ID: 1170788143

View in Genome Browser
Species Human (GRCh38)
Location 20:19485712-19485734
Sequence CCTTAGGAGCTGTGGATCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170788143_1170788150 25 Left 1170788143 20:19485712-19485734 CCTCTGATCCACAGCTCCTAAGG 0: 1
1: 0
2: 0
3: 19
4: 136
Right 1170788150 20:19485760-19485782 CCCAAAACACACCTGCTCCAAGG 0: 1
1: 0
2: 2
3: 22
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170788143 Original CRISPR CCTTAGGAGCTGTGGATCAG AGG (reversed) Intronic
900800450 1:4733920-4733942 CCTTATGAGATGTGGATCAAAGG + Intronic
902604005 1:17558791-17558813 ACTGAGGAGCTGTGGCTCTGTGG + Intronic
902802203 1:18837620-18837642 CTTTAGGAGGTGTGGAGCAGAGG + Intergenic
904685776 1:32259266-32259288 CCTGAGAAGCTGTGAATGAGAGG - Intronic
908897505 1:68916936-68916958 GGTGAGGAGCTGTGGATGAGGGG - Intergenic
910412925 1:86965355-86965377 CCTTAGGAGCTGTGCAGAGGGGG - Intronic
912543659 1:110435517-110435539 ACTTAGAAGCTGTGCTTCAGGGG - Intergenic
916964390 1:169920372-169920394 CCTTAGGAGATGTAAATCTGAGG - Intergenic
917173594 1:172205409-172205431 CCTTAGGAGCTTTGTTTAAGTGG + Intronic
917731274 1:177877288-177877310 CCTTGGGAGCTGGGGAACACAGG - Intergenic
919672840 1:200353466-200353488 GCTCAGGAGCTGTGGAGCACAGG - Intergenic
921067939 1:211636081-211636103 CCTTTGGATTTGTGGATCTGTGG - Intergenic
922639766 1:227217596-227217618 CATTGGAAGCTGTGGAGCAGAGG - Intronic
923321911 1:232842717-232842739 TATTAGGAGCTGAGGATCAAAGG - Intergenic
924699539 1:246437308-246437330 CCCTGGGAACTGTGGATGAGGGG - Intronic
1068266490 10:54656683-54656705 CCTGAGGAACTGTGGATCCCTGG + Intronic
1071689689 10:87803852-87803874 CAATAGGAGCTGGGAATCAGAGG - Intronic
1075716894 10:124561027-124561049 CCTCAGGACCTGGGGATCAGTGG + Intronic
1076637320 10:131891046-131891068 CTTTAGGAGCCTTGGAGCAGTGG - Intergenic
1076717651 10:132374568-132374590 ACACAGAAGCTGTGGATCAGGGG - Intronic
1077896263 11:6455929-6455951 CCTTAAGAGCAGTGAATCAAAGG - Intronic
1079851710 11:25543506-25543528 CCTTGGGTACTGTAGATCAGAGG + Intergenic
1080380398 11:31764864-31764886 AATTTGTAGCTGTGGATCAGGGG - Intronic
1081915510 11:46727953-46727975 CATTAGGAGCTGAGGATGAGGGG - Intronic
1081993732 11:47350918-47350940 CCCCAGGAGCTGTGGATGAGGGG - Intronic
1084605784 11:70170834-70170856 CCTTATGGGCTGTGGCTCACGGG + Intronic
1086139495 11:83479454-83479476 CCTTAGCATCTGTGGGTCACAGG + Intronic
1091339884 11:134802059-134802081 CCGTAGGAGCTGGGGGCCAGGGG - Intergenic
1093721338 12:22445436-22445458 CCTTAGGAGATGTTGGTCAAAGG + Intergenic
1097243029 12:57589329-57589351 CCTTTGGTGCTGTGCTTCAGTGG - Intergenic
1098014220 12:66087623-66087645 CCATTGAAGCTGTGGATCAGTGG - Intergenic
1099312659 12:81047243-81047265 CCTTACTAGCTGTGGATCTTTGG + Intronic
1102574488 12:113847591-113847613 CCTGAGGAGCTGTGGTCCCGGGG + Intronic
1102864967 12:116367214-116367236 CCTTGGGAGCTGTGAGTGAGAGG + Intergenic
1112430877 13:99349294-99349316 CTTTAGGTGCTGTGTGTCAGGGG - Intronic
1113830914 13:113295226-113295248 CTTAAGAAGCAGTGGATCAGAGG + Intergenic
1114277034 14:21155798-21155820 CCTCTGGAGCTGGGGGTCAGTGG + Exonic
1115634613 14:35279623-35279645 CTTTAGGAGTTGGAGATCAGAGG - Intronic
1116566117 14:46446466-46446488 TATTAACAGCTGTGGATCAGCGG - Intergenic
1116922638 14:50596391-50596413 AGTTAGGAGCTGTGTTTCAGTGG - Intronic
1117947809 14:61048651-61048673 CTTTAGGAGCTCTGGATAAAAGG - Intronic
1119852942 14:77879038-77879060 CCTTGAGAGCTGTGGATGAAGGG - Intronic
1121561588 14:94880234-94880256 CATTGGGACCTGTGGATCACAGG - Intergenic
1121624516 14:95374493-95374515 CATCAGGAGCTGTGTGTCAGGGG + Intergenic
1124153195 15:27200651-27200673 CCTTGGGACGTGTGGACCAGCGG + Intronic
1125520973 15:40347666-40347688 CCTTAGGTGGTGTGGCTCAGGGG + Intergenic
1125853899 15:42931036-42931058 CCTAAGTAGATGTTGATCAGAGG - Intergenic
1126547511 15:49889244-49889266 CTGCAGGAGCTGAGGATCAGCGG - Intronic
1128231080 15:66035927-66035949 GCTGAGGGGCTGTGGCTCAGAGG - Intronic
1129030904 15:72616934-72616956 CCCTAGAAGCTGTGGCCCAGAGG + Intergenic
1129671135 15:77608279-77608301 CCTTACCAGCTGTAGATCACTGG + Intergenic
1130670793 15:85910716-85910738 GCTTAGGTGCTGTGGGTCTGAGG + Intergenic
1130676920 15:85961020-85961042 TCTAAGGAGCTGTGGGGCAGCGG + Intergenic
1130875584 15:88011165-88011187 ACTCAGGAGCTCTGGATGAGTGG - Intronic
1131045003 15:89307306-89307328 GCTTAGGAGCTTTGGAGGAGAGG + Intronic
1132344804 15:101101669-101101691 CCTCAGGAGGGGTGGATCCGTGG - Intergenic
1132805233 16:1772177-1772199 CCTTAGGGGCTGTGAGGCAGTGG - Exonic
1134641792 16:15834954-15834976 CCTGAGTAGCTGTGGACCACAGG - Intronic
1134680304 16:16120383-16120405 TTTGTGGAGCTGTGGATCAGAGG - Intronic
1135414497 16:22258383-22258405 GTTTAGGAGCTGTGGATGAAGGG + Intronic
1138051556 16:53783896-53783918 TCTTAGGTTCTGTAGATCAGTGG + Intronic
1138134654 16:54511235-54511257 CCTTAGGAATTGTGGGTCACAGG + Intergenic
1140740136 16:77934262-77934284 CCTGAAGAGCTGTGGTTCTGTGG + Intronic
1142323029 16:89397151-89397173 CCTGAGGAGCTCTGGCTCTGTGG - Intronic
1145007221 17:19344612-19344634 CCTTGGGAGCTGTGGTACAGAGG - Intronic
1146612382 17:34319247-34319269 GCTTAGGCTCTGTGGAGCAGAGG - Exonic
1147579733 17:41621542-41621564 TCTTAGGGGCTGGGGCTCAGGGG - Intronic
1149187939 17:54023623-54023645 CCTGAGGAGATGTTGATCAGAGG + Intergenic
1149615921 17:57998424-57998446 CCTCAGGTGCTGTGTATTAGAGG - Intronic
1150764043 17:67989099-67989121 CCTTAGTAGCTGGGGATTACAGG - Intergenic
1152011497 17:77721650-77721672 GCTTAGGAGCTTTGGCTGAGAGG - Intergenic
1152039004 17:77891108-77891130 CCTCAGGAGCTCTGGGTGAGGGG + Intergenic
1152291893 17:79444491-79444513 GCTTTGGAGCTGTGGCTCAGAGG - Intronic
1153564290 18:6404279-6404301 CCTGAGGTTCTGTGGATCAGGGG - Intronic
1155262068 18:24052807-24052829 CCTTAGAAGATGTGGCGCAGTGG + Intronic
1159586344 18:70287225-70287247 CAGTAGGAGCTGTGCAGCAGGGG - Intergenic
1160910781 19:1472845-1472867 CCTAAGGAGCTGAGGGTCTGAGG + Exonic
1163333881 19:16659501-16659523 CCTTCTGAGCTGGGGGTCAGGGG - Intronic
1163835464 19:19570778-19570800 CCTCAGGAGCTGGGCGTCAGGGG + Exonic
1166154422 19:40900149-40900171 CCGCAGGAGGTGTGGCTCAGCGG - Intergenic
1166662980 19:44659264-44659286 CTTTTAGAGCTGAGGATCAGAGG - Intronic
1166825726 19:45607721-45607743 CCAGAGGAGCTGTGGTTCAGAGG - Intronic
1167067493 19:47197711-47197733 ACTAAGGAGCTGTGGAAAAGAGG - Intronic
927225470 2:20760895-20760917 CATTAGGAGGTGAGGATCATGGG + Intronic
927562426 2:24083515-24083537 CCTCAGAAGCTGTAGAGCAGAGG + Intronic
929404476 2:41625897-41625919 CCTCACCAGCTGTTGATCAGAGG + Intergenic
929977924 2:46653236-46653258 CCATAGGAACTGAGGAACAGGGG + Intergenic
932290263 2:70571098-70571120 CCTTAGCAGCTCTCCATCAGAGG - Intergenic
934904191 2:98184769-98184791 CCTTTGGACCTGTGGACCTGGGG + Intronic
940148233 2:150570637-150570659 CCTTAGGAGATGGGAAGCAGAGG - Intergenic
946507523 2:220317570-220317592 CCTCAGGGGCTGTAGATCAGAGG - Intergenic
948252688 2:236543243-236543265 ACTCAGGGGATGTGGATCAGTGG + Intergenic
948409279 2:237746836-237746858 CCTTAGCAGCTGTGGCTAAGTGG + Intronic
948820143 2:240538601-240538623 ACTGGGGAGCTGTGGAGCAGGGG - Intronic
1169119209 20:3085118-3085140 GCCTAGGAGCTGTGGGGCAGGGG + Intergenic
1170788143 20:19485712-19485734 CCTTAGGAGCTGTGGATCAGAGG - Intronic
1179076898 21:38130698-38130720 ACTTAGGAGCTGTGGTCCATAGG + Intronic
1181985376 22:26796820-26796842 CCTTTGGGACTGTGGGTCAGTGG + Intergenic
1182658424 22:31907762-31907784 GTTCAGGAGCTGTGGGTCAGAGG + Intergenic
1183362627 22:37390595-37390617 CCTTTGCAGCTGCGGATCTGAGG - Intronic
1185380020 22:50503978-50504000 CGTGAGGAGCTGAGGAGCAGGGG - Intronic
950431650 3:12954386-12954408 CCTTGGTGGCTGTGGATCAATGG + Intronic
951159487 3:19400038-19400060 CCTCAGGCACTGTGAATCAGAGG - Intronic
961065018 3:123867836-123867858 GCTTATGAGCTGTGGACCTGAGG - Intronic
961818962 3:129565576-129565598 CCCTAGGAGCTGTGGGTCCCAGG + Intronic
964843979 3:161026320-161026342 CCTCAGCAGCTGTGGATTAAAGG - Intronic
965728502 3:171745650-171745672 CCTCAGGAGTTGTACATCAGGGG + Intronic
967495321 3:190137194-190137216 CCGTAGGAGATGTTGATCATGGG + Intergenic
968718561 4:2180566-2180588 CATTTGGAGCTCTGGATAAGAGG + Intronic
970051481 4:11919380-11919402 CGTTAGGTCCTGTGGATCAGAGG - Intergenic
971940092 4:33202736-33202758 CCTTAAGGGCTATGGATCAGAGG - Intergenic
974953969 4:68616233-68616255 CCTAAGGAGGTCTGGAGCAGCGG - Intronic
976764033 4:88580399-88580421 CCTGAGTAGCTGGGGATCACAGG - Intronic
982086810 4:151843873-151843895 CCATAGGATCAGAGGATCAGAGG + Intergenic
985287804 4:188354701-188354723 CTTTAGAAACTGTGGACCAGGGG + Intergenic
992457180 5:76926558-76926580 GGTTAGGAGCTGTGGAACAGGGG + Intergenic
998879139 5:146629390-146629412 CCTTAGGAGGTGAGGCTAAGAGG - Intronic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1001160924 5:169312096-169312118 CATTGGAAGCTTTGGATCAGAGG - Intergenic
1002577319 5:180181692-180181714 CATTTGGAGTTCTGGATCAGGGG - Intronic
1002863817 6:1103517-1103539 CCTAGGAAGCTGGGGATCAGAGG - Intergenic
1003522892 6:6873782-6873804 GCATAGACGCTGTGGATCAGTGG - Intergenic
1006646919 6:35521228-35521250 GCATAGGAGCTGAGGACCAGGGG - Intergenic
1007408473 6:41648204-41648226 GATTAGGAGCTGGGGCTCAGAGG - Intronic
1010305353 6:74315264-74315286 TCTTAGGAACTGTTGATCTGAGG - Intergenic
1017315968 6:153031803-153031825 CCATAGGAGCTGTTGCCCAGAGG + Intronic
1017680062 6:156854422-156854444 CCTTTGGGGCTGTGAAGCAGGGG + Intronic
1018519304 6:164628481-164628503 CCTCAGGAGGTGAGGATCACTGG - Intergenic
1019267209 7:124519-124541 CCTCAGGAGATGGGGATCACTGG + Intergenic
1021549098 7:21850981-21851003 TTTTAGGAGCTGTGAATCACTGG + Intronic
1022197867 7:28086452-28086474 CCTTAGGAGCTGATGATCTGAGG + Intronic
1028085586 7:86632878-86632900 CCTGAGGAGCAGTGAATGAGAGG + Intergenic
1030481678 7:110112241-110112263 CGTGAGGAGCTGAGGAACAGGGG + Intergenic
1030534778 7:110752632-110752654 CAGTAGGAGATGTGTATCAGAGG - Intronic
1033503082 7:141973409-141973431 GCTTGGTAGCTGTGGTTCAGTGG + Exonic
1034947170 7:155269934-155269956 CTTCAGGAGCAGTGGGTCAGTGG - Intergenic
1038672393 8:29592688-29592710 CTTGAGGATCTGTGGATCTGTGG + Intergenic
1045950456 8:107845899-107845921 CAGCAGGAGCTGTGGCTCAGGGG - Intergenic
1046660512 8:116943589-116943611 CAGTAGAAGCTGTGGATCAGGGG + Exonic
1047201336 8:122770198-122770220 CCTTAGGAGGGGTGGGACAGTGG + Intergenic
1047464376 8:125098424-125098446 CCTTAGGAGTTTTTGAGCAGAGG + Intronic
1048869918 8:138788930-138788952 ACTTAGCAGCTGTGTAACAGTGG - Intronic
1049772066 8:144387854-144387876 CCTTAGTAGCTGGGGATTACAGG + Intronic
1057635029 9:96756754-96756776 CCTTGGGAGCTGGGGGCCAGGGG - Exonic
1057740439 9:97706637-97706659 CCTTAGAAGATGGGGATGAGGGG - Intergenic
1060004744 9:119990032-119990054 GCTTAGGGGATGAGGATCAGGGG - Intergenic
1061067670 9:128288729-128288751 CCCTGGGAGCTGTGGACAAGGGG - Exonic
1061116965 9:128619849-128619871 CCAATGGATCTGTGGATCAGCGG + Intronic
1186730417 X:12403566-12403588 CCTTAGGAGCAGTGGGTTTGTGG - Intronic
1190437030 X:50435675-50435697 CATTAGGAGTTGTGTATGAGTGG + Intronic
1190914889 X:54804031-54804053 TCTTATGACCTGGGGATCAGAGG - Intergenic
1195198091 X:102518526-102518548 CTTTAGGATCTGTGGTACAGTGG - Intergenic
1198329485 X:135608682-135608704 TCTTAGAAGCTGAGCATCAGAGG + Intergenic
1198337149 X:135677673-135677695 TCTTAGAAGCTGAGCATCAGAGG - Intergenic
1199431122 X:147761131-147761153 CCTGAGTAGCTGGGGATTAGAGG + Intergenic
1199828900 X:151529107-151529129 CCTCATGACCTGTTGATCAGAGG + Intergenic