ID: 1170787574

View in Genome Browser
Species Human (GRCh38)
Location 20:19480816-19480838
Sequence CCTGGGACACTGATCCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170787566_1170787574 27 Left 1170787566 20:19480766-19480788 CCAGTGAACTCAATCTAAGAGCT 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1170787574 20:19480816-19480838 CCTGGGACACTGATCCTTACTGG 0: 1
1: 0
2: 0
3: 11
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170787574 Original CRISPR CCTGGGACACTGATCCTTAC TGG Intronic
902236815 1:15062955-15062977 CCTGGCACAGTGCTCCTTCCAGG - Intronic
903434354 1:23335382-23335404 CCTGGGCCACAGACCCGTACTGG + Intronic
903953348 1:27009281-27009303 CCTGGGAAACTGAAGCTCACAGG + Intronic
905390471 1:37633177-37633199 CCTGGGACACTTAACCATTCAGG - Intronic
908903390 1:68981573-68981595 CATGGAACTCTGATCCTTCCTGG + Intergenic
911120641 1:94293202-94293224 CCTGGGACACTGGACCTTGATGG - Intergenic
911529583 1:99028877-99028899 CCTGGAACATTCTTCCTTACAGG - Intergenic
912742036 1:112207229-112207251 ACTTGGAAACTGATCCTTTCAGG - Intergenic
912865356 1:113251433-113251455 CCAGGGACAGGGATCCTTAGGGG - Intergenic
920720901 1:208385956-208385978 CCTGGGACATTGATGTTTTCTGG + Intergenic
920746586 1:208634838-208634860 GCTGGGACATTGATCTTTCCTGG + Intergenic
920905999 1:210168890-210168912 TCTGGGATACTGATCCTTTATGG - Intronic
922808860 1:228404951-228404973 CCTGAGCCACTGAACCTAACAGG + Intronic
1065411456 10:25433813-25433835 CCTGAGCCACTGAACCTGACTGG + Intronic
1066554284 10:36594081-36594103 CCTGAGACAATGATCTTCACTGG - Intergenic
1067040741 10:42951960-42951982 CCTGGGCCACTGACCCCTCCTGG - Intergenic
1069878242 10:71576187-71576209 CCTGGGACAGTGATCCTCAGGGG - Intronic
1070349260 10:75576158-75576180 CCTGGGACACTCAAGCTTAGTGG + Intronic
1073001622 10:100290083-100290105 TCTGGGACACTACTCCTTCCAGG + Exonic
1075348034 10:121698550-121698572 CCTGGGACAATGGTCCATTCAGG + Intergenic
1076247007 10:128955075-128955097 CCTTGGACACGGTTCCTTTCTGG + Intergenic
1077957860 11:7040227-7040249 CCTGGGCCACAGACCCCTACTGG + Intronic
1081574114 11:44308917-44308939 CCTGGGACCCTGAGCGCTACTGG - Intronic
1082706683 11:56501066-56501088 CCTGAGCCACTTATCCTTCCTGG - Intergenic
1083921605 11:65784091-65784113 CCTGGAACACTTTTCCCTACTGG - Intergenic
1087762349 11:102114237-102114259 CCTGGGACACTGACCCCCACTGG + Exonic
1088294473 11:108277216-108277238 CCTGGGACACTGAAGCTTGGTGG - Intronic
1088755654 11:112883158-112883180 CCTGGCACAGTGCTCCTTCCTGG - Intergenic
1089502684 11:118941491-118941513 CCTGGGATACTGCTCCCTCCTGG + Intronic
1093104405 12:15068662-15068684 CCTGGGCCACAGATCGGTACTGG + Intergenic
1093336044 12:17905903-17905925 CCTGGGACACTGAAGCTTGGTGG - Intergenic
1097278450 12:57829204-57829226 CCTGTGATCCTGATCCTTCCAGG - Intronic
1099748040 12:86732748-86732770 CCTGGGCCACAGATCAATACTGG - Intronic
1104136516 12:125944840-125944862 CCTGGGACTCTAATTCTTTCTGG - Intergenic
1110403085 13:75116535-75116557 CCTGGTACACTGGTCCTAATAGG + Intergenic
1116313943 14:43362571-43362593 CCTGGGCCACTGACCCATGCAGG + Intergenic
1117322201 14:54634669-54634691 CCTGGGACACAGACCGGTACTGG - Intronic
1123758616 15:23416005-23416027 CCTGGCACACGGATGCATACAGG + Intergenic
1123840173 15:24240189-24240211 CCTGGAAAACTGACACTTACAGG - Intergenic
1126900465 15:53309312-53309334 CATGGGAGGCTGATCCTTATAGG + Intergenic
1133529217 16:6639005-6639027 CCTTGGAAACTGATACTTTCAGG - Intronic
1134457719 16:14406856-14406878 CCTGGCACACAGATGCATACAGG - Intergenic
1136091687 16:27925347-27925369 CCGGGGACACTCATTCTTCCTGG - Intronic
1136527772 16:30843625-30843647 CCATGGACACTGAGCGTTACCGG + Intronic
1153409743 18:4780364-4780386 CATGGGACAATGAACCTTAATGG + Intergenic
1163744604 19:19037877-19037899 CCTGGGTCACAGACCCATACTGG + Intronic
1164787320 19:30943915-30943937 CCTGGGACACAGAGCTTGACTGG - Intergenic
1168619070 19:57862726-57862748 TCTGGGACACTGATACTGACAGG + Exonic
1168624615 19:57907574-57907596 TCTGGGACACTGATACTGACAGG - Exonic
927203463 2:20592542-20592564 CCTGGGAAACTGATCCTGATGGG - Intronic
934554839 2:95281743-95281765 CCTGGGCCCCAAATCCTTACAGG - Intronic
935057670 2:99581747-99581769 CCTGGACCACTCATCCTTTCAGG - Intronic
939604327 2:144235100-144235122 CATGGGACACTGATAGTTGCAGG + Intronic
941889314 2:170561582-170561604 CCTGGGATACAGATCCTGATGGG - Intronic
945046608 2:205787419-205787441 CCTGGGACACAGATCATTTCAGG - Intronic
947364681 2:229381567-229381589 CCTGGGACACTGAAGCTTGGTGG + Intronic
948458205 2:238117032-238117054 CTGGGGACCCTGAGCCTTACCGG - Exonic
1170787574 20:19480816-19480838 CCTGGGACACTGATCCTTACTGG + Intronic
1170880260 20:20290772-20290794 CCTGGCAAACTGATCATGACTGG - Intronic
1171000850 20:21414124-21414146 CCTGGGACACTGAAGCTTGGTGG + Intergenic
1171488456 20:25500271-25500293 CATGGGACACAGCTCCTTACAGG - Intronic
1178527419 21:33342995-33343017 TCTGGGACACTGCTCTTTCCTGG + Intronic
1179347708 21:40576402-40576424 GCTGGGACACTGATAATTATGGG + Intronic
1181443912 22:22953714-22953736 CCTGGGGCACTGCCCCTTGCAGG - Intergenic
1184696540 22:46142630-46142652 CCTGAGACACTGTTCCATAAGGG - Intergenic
1185112047 22:48905557-48905579 CATGGGACACTCATCCTTGGGGG - Intergenic
949420959 3:3865120-3865142 CCTTGAAAACTCATCCTTACAGG - Intronic
950574110 3:13820944-13820966 CCTGGGAGACTGCTGCCTACAGG - Intronic
951815594 3:26750514-26750536 CCTGAGACACAGGTCCTTAGTGG + Intergenic
956776303 3:72568255-72568277 CCTGGGTCACGGCTCCTTATGGG - Intergenic
964736331 3:159922454-159922476 CCTGGGACAGTGATCCTTTGTGG - Intergenic
965189463 3:165509283-165509305 GCTGGGACATTGATCTTTTCTGG + Intergenic
969414625 4:7050394-7050416 CCTGGGGAACTGAGCCTTCCTGG + Intronic
969661983 4:8535708-8535730 CCTTGGACATGGATGCTTACAGG - Intergenic
970560822 4:17280560-17280582 CCTGGGACACTGGTTCTCAATGG - Intergenic
985512201 5:319125-319147 CCTGGGCCACTGGTCCTCTCGGG - Intronic
985878822 5:2621843-2621865 TCTGTGACACTGACCCTTCCTGG + Intergenic
985918721 5:2949127-2949149 CCTGGGACACTGCTCCCCATTGG + Intergenic
992977699 5:82138076-82138098 CCTGGGACACTCAAGCTTGCTGG - Intronic
993955622 5:94228926-94228948 CCTGGGACTCTGACCATTCCAGG + Intronic
995022050 5:107377985-107378007 GCTGAGACACTGCTCCATACAGG - Exonic
999424739 5:151477249-151477271 CCTGGGACATTCACCCTTTCAGG - Intronic
999428889 5:151509398-151509420 CCTGGGTCACGGACCCATACTGG + Intronic
1002878791 6:1234337-1234359 CCTGGGAAACTTAGCCTTCCCGG + Intergenic
1016711417 6:147176890-147176912 CCTGGGAGATTGATTGTTACTGG - Intergenic
1016728987 6:147407301-147407323 CCTGGGACACTGACCCCCACTGG + Intergenic
1017988940 6:159469673-159469695 CATGGGGCACTGGTGCTTACAGG - Intergenic
1018559871 6:165090579-165090601 CCTGGTTCACTGATCCTGGCTGG + Intergenic
1021217119 7:17930707-17930729 CCTGGGCCACAGAGCATTACAGG + Intronic
1021240698 7:18197107-18197129 ACTGGGACATTGACCATTACTGG + Intronic
1023993237 7:45143030-45143052 CCTGGGACTCTCCTCCTTTCTGG - Intergenic
1024244938 7:47462254-47462276 GCTGTGACAATGATCGTTACTGG - Intronic
1024265918 7:47606383-47606405 CCTGGGACACTGGTGCTGACTGG + Intergenic
1033932177 7:146537700-146537722 CCTGGGACAGTGAGCATTTCAGG + Intronic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1034706111 7:153146525-153146547 CCTGAGACAATGATCCCTGCAGG - Intergenic
1035244462 7:157553316-157553338 CCTGGGAGACTGTCCCTCACTGG + Intronic
1035569651 8:663498-663520 TCTGGGACACGGATGCTCACAGG + Intronic
1041472391 8:58225274-58225296 CCTGGGAAACAGCTCCTTCCGGG + Intergenic
1045676616 8:104614799-104614821 CCTGGGCCACTGACCAGTACTGG - Intronic
1050720477 9:8583286-8583308 CCTGGGCCACAGATCATTACTGG - Intronic
1055571776 9:77624058-77624080 CCTGGGACACTCAAGCTTGCTGG + Intronic
1058903576 9:109462484-109462506 CCTTGCACACTGAACTTTACAGG + Intronic
1186719430 X:12287319-12287341 CCTGGGAGGCTGATCCTATCAGG - Intronic
1188921922 X:35987459-35987481 CCTGGGACACTGGCTCTTAGTGG - Intronic
1196938950 X:120756940-120756962 GCTGGGACACTGATTGATACAGG + Intergenic
1200835079 Y:7725174-7725196 CCTGGGAAACTGGTCCATTCAGG + Intergenic
1202256614 Y:22928127-22928149 CCAGGCACCCAGATCCTTACAGG - Intergenic
1202409605 Y:24561880-24561902 CCAGGCACCCAGATCCTTACAGG - Intergenic
1202461178 Y:25108197-25108219 CCAGGCACCCAGATCCTTACAGG + Intergenic