ID: 1170786353

View in Genome Browser
Species Human (GRCh38)
Location 20:19470974-19470996
Sequence CCTCAGAGGGAGACGGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170786347_1170786353 0 Left 1170786347 20:19470951-19470973 CCTAAAAGAAGGCATCAGGAGGG 0: 1
1: 0
2: 1
3: 44
4: 317
Right 1170786353 20:19470974-19470996 CCTCAGAGGGAGACGGCACAAGG 0: 1
1: 1
2: 2
3: 26
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170786353 Original CRISPR CCTCAGAGGGAGACGGCACA AGG Intronic
900611754 1:3547196-3547218 CCTCAGAGGGATGAGGCTCAGGG + Intronic
900866453 1:5272237-5272259 GCTCAGAGGGTGAGGACACAGGG - Intergenic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902603085 1:17553164-17553186 CCTCAGAGGGGGACTGGACTGGG + Intronic
904009478 1:27381664-27381686 GCTCCGAGGGAGAAGGCGCAGGG + Intronic
905276970 1:36824699-36824721 GCCCAGAGGGAGAAGGCAGAGGG + Intronic
910806350 1:91192724-91192746 CTTCAGAGGGAGTGGGGACACGG + Intergenic
910970743 1:92853348-92853370 CCTCAGTGGGATATGTCACAGGG - Intronic
911568535 1:99494305-99494327 CACCAGAGGGAGAAGGCACAAGG - Intergenic
911715000 1:101122971-101122993 CCTAAAAGTGAGACGACACAGGG + Intergenic
913290665 1:117268861-117268883 CCCCAGAGAGAAACGCCACAGGG - Intergenic
913433768 1:118825990-118826012 TCTCAGAATGAGAAGGCACAGGG - Intergenic
914863028 1:151401995-151402017 CCAGGGAGGGAGATGGCACATGG - Intergenic
914961336 1:152211784-152211806 CCTTAGAGGGAGACAACATATGG - Intergenic
919513648 1:198495036-198495058 CCTCAGGGACAGAGGGCACAGGG + Intergenic
922937409 1:229432950-229432972 CCGCAGAGGGAGCCGGCTCGGGG - Intronic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1063179686 10:3586429-3586451 CCTCAGACTGAGACTTCACAGGG + Intergenic
1065830468 10:29609717-29609739 CCTCAAAGGGAGCTGGCATATGG + Intronic
1066460059 10:35605369-35605391 CCTCAGAGGCAAACGGCTTAGGG + Intergenic
1067099643 10:43325270-43325292 CAACAGAGGCAGACTGCACATGG + Intergenic
1072948600 10:99833159-99833181 CCCCAGAGGAAGATGACACAGGG - Intronic
1073938829 10:108669912-108669934 CCTGAGAGGAAGACCACACAGGG - Intergenic
1074422095 10:113317999-113318021 CCTCAGAGGCAGATGTCTCAGGG - Intergenic
1074984123 10:118642251-118642273 CCTCAGAGGGAGACAGTCCATGG + Intergenic
1076735995 10:132459249-132459271 CCGCAGTGGGAGAGGACACAGGG + Intergenic
1076848756 10:133082762-133082784 GCTTACAGGGGGACGGCACAGGG - Intronic
1077227111 11:1443247-1443269 GCTCAGAGGGAGTCGGCCCGGGG - Intronic
1077411440 11:2405694-2405716 TCTCAGAGGGAGGAGTCACAGGG - Intronic
1077497306 11:2892468-2892490 CCTCAGTGGGAAACAGCACGTGG + Intronic
1077593790 11:3514007-3514029 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1084249602 11:67886735-67886757 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1085832529 11:79916735-79916757 CCTCTGAGGGAGAGGGAACACGG - Intergenic
1086925798 11:92639514-92639536 CCTCAGAGAGAGATGGGGCATGG - Intronic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1089497446 11:118914782-118914804 CCTCAGAGGGCGAGGCCACCAGG - Intronic
1090873761 11:130770684-130770706 CCTCACATGGATAAGGCACACGG + Intergenic
1092077281 12:5684277-5684299 CCTCAGAGGGATAGGGATCAGGG + Intronic
1092154644 12:6274337-6274359 TTACAGAGGGAGATGGCACAGGG + Intergenic
1092419889 12:8322134-8322156 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1096489934 12:52007692-52007714 CCTCAGAGTGAGAACGCACGCGG - Intronic
1097689856 12:62724526-62724548 CCTCAGAGGGAGAGGGTAGGTGG - Intronic
1099951490 12:89309187-89309209 CCTCAGAGAGAGACCCCTCAGGG - Intergenic
1102088854 12:110169317-110169339 TCGCAGAGGGAAAAGGCACATGG - Intronic
1102192755 12:111001464-111001486 CTTCAGAAGGAGGCGTCACATGG - Intergenic
1104526972 12:129532918-129532940 CCGCAGAGGGAAAAGGCACAGGG - Intronic
1104671256 12:130682124-130682146 CCTCACCGGGATACGGGACAAGG - Intronic
1105559083 13:21473579-21473601 CCTCAGTAGGATAGGGCACAGGG - Intergenic
1106899299 13:34338242-34338264 CCTCAGAGGCGGATGACACATGG - Intergenic
1107737880 13:43417187-43417209 CAACAGAGGGAGACGGGAGACGG + Intronic
1108213547 13:48161530-48161552 CCTCAGGTGGGGAGGGCACATGG + Intergenic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1113589914 13:111491224-111491246 CCTCAGAAGCTGACGGCAGAAGG + Intergenic
1113851749 13:113421818-113421840 CCTCAGGGAGAGAAGGCACTGGG - Intergenic
1113863744 13:113508080-113508102 CCACAGTGGGAAACGGCACCAGG - Intronic
1120590145 14:86364812-86364834 CCTCACAGGGAGCCAGCACCTGG + Intergenic
1121489392 14:94347033-94347055 ACTCAGAGGGAGCCGGGACCGGG - Intergenic
1121848790 14:97200052-97200074 CCTCACAGGGAGCCAGCACTTGG - Intergenic
1122324590 14:100874853-100874875 CCTCAGTGGGAGAAGCCCCAGGG - Intergenic
1123922687 15:25081594-25081616 CCACATGGGGAGACAGCACAAGG + Intergenic
1124533883 15:30527557-30527579 TGTCACAGGGAGAGGGCACAGGG + Intergenic
1124764765 15:32480052-32480074 TGTCACAGGGAGAGGGCACAGGG - Intergenic
1129169036 15:73796792-73796814 CCTCTGAGGGAGCAGGCCCAGGG - Intergenic
1129789380 15:78330814-78330836 AGTCAGAGGGAGACAGCACCAGG - Intergenic
1130184304 15:81664814-81664836 CCTGAAAGGGGGAAGGCACATGG - Intergenic
1131176433 15:90212218-90212240 CCCTGGAGGGAGACGGCACATGG - Intronic
1132738345 16:1398470-1398492 GCTCAGAGGGAGACTGAACGTGG + Exonic
1132826071 16:1906302-1906324 CTGCAGAGGGACACGGCACAGGG - Intergenic
1132988496 16:2780447-2780469 CCCCAGAGGGTGACACCACAGGG + Intergenic
1134821443 16:17250740-17250762 CCTCAGAAGGAGATGCCAAAGGG + Intronic
1135610742 16:23864881-23864903 CCCAAGAGGGAGAGGGCATAGGG - Intronic
1138593031 16:58012991-58013013 CCTCAGAGGGAACCAGCCCAGGG - Intronic
1139208736 16:65055248-65055270 CCATAGAAGGAGACTGCACAAGG - Intronic
1142468994 17:152095-152117 GCTCAGAGGTACACGGCACAGGG - Intronic
1143033327 17:3980409-3980431 CCACGGAGGGAGACGGCAGGTGG - Intergenic
1145158244 17:20556942-20556964 ACGGAGAGGGAGACGGCAGACGG - Intergenic
1146492023 17:33290472-33290494 CCTCCAAGGCAGACTGCACAAGG + Intronic
1146993191 17:37294797-37294819 CCCCAAAGGGGGACGGCCCAGGG - Intronic
1147120410 17:38332148-38332170 GCTCAGAGGGTGAGGACACAAGG + Intronic
1147924135 17:43936200-43936222 CCTCAGAGGGAAAGGGGGCAGGG + Intergenic
1151334498 17:73432000-73432022 CCTCAGAGGCAGCTGGCACCCGG + Intronic
1151448218 17:74181137-74181159 GCTCAGTGTGAGACAGCACAGGG - Intergenic
1151933442 17:77247364-77247386 CCTCAGAGGGCAACGGCAGTGGG - Intergenic
1152239171 17:79152634-79152656 CCCCAGAAGGAGACGGAAAAGGG + Intronic
1152570943 17:81121014-81121036 CCTCAGAGGGTGAGGGCCCCGGG - Exonic
1154284240 18:13036648-13036670 CCTCAGAGGGATGGGGCAAATGG - Intronic
1156357558 18:36355481-36355503 CCTCAGATGGAGACTACATATGG - Intronic
1156997654 18:43486620-43486642 CCCCAGACTGGGACGGCACAAGG + Intergenic
1157279444 18:46335969-46335991 CCTCAGATGGAGACAGGAAATGG - Intronic
1160839722 19:1140671-1140693 CGTCAGCAGGAGAAGGCACACGG + Intronic
1161124025 19:2546030-2546052 CATCAGGGTGAGAAGGCACAGGG + Intronic
1162192422 19:8957397-8957419 CCTCATAGGGCGACATCACAGGG - Exonic
1163316041 19:16541487-16541509 ACCCACAGGGAGACGGCAAAGGG + Intronic
1163928157 19:20364702-20364724 CTTCAGAGGGAGGCAGTACAGGG - Intergenic
1164219909 19:23184025-23184047 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1165993806 19:39831065-39831087 CCTCAGAGGGAGAGATCATATGG + Intronic
1166239296 19:41478875-41478897 CCTCAGAAGGAGAAGACTCAGGG - Intergenic
1168297889 19:55386548-55386570 CCTGGGAAGGAGGCGGCACAAGG - Exonic
926273887 2:11388878-11388900 GCTCAGAGGGAGGAGGCTCAGGG - Intergenic
929864778 2:45708802-45708824 CAACAGAGGGAGAAGGCACCTGG - Intronic
929930736 2:46253696-46253718 CCTGAGAGTGACACGGCCCAAGG + Intergenic
936344346 2:111663795-111663817 CAGCAGAGGGAGACGGCATTTGG - Intergenic
937114755 2:119397253-119397275 CCTCAGAGGGAGCCAGCCCCGGG - Intergenic
937328314 2:121005628-121005650 GCTCAGAGGGAGATGCCAAATGG + Intergenic
938191991 2:129291800-129291822 CCTCACAGGGAAACCTCACAGGG - Intergenic
938785856 2:134628742-134628764 CAGCAAAGGGAGACGGCACATGG - Intronic
940111965 2:150164840-150164862 ACTCAGAGGGAGAAGGAGCAAGG - Intergenic
942985304 2:182134028-182134050 CCTTAGAGGAAGAAGGGACAGGG + Intergenic
946128740 2:217587632-217587654 CCTGAGAAGGAGAAGACACAAGG - Intronic
947610946 2:231524880-231524902 CCTCAGAGGGAAACAGCAGGAGG - Exonic
1168970063 20:1924925-1924947 CCTCGGAGGGAGACGCCATTAGG + Intronic
1170786353 20:19470974-19470996 CCTCAGAGGGAGACGGCACAAGG + Intronic
1171847105 20:30283952-30283974 CCTCAGTGGAAGTCGGCTCAAGG + Intergenic
1173448263 20:43139334-43139356 CCACAGAGAGTGAAGGCACAGGG - Intronic
1174158923 20:48536576-48536598 CCCCAGGGTGAGACAGCACAAGG + Intergenic
1175538032 20:59729071-59729093 GCTCACAGGGAGAGGTCACAGGG + Intronic
1175773011 20:61635568-61635590 CCTGAGAAGGACAGGGCACAAGG + Intronic
1175935845 20:62513666-62513688 CCGCAGAGGGAGAGGGCTCATGG + Intergenic
1176104714 20:63380559-63380581 CCTCACAGGGAGCCGGCATGTGG + Intergenic
1176685088 21:9839675-9839697 CCTCGGAGGAAGTCGGCTCAAGG - Intergenic
1176982701 21:15401343-15401365 CCTCAAAGGGAGACAGTTCAAGG - Intergenic
1179297798 21:40078975-40078997 GCTCTGGGGGAGAAGGCACATGG + Exonic
1179614562 21:42573391-42573413 CCTCAGAGGGAGACAGCACAGGG - Intronic
1179800679 21:43810358-43810380 CCGCAGGGGGAGAGGTCACATGG - Intergenic
1180086186 21:45508977-45508999 CCTCTGAGGGAGACAGAGCAAGG + Intronic
1181437929 22:22921192-22921214 CCCCAGAGGGAGAGGGGAGAGGG - Intergenic
1182477320 22:30583220-30583242 CCCCAGGGGGAGAGGGAACAGGG + Intronic
1184341465 22:43888320-43888342 CCTGAGAGGTAGAAGGGACAAGG + Intronic
1184857980 22:47156871-47156893 CGACAGAAGGAGACGGCAAATGG - Intronic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950715062 3:14842135-14842157 CCTCAGAGGGAAATGGTAGAAGG - Intronic
951793713 3:26515481-26515503 CAACAGAGGGAGACGGGAGAGGG - Intergenic
954418572 3:50406413-50406435 CCTCAGAGGTACACTCCACAGGG + Intronic
956089263 3:65647874-65647896 CCTCAGATTGGGACAGCACAAGG + Intronic
957063843 3:75504691-75504713 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
957922478 3:86763255-86763277 CTGCAGAGGGATACAGCACAAGG - Intergenic
961787944 3:129358801-129358823 CCTCAGAGGCACAGCGCACATGG + Intergenic
961897577 3:130181327-130181349 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
963265717 3:143238400-143238422 ACTCAGAGGGACACGGCACATGG - Intergenic
963525403 3:146409360-146409382 CTTCAGAGGGAGGCAGTACAGGG + Intronic
965636891 3:170791487-170791509 CCTGAGAGATAGACAGCACATGG - Intronic
967981617 3:195069394-195069416 CCTCAGAGGCAGACAGCAAGGGG + Exonic
968517140 4:1020129-1020151 CGCCAGTGGGAGACGTCACAGGG + Intronic
968547590 4:1206714-1206736 CCCCTGAGGGAGACCTCACAGGG - Intronic
969007743 4:4034893-4034915 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
969228727 4:5815449-5815471 CCTCATAGGGAGACGGGAAATGG + Intronic
969745870 4:9071169-9071191 CTTCAGAGGGAGGCAGTACAGGG - Intergenic
972751183 4:41990701-41990723 TCGCAGACGGAGCCGGCACAGGG - Exonic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
974329283 4:60455783-60455805 CCTCAGAGGGAGGCAGGCCAGGG - Intergenic
977456391 4:97266384-97266406 CCACAGAGGGAGAAAGCAAAAGG - Intronic
985082493 4:186280415-186280437 CCTCACAGGCAGACGGGACAAGG - Intronic
985564481 5:608555-608577 CCTGTCAGGGAGACAGCACACGG + Intergenic
985775780 5:1841076-1841098 CCTCAGTGGGAGTCGGCCCAGGG - Intergenic
986076711 5:4345253-4345275 ACACAGAGGGAGAAGACACACGG - Intergenic
987061312 5:14246695-14246717 CCCCAGATGGAGAAGCCACAGGG - Intronic
989104591 5:37849612-37849634 CCACAGAGCGAGGCGGCAGAGGG + Intergenic
991435695 5:66596049-66596071 CGTCAGAGGGAGACGGCGAGCGG - Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
994081392 5:95711685-95711707 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
994670413 5:102755676-102755698 CCCCCTAGGGAGAGGGCACAAGG - Intronic
997409314 5:133679091-133679113 CCTGAGAGGGAGAGGGCATAGGG - Intergenic
1000813772 5:165894289-165894311 CCTAAGAGGGAGAAAGAACATGG - Intergenic
1001907326 5:175483964-175483986 CCTCAGAGGGACACACTACACGG - Intronic
1001958010 5:175861595-175861617 CCTAGAAGGGAGACGGCAGAGGG + Intronic
1002363826 5:178694947-178694969 CCTGAGAGAGAGAAGACACATGG + Intergenic
1002376823 5:178794888-178794910 TCACAGAGGCAGAGGGCACAAGG + Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1004936820 6:20516022-20516044 CCTCACAGGGAGGCAACACAGGG + Intergenic
1005738939 6:28773362-28773384 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1007315617 6:40986247-40986269 CCTCACAGGGAGCCAGCACCTGG + Intergenic
1016237966 6:141890860-141890882 CCTCACAGGGAGCCAGCACCAGG + Intergenic
1017794707 6:157833645-157833667 CTCCTGAGGGAGAAGGCACATGG - Intronic
1017907150 6:158764707-158764729 CCGCAGATGGAGACTGCTCAAGG - Exonic
1018378058 6:163232272-163232294 CCCCAGCGGGACACGGCACCTGG - Intronic
1019408752 7:897641-897663 CCTCAGATGGAGGGGGCACCTGG + Intergenic
1020328267 7:6993024-6993046 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1025775000 7:64553609-64553631 CATCAGAGGGAGACAGGAGAGGG - Intronic
1035268867 7:157708189-157708211 ACTCAGAGGCACACGGCACGGGG - Intronic
1036368358 8:8141091-8141113 CTTCAGAGGGAGGCAGTACAGGG - Intergenic
1036882530 8:12524551-12524573 CTTCAGAGGGAGGCAGTACAGGG + Intergenic
1037151453 8:15640333-15640355 CAGCAGAGGGAAAAGGCACACGG - Intronic
1037629225 8:20637831-20637853 CCTCAGAGAGAGACAGCACATGG - Intergenic
1037751363 8:21684508-21684530 CTTCAGAGGGAGAGGTCAGAGGG - Intergenic
1038520747 8:28230155-28230177 CCACTGAGAGGGACGGCACACGG - Intergenic
1039552507 8:38453287-38453309 CCTCCAGGGGAGACGGCACATGG - Intronic
1039793178 8:40891548-40891570 CCTCAGGGGCAGAGGGCCCAGGG - Intronic
1040915421 8:52563710-52563732 CCTCAGGAGGGGAGGGCACAGGG - Intronic
1046115428 8:109778371-109778393 CCTCAGAGGAAGAGGTCACCTGG + Intergenic
1047232340 8:123008230-123008252 CATTAGAGGGAGAGGCCACATGG + Intergenic
1047589304 8:126310409-126310431 ACTCAGAGGGAGATTACACAAGG - Intergenic
1050589546 9:7148086-7148108 CCTCACATGGAGCCGGCACCTGG - Intergenic
1051674711 9:19547333-19547355 TCTCAGAGGGGGACTGCACAGGG + Intronic
1051674868 9:19548730-19548752 TCTCAAAGGGGGACTGCACAGGG - Intronic
1052709756 9:32039056-32039078 CCTGAGAGGCAGAGGTCACAGGG + Intergenic
1058249117 9:102669224-102669246 CCACAGTAGGAGAGGGCACAAGG - Intergenic
1058953269 9:109923239-109923261 CCACAGAGGGAGAGGACACCAGG + Intronic
1059336684 9:113573464-113573486 GCTGTGAGGGAGGCGGCACATGG + Intronic
1061680811 9:132241702-132241724 CCTCGGAGGGTGACGGCGCCCGG - Intronic
1062033559 9:134372736-134372758 CCTCAGAGGGTGGCAGCACAGGG + Intronic
1186144955 X:6615571-6615593 CCTCTGAGGTAGAGAGCACAAGG + Intergenic
1189245757 X:39561996-39562018 CTTCAGAGGGTGACACCACAAGG + Intergenic
1192350313 X:70350463-70350485 CAACAGAGGGAGACGGGAGAGGG + Intronic
1196465411 X:115967667-115967689 CCTCAGAGGGGGACAGGTCATGG - Intergenic
1197838475 X:130720166-130720188 CCACAAAGGGAGAGGGCACTTGG - Intronic