTCTGGGAGTGGGTGG - Intergenic
1189289653 X:39876102-39876124 GCTGCAGCCCTGGGAGTGGGAGG - Intergenic
1190113328 X:47609400-47609422 GGGGGAGCCCTGGGGCTGGGAGG - Intronic
1192234962 X:69289826-69289848 GGGGCAGCTGTGGGAGTGTGAGG + Intergenic
1193906574 X:87252726-87252748 GGGGCAGATCTGGAAGTGGCAGG - Intergenic
1195649176 X:107266750-107266772 GTTCCAGCCCTGTTAGTGGGAGG - Intergenic
1199613264 X:149635234-149635256 AGGGTAGCCCTGGGAGTGGGTGG + Intergenic
1201243254 Y:11979095-11979117 GGTGACGTCCTGGTAGTGGGAGG - Intergenic
1201948748 Y:19540491-19540513 GGGCCAGCACTGGGTGTGGGCGG - Intergenic