ID: 1170791114

View in Genome Browser
Species Human (GRCh38)
Location 20:19510377-19510399
Sequence CAGCACACAGCAGTGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 642
Summary {0: 1, 1: 0, 2: 3, 3: 90, 4: 548}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170791114_1170791118 5 Left 1170791114 20:19510377-19510399 CCATGCCCCACTGCTGTGTGCTG 0: 1
1: 0
2: 3
3: 90
4: 548
Right 1170791118 20:19510405-19510427 AATTATGTGTGTATAAGTTATGG 0: 1
1: 0
2: 7
3: 21
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170791114 Original CRISPR CAGCACACAGCAGTGGGGCA TGG (reversed) Intronic
900247907 1:1647554-1647576 CCACACACAGCCGTGGGCCAAGG - Intronic
900259133 1:1714709-1714731 CCACACACAGCCGTGGGCCAAGG - Intronic
900380428 1:2381461-2381483 CAGCACACAGCAGTGTCCCCAGG + Intronic
900499477 1:2994231-2994253 CAACACACAGCAGTGGGGAGAGG - Intergenic
901512426 1:9724163-9724185 TAGCACACAGCTCTGTGGCAGGG + Intronic
901863244 1:12088052-12088074 CAGCACTCAGCTGTGTGGCCGGG + Intronic
903177427 1:21589346-21589368 CAGGACTCAGGGGTGGGGCAAGG + Intergenic
904049572 1:27631185-27631207 GAGAACACAGCAGTGGGGGAGGG - Intronic
905557500 1:38898982-38899004 CCACACACTGCAGAGGGGCAGGG + Intronic
905919595 1:41710648-41710670 CAGGACACAGTATTAGGGCAGGG - Intronic
905937002 1:41832653-41832675 CAGCACAAAGCAGTGGTGCCTGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907656010 1:56342521-56342543 CAGGTCACAGCAGGGTGGCAGGG - Intergenic
908090985 1:60685677-60685699 CTGCACACAGCAGGGGGGCCTGG - Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
909715383 1:78701639-78701661 CAGCACAATGCAGTGGAGCAGGG + Intergenic
910402640 1:86852688-86852710 AAGTACACAGCAGCCGGGCATGG - Intergenic
910447827 1:87316922-87316944 AAGCACACAGCATTGTGCCATGG + Intergenic
911643616 1:100315741-100315763 CAGGACAAAGCAGGGTGGCAGGG - Intergenic
912206032 1:107510564-107510586 CTGCACACAGCAGGGGGCCCTGG - Intergenic
912536651 1:110378480-110378502 CAGCACAGTGCAGTGGCTCAAGG - Intronic
912547781 1:110463520-110463542 CAGGACACAGCAGAGTGGCAGGG - Intergenic
912978884 1:114352967-114352989 CAGCGAACAGCAGTGTGGCTGGG + Intergenic
915010289 1:152679078-152679100 CATCACCCAGAAGTGGGCCAAGG + Intergenic
915762745 1:158331324-158331346 CAGCTCCCAGCACTGGTGCAGGG - Intronic
917435577 1:175017698-175017720 CAGCACACAGAGGGTGGGCAAGG + Intronic
918591534 1:186246105-186246127 CTGCACACAGCAGGGGGCCCTGG + Intergenic
919422644 1:197389902-197389924 CAGCACGCAGCAGGGTGGCAGGG - Intronic
919500669 1:198334335-198334357 CAGCTCACATTAGTGGGTCATGG - Intergenic
919684024 1:200465030-200465052 CAGCACATGGCAGTTGTGCAGGG - Intergenic
919755506 1:201063733-201063755 CAGCACAGATCTGTGTGGCAGGG - Intronic
919803425 1:201366885-201366907 AAGCACACAGCCATGGGTCAGGG + Intronic
920195439 1:204223339-204223361 CAGCACAGGGCACTGGGGTAGGG + Intronic
920268988 1:204749062-204749084 CAGCACCCAGAGGTGGGGGAAGG - Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923311003 1:232735317-232735339 CAGCACACTGCAATGGGGCGTGG - Intergenic
923652927 1:235890503-235890525 AAGCACTGAGCAGAGGGGCAGGG - Intergenic
923658703 1:235940350-235940372 CAGCAAAGAGCTGTGGGTCAGGG + Intergenic
924941296 1:248813835-248813857 GAGCACACAGCACGGGGGGAGGG - Intronic
1063062663 10:2573901-2573923 AAGCACATAGCAGCTGGGCATGG - Intergenic
1064987509 10:21225869-21225891 CAGCTGACCACAGTGGGGCAGGG - Intergenic
1065078153 10:22101612-22101634 GAGGAGAGAGCAGTGGGGCAGGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066754887 10:38701076-38701098 CAGCACAGGGCAGTGATGCATGG + Intergenic
1067569332 10:47360107-47360129 CAGCACAGAGCTGGGGGGCATGG + Intergenic
1067706704 10:48611724-48611746 CTGCTCAGAACAGTGGGGCAGGG - Intronic
1068747991 10:60557033-60557055 CAGACGACAGCAGTGGGGGAGGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069099741 10:64305285-64305307 CCTCACACAGCAGGAGGGCAGGG + Intergenic
1070365450 10:75732604-75732626 CAGCACACAAGAGAGGGCCAGGG - Intronic
1070432885 10:76358976-76358998 CAGCACACAGATGTTCGGCAAGG + Intronic
1070570759 10:77638055-77638077 CAGCGCACACCCGTGGCGCACGG - Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072674123 10:97452882-97452904 CAGCACACACCTGTGAGGAAGGG - Exonic
1073942558 10:108714791-108714813 CTGCACAGAGCAGTGGGCCCTGG + Intergenic
1074496078 10:113981064-113981086 TAGCACACAGCTGTGGAGCTGGG + Intergenic
1075222995 10:120600798-120600820 CAGCACAGAGCAGGGGGAGAAGG - Intergenic
1075278540 10:121118232-121118254 CAGGGCACTGCAGTGAGGCAGGG + Intergenic
1075551912 10:123399334-123399356 AAGCACACAGCCATGGGGCCTGG + Intergenic
1075722848 10:124597599-124597621 CAGGAGAAAGCAGGGGGGCAGGG - Intronic
1075747442 10:124737516-124737538 GAGAACACAGCAGTAGGGCAGGG + Intronic
1076191034 10:128483601-128483623 CAGCACCCTGCCGTGGGGCACGG - Intergenic
1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076697809 10:132255596-132255618 CAGCACCCAGGAGAGGAGCAGGG + Intronic
1076731635 10:132442326-132442348 CAGCACAGAGCAGGGGCGCTGGG + Intergenic
1076742427 10:132493351-132493373 CAGCACTCAGCTGATGGGCAGGG - Intergenic
1077044578 11:538816-538838 CAGCCCACAGCTCTGGGGCGAGG + Exonic
1077367085 11:2165625-2165647 CAGCCCCCAGCAGAGGGGCAGGG - Intronic
1077389007 11:2290692-2290714 CAGTGCACAGCAGAGCGGCAAGG + Intergenic
1077419435 11:2443760-2443782 CTGCACACAGCCCTGAGGCAGGG - Intergenic
1077836795 11:5933281-5933303 AAGCACACAGGAGTGGGGGAAGG - Intronic
1078354634 11:10624731-10624753 CAGCACACTGGAGTCGGGTAGGG + Intronic
1078507761 11:11965244-11965266 CTGCACAGAGCCGTGGGGAATGG + Intronic
1079365700 11:19807515-19807537 CAGCCCCCACCATTGGGGCAAGG - Intronic
1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG + Intergenic
1079863123 11:25699507-25699529 CAGCACACAGCAGGGGGACCTGG + Intergenic
1080326222 11:31076632-31076654 AAACAAACAGCAGTTGGGCATGG - Intronic
1080485797 11:32705125-32705147 CGGGAAACAGCAGTGGGGCTAGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081719826 11:45280299-45280321 CAGCACACAGGAGGTGGCCATGG + Intronic
1081720029 11:45281910-45281932 CAGGACTGAGCCGTGGGGCAAGG + Intronic
1081765881 11:45609878-45609900 CAGCACACAACAGGGGGTCAGGG + Intergenic
1081960454 11:47132670-47132692 CAGCACAGGGTAGTTGGGCAGGG - Intronic
1083578795 11:63812048-63812070 CAGAGCAGAGCAGAGGGGCACGG + Intergenic
1083589155 11:63882763-63882785 CAGTATACAGCAGTGGAGCTAGG + Intronic
1084401100 11:68943420-68943442 CAGCACCCAGCAGTAGGGACGGG - Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085304576 11:75477806-75477828 AAGCACAGGGCAGTGAGGCAGGG + Intronic
1085764073 11:79267320-79267342 CTCCACAGAACAGTGGGGCAGGG - Intronic
1086148841 11:83586159-83586181 CATCATTCAGGAGTGGGGCATGG + Intronic
1086960746 11:92978140-92978162 GAGCACAGAGGAGGGGGGCAAGG + Intronic
1087834469 11:102858769-102858791 CAGGACACAGCACAGGGGAAAGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088555687 11:111058567-111058589 CAGGAAACTGCAGAGGGGCAGGG + Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089624329 11:119741639-119741661 GAGCTGACAGCCGTGGGGCAGGG - Intergenic
1089697904 11:120227053-120227075 CAGCACAGAGCAGTGGAGGAGGG + Intronic
1089747282 11:120626245-120626267 CAGCACACAGGAAAGGGGCAGGG - Intronic
1090692551 11:129199407-129199429 CTGCACACAGCAGGGGGCCCTGG - Intronic
1091280399 11:134378635-134378657 CACCACACAGGAGTGAGGCCAGG - Intronic
1091350683 11:134891818-134891840 CTGCACACAGCAGGGGGCCCTGG - Intergenic
1091749574 12:3014077-3014099 CAGGCCACAGCTGTGGGGCTTGG - Intronic
1093570679 12:20662979-20663001 CTGCACACAGCAGAGGGTCTGGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096513460 12:52144392-52144414 CACCACAAAGCTGTGGGGTAGGG + Intergenic
1096677554 12:53233767-53233789 CAGCTCTCAGCAGTGTGGGAGGG + Intergenic
1096688232 12:53303263-53303285 CAGCACTCAGCACTGGGCCTCGG + Intronic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1098327384 12:69316595-69316617 CTGCACACAGCAGGGGAGCCTGG + Intergenic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099492764 12:83307100-83307122 CTGCACACAGCAGGGGGTCCTGG - Intergenic
1100806653 12:98292538-98292560 CAGCACATGGAAGTGGGTCAGGG - Intergenic
1101707061 12:107230529-107230551 GAGGACACAGATGTGGGGCAAGG + Intergenic
1102259415 12:111435264-111435286 TAGCACACACCAGTGGGGCCAGG - Intronic
1102348234 12:112173109-112173131 CGACACACAGGAGTGAGGCATGG - Intronic
1102540852 12:113618061-113618083 CAGGAGACAGCAATGGGGCAGGG + Intergenic
1102914943 12:116745617-116745639 TGACACACAGCAGTGGGACACGG - Intronic
1103168221 12:118789290-118789312 CAGGAAACAGCAGTGGGTGATGG - Intergenic
1103263470 12:119609559-119609581 CTGCACACAGCAGGGGGCCCTGG - Intronic
1103607274 12:122096657-122096679 CAGCAGCCTGCTGTGGGGCAGGG + Intronic
1103871560 12:124096064-124096086 CAGCACACAGCTGAGAGCCAGGG + Intronic
1104404484 12:128506207-128506229 CAGGAGAAAGCAGTGGGGAATGG + Intronic
1104426448 12:128682194-128682216 CTCTACACAGGAGTGGGGCAAGG + Intronic
1104547040 12:129722027-129722049 CTGGCCACAGCAGTGAGGCAGGG - Intronic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104859735 12:131917853-131917875 CAGCCCACGGCAGCTGGGCAAGG - Intronic
1105259880 13:18771099-18771121 CTGCACACAGAAGGGGGTCATGG + Intergenic
1105262560 13:18790422-18790444 CTGCACACAGAAGGGGGTCATGG + Intergenic
1105299085 13:19117164-19117186 CAACACAGAGCATGGGGGCATGG + Intergenic
1105615846 13:22011440-22011462 CCGCACACAGAAATGTGGCAGGG - Intergenic
1106563417 13:30865558-30865580 CAGCACACAGAAAGGGAGCAGGG + Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1108154558 13:47572504-47572526 CTGCACACAGCAGGGGGCCTTGG - Intergenic
1108525965 13:51286319-51286341 CAGAACAGGGCAGTGGGGCATGG - Intergenic
1108531107 13:51328376-51328398 CAGCACGGAGCAATGTGGCAGGG + Intergenic
1109034689 13:57241477-57241499 CAGCAAACAACAGTGTGGCTAGG - Intergenic
1109324685 13:60853035-60853057 CTGCACACAGCAGGGGGCCCTGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110306425 13:73992934-73992956 AAACACACAGCAGTGAGGCTGGG + Intronic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111339241 13:86862412-86862434 CTGCACAGAGCAGGGGGGCCTGG - Intergenic
1111474097 13:88724271-88724293 CTGCACAAAGCACTGGGCCAAGG - Intergenic
1111699461 13:91667889-91667911 CAGCACACAACACTGCTGCAGGG - Intronic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112769668 13:102781801-102781823 CTGCACACAGCAGGGGGCCCTGG - Intergenic
1113168738 13:107473740-107473762 CAGTACAAACCATTGGGGCAGGG - Intronic
1113852828 13:113427746-113427768 GAGCACAGAGCAGTGGCTCAAGG + Intronic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114778708 14:25514952-25514974 CAGCACACAGCAGGGGGACCTGG + Intergenic
1115878750 14:37891722-37891744 CTGCACACAGCAGGGGGCCCTGG - Intronic
1116964949 14:51004500-51004522 AAGTACACAGGAGTGTGGCAGGG + Intronic
1117084144 14:52181500-52181522 CTGCACACAGCAGGGGGTCCTGG + Intergenic
1117833588 14:59779059-59779081 GAGTACACAGCAGTGGTCCAGGG + Intronic
1118317981 14:64737308-64737330 CAGCACACGGGCGAGGGGCAGGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119199560 14:72742517-72742539 GAGCACACGGCAGAGGGGGAAGG + Intronic
1119852441 14:77875649-77875671 TCACACACAGCAGTGGGGCCAGG - Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120317318 14:82912174-82912196 TAGCAAACAGCAGTAGTGCAGGG + Intergenic
1120723743 14:87915950-87915972 CAACACACACCAGTGCGGTAGGG - Intronic
1121788591 14:96681695-96681717 CAGCAGGCAGGAGTGAGGCATGG + Intergenic
1122278095 14:100605495-100605517 CAGCTCAGAGCAGAGGGGCTGGG + Intergenic
1122347831 14:101071422-101071444 CAGCACACACCAATGGAGCGAGG - Intergenic
1122424268 14:101596602-101596624 CAGCTCCCTGCAGTGAGGCAGGG - Intergenic
1122541975 14:102503716-102503738 CCACACACTGCAGAGGGGCAGGG + Exonic
1122555176 14:102575056-102575078 CAGAACACAGCACGGGGGCGGGG - Intergenic
1123002932 14:105305997-105306019 CAGCACACAGCAGCAGAGCGGGG + Exonic
1123737597 15:23200336-23200358 CTGCACACAGCAGGGGGACCTGG + Intergenic
1124062340 15:26306024-26306046 CTGCACACAGCAGGGGGCCCTGG - Intergenic
1124221824 15:27856053-27856075 CCGCAGACACCAGTGGGGCAAGG - Intronic
1124288808 15:28428998-28429020 CTGCACACAGCAGGGGGACCTGG + Intergenic
1124294416 15:28488315-28488337 CTGCACACAGCAGGGGGACCTGG - Intergenic
1124722506 15:32122163-32122185 CAGCACATCGCAGTGGGTGAGGG + Intronic
1124840956 15:33241715-33241737 ATGCACACACCAGTGGGGGAGGG + Intergenic
1125747196 15:42005080-42005102 CAGCAGGCAGCTGTGGGGGAAGG - Intronic
1126110737 15:45173401-45173423 CATCCCACAGCTGTGGGGAAGGG + Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126190578 15:45873847-45873869 CTGCACACAGCAGGGGGTCCTGG + Intergenic
1126825099 15:52540592-52540614 CTGCACACAGCAGGGGGGCCTGG + Intergenic
1127581972 15:60346891-60346913 CTGGAGAGAGCAGTGGGGCAGGG - Intergenic
1127587646 15:60394093-60394115 CAGCACAGAGGTGGGGGGCATGG - Intronic
1127734642 15:61829608-61829630 CCGCCCACAGCAGGGGGGTAGGG + Intergenic
1127791047 15:62398979-62399001 CTGCACACAGCAGGGGGCCCTGG - Intronic
1127914141 15:63441676-63441698 CAGGACACAACAGTGGGGCCTGG + Intergenic
1128129309 15:65215055-65215077 CTGCACCCTGCAGTGGGGAAAGG + Intergenic
1128242133 15:66108268-66108290 GAAACCACAGCAGTGGGGCAAGG + Intronic
1128257973 15:66212309-66212331 CAGCACACAGAGGTGGGACTTGG + Intronic
1128385755 15:67147121-67147143 CACCACACATCACTGGGGCCTGG - Intronic
1129239749 15:74244377-74244399 CACCCCACACCAGTGGGGCAGGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131920115 15:97317418-97317440 CAGCACATAGCATAAGGGCAGGG + Intergenic
1132247251 15:100307181-100307203 CATCACACAGCATTGGGGTAGGG - Intronic
1132504006 16:297784-297806 AACCACACAGCCATGGGGCAAGG - Exonic
1133231703 16:4370011-4370033 CAGGGCACAGGATTGGGGCAGGG + Intronic
1133539138 16:6731788-6731810 TAGGAAACAGCAGTGGGGAAGGG - Intronic
1134117668 16:11561346-11561368 CAACACACAGGTGTGGGGGATGG + Intronic
1134265904 16:12692329-12692351 CAACACTCGGCAGTGGGTCAGGG + Intronic
1135972270 16:27081147-27081169 CAGCACAGAGCAGACAGGCAAGG + Intergenic
1136709914 16:32228662-32228684 CTGCACACAGCAGGGGGACCTGG - Intergenic
1136727799 16:32375762-32375784 CAGCACAGGGCAGTGATGCATGG - Intergenic
1136757995 16:32700749-32700771 CTGCACACAGCAGGGGGACCTGG + Intergenic
1136810111 16:33169626-33169648 CTGCACACAGCAGGGGGACCTGG - Intergenic
1136816587 16:33279706-33279728 CTGCACACAGCAGGGGGACCTGG - Intronic
1137269543 16:46894279-46894301 CAACACACAGCTGTGGGCCCTGG - Intronic
1137524451 16:49222243-49222265 CAGCACACACGAGTTGAGCAAGG - Intergenic
1137696401 16:50464933-50464955 CAGCACACAGAAGCGGGGTGGGG - Intergenic
1138097958 16:54228382-54228404 TAGAACACAACAGTGGGGGAAGG - Intergenic
1138153921 16:54685673-54685695 AAGAAGACAGCAGTGGTGCAGGG - Intergenic
1138265948 16:55659760-55659782 CCACATACAACAGTGGGGCAGGG + Intronic
1138810084 16:60139468-60139490 AAGCACACAGCATGGGGGAATGG - Intergenic
1139458727 16:67105369-67105391 CAGTACACAGTGGTGGGACAGGG + Intergenic
1139653878 16:68375964-68375986 CCGCACACAGGAGCAGGGCAGGG - Intronic
1140116821 16:72049204-72049226 CAGGACACAGCAGTAGGGTCTGG + Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141349975 16:83285887-83285909 CATCACAGAGAAGTGGGACAAGG + Intronic
1202998636 16_KI270728v1_random:141992-142014 CAGCACAGGGCAGTGATGCATGG + Intergenic
1203060146 16_KI270728v1_random:961098-961120 CTGCACACAGCAGGGGGACCTGG + Intergenic
1203130233 16_KI270728v1_random:1678396-1678418 CAGCACAGGGCAGTGATGCATGG + Intergenic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1143854625 17:9839524-9839546 GAGCCCACAGCAGTGAGGGATGG - Intronic
1144392027 17:14802547-14802569 CAGCACTGAGCAGTTTGGCATGG - Intergenic
1145126254 17:20302345-20302367 CAGCCCACAGGAGCCGGGCAGGG - Intronic
1145249502 17:21289527-21289549 GAGGACACAGCATTGTGGCAGGG + Intronic
1146454591 17:32998967-32998989 CAGCATACACCAGAGGGGCGTGG + Intergenic
1147612014 17:41807380-41807402 GACCACACAGCAGTGGGGCTGGG + Intronic
1147879679 17:43645864-43645886 CAGCCCAAGGCAGTGGGGCGCGG - Intronic
1148229014 17:45919560-45919582 CTGCGCCCAGCAGTGGGGGAAGG - Intronic
1148262280 17:46193690-46193712 CGGCACGCAGCACTGCGGCAGGG + Intronic
1148359936 17:47003415-47003437 CATCACACAACAGGGGGGCAGGG + Intronic
1148690313 17:49523424-49523446 CATCACACACCACTGGTGCAGGG + Intergenic
1148721148 17:49754212-49754234 CAGCCTGCAGCTGTGGGGCAGGG + Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149045552 17:52240638-52240660 CAGCCCACAGCCTTGGGTCACGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149381034 17:56094132-56094154 CAGAAGACAGGAGAGGGGCATGG + Intergenic
1149983659 17:61331178-61331200 CAGCACACAGGGGTAGGGGATGG + Intronic
1150647922 17:66991449-66991471 CTGAGCAAAGCAGTGGGGCAGGG + Intronic
1151550677 17:74820835-74820857 CAGGACTCAGCAGCGGGTCATGG + Intronic
1151566328 17:74900643-74900665 CAGGCCACAACAGTGGGGCAGGG + Intergenic
1151896863 17:76986578-76986600 CAGCAGACAGCGGAGGGGCGGGG - Intergenic
1151940309 17:77287841-77287863 CAGGAAACAGGAGTGGCGCAGGG + Intronic
1152020607 17:77778506-77778528 CAGCAAACAGCAGAGAGGCTGGG - Intergenic
1152167128 17:78717076-78717098 CAGCACGTGGCAGTGGGGGAGGG - Intronic
1152426257 17:80220281-80220303 CAGCGCGCAGCAGGCGGGCACGG + Exonic
1152533951 17:80939821-80939843 CAGCACTGAGCAGCAGGGCAGGG - Intronic
1152928077 17:83096984-83097006 CAGCCCACAGCGGGGCGGCAGGG + Intergenic
1153340459 18:3968180-3968202 CAGGAGAAAGAAGTGGGGCAGGG - Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154428877 18:14293286-14293308 CTGCACACAGAGGTGGGTCATGG - Intergenic
1155412982 18:25566414-25566436 CAAACCACAGCAGTGGGCCAGGG + Intergenic
1155605989 18:27606476-27606498 CTTCACATAGCAGAGGGGCAAGG + Intergenic
1156498314 18:37540578-37540600 CCAGACGCAGCAGTGGGGCAGGG + Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157557838 18:48624320-48624342 CACCACCCAGCAGTGGGGTTTGG - Intronic
1157622177 18:49022955-49022977 CAACACACACCTGTGAGGCATGG + Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1159366931 18:67478421-67478443 CAGCTCAAAGCAGTCAGGCAGGG + Intergenic
1159902776 18:74063618-74063640 CATCTCAGAGCAGTGGGGGAAGG - Intergenic
1159915157 18:74182194-74182216 CAGCACACAGCAGCTGCGCTTGG + Intergenic
1160134531 18:76261312-76261334 CTGCACACAGCGGTGGAACAGGG - Intergenic
1160940591 19:1618837-1618859 CAGCGCTCAGCACTGGGGAAGGG - Intronic
1161118533 19:2512658-2512680 GAGGACACACCAGTGGGGCCGGG + Exonic
1161293986 19:3510427-3510449 CAGAACCCAGCAGTGTGGCCGGG - Intronic
1161375242 19:3936622-3936644 GATCACGCAGCAGTTGGGCAGGG - Exonic
1161616257 19:5272164-5272186 CAGCACAGAGTGGTTGGGCAAGG + Intronic
1162046274 19:8002428-8002450 CAGGACACAGCAGCGGAGCAGGG + Intronic
1162724097 19:12679612-12679634 CAGAACACAGAGGTGGGGCTGGG - Exonic
1163124919 19:15239554-15239576 CACCTCACCCCAGTGGGGCATGG + Intronic
1163489356 19:17607768-17607790 CCTCACAGAGCACTGGGGCAGGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164462844 19:28463637-28463659 CAGGTCACAGCAGCTGGGCAGGG - Intergenic
1164646725 19:29863738-29863760 CAGCACCCAGCAGGAGGGGAAGG - Intergenic
1164877247 19:31700188-31700210 CAGCACACATCTGTAGGGCCTGG - Intergenic
1165080375 19:33303004-33303026 CAGCGCAGAGCAGCGGGGCTGGG + Intergenic
1165221194 19:34317954-34317976 TAGCACAGAGCACTGGGGGAAGG + Intronic
1165904457 19:39185245-39185267 CAGCACTGAGAAGTGGGTCAGGG + Intergenic
1166392789 19:42419343-42419365 CTGCACAAAGGAGTGGGGAAGGG + Intronic
1167722821 19:51190574-51190596 CAGAACAGAGCAGTGGGGCCAGG - Intergenic
1167761492 19:51452658-51452680 CAGAACAGAGCAGTGGGGCCAGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168508865 19:56958649-56958671 CAGGCCACAGCTGTGGGGCCAGG - Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
926736646 2:16078536-16078558 CAGCCCACAGCAAAGGGGAAAGG + Intergenic
926835233 2:17011878-17011900 AAGCACACATCACAGGGGCAGGG - Intergenic
927090357 2:19706010-19706032 CAGCCCATAGCACTAGGGCAGGG - Intergenic
927841779 2:26449595-26449617 CAGAACACAGCAGCAGGACAGGG - Intronic
927861584 2:26563088-26563110 CAGCACCCAGCATTCGGGCAAGG + Intronic
929228289 2:39533200-39533222 CAGGAGAGAGCAGTGGGCCAGGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930767350 2:55097548-55097570 AAGGAGACAGCAGTGGGGGAAGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931041399 2:58305057-58305079 CTGCACACAGCAGGGGGCCCTGG - Intergenic
932132072 2:69196952-69196974 CAGCACAGAGCAGGGGCTCAGGG + Intronic
932468513 2:71939204-71939226 GAGCACCCAGCTGTGGGGCCAGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
934318171 2:91945311-91945333 CAGCACAGGGCAGTGATGCATGG + Intergenic
935640282 2:105283653-105283675 GAGCACTCAGCTGTGGGACAAGG + Intronic
935724024 2:106007555-106007577 TGGCACACAGCAGGGGGGCCTGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
935809549 2:106783836-106783858 CAGCAGTCAGCTGTGGGGCTTGG - Intergenic
936685544 2:114822366-114822388 CTGCACACAGCAGGGGGCCCAGG + Intronic
937304173 2:120860951-120860973 CAGCACACAGGAGTGTGCAATGG + Intronic
937612678 2:123881014-123881036 CAACACACAGCAGTGCAGAAAGG - Intergenic
937614595 2:123906748-123906770 CAGCACACAAGTGTGGGGAAGGG + Intergenic
937650905 2:124318130-124318152 CAGCACACACCAGTGGGTCCTGG + Intronic
937862646 2:126723000-126723022 CAGCAGACAGCAGTGGCAGAGGG + Intergenic
937868507 2:126771349-126771371 CAGGAGGCAGCAGTGGGGCAAGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940444767 2:153764791-153764813 CTGCACACAGCAGGGGGCCCTGG - Intergenic
941080618 2:161056562-161056584 CAGGACACAGCAGTAGGGTACGG + Intergenic
941083326 2:161088063-161088085 CAGAACACAGCACTGCAGCAAGG + Intergenic
942851767 2:180495459-180495481 CAGCTCACAGCAGCGTGGTAGGG + Intergenic
943569770 2:189559585-189559607 CAGACCACAGAAGTAGGGCAGGG - Intergenic
945148724 2:206765460-206765482 CTGCATACAGGAGTGGGGCTCGG - Exonic
945991559 2:216399811-216399833 CAGCACACACTAGTTGGGCGAGG + Intergenic
946295918 2:218783370-218783392 CAGAACACAGAAATGAGGCAGGG + Intronic
946416142 2:219540689-219540711 CAGCACACAGCTGGGGGACTGGG + Intronic
947493017 2:230611999-230612021 GGGCACACAGCAGTGATGCAGGG + Intergenic
947732133 2:232437126-232437148 CAGAACAGGGCACTGGGGCAGGG + Intergenic
947886549 2:233576567-233576589 CTGCACACAGCAGGGGGCCCTGG + Intergenic
947893467 2:233646207-233646229 CTGCACACAGCAGGGGGCCCTGG + Intronic
947951676 2:234152959-234152981 CTGCACACAGCAGAGGGACCTGG + Intergenic
948197671 2:236107377-236107399 CAGCCCACAGCAGCCCGGCAGGG - Intronic
948501368 2:238397366-238397388 CAGCACACGGCCATGGGGCTGGG - Intronic
948665946 2:239535125-239535147 CAGCACACAGCATGGGTCCACGG - Intergenic
948781458 2:240324229-240324251 CCTCAAACAGCAGTGGGGCCCGG + Intergenic
948907474 2:240986698-240986720 CAGCACACAGCAGAGGGACAAGG - Intronic
948981143 2:241495480-241495502 CAGCACACTGCAGGGGTGGAAGG + Exonic
1169128493 20:3148947-3148969 CAGCACACAGCATGGGGGACAGG - Exonic
1170502582 20:16989780-16989802 CAGCACCCACCAGTGGGCCCCGG + Intergenic
1170791114 20:19510377-19510399 CAGCACACAGCAGTGGGGCATGG - Intronic
1170797031 20:19556966-19556988 CAGCACATAGCAGAGGCCCAGGG - Intronic
1171233886 20:23509110-23509132 CTGCCCACAGCTGTGGGGCCAGG + Intergenic
1171307136 20:24116345-24116367 CAGCCCACTGCAGAGGGGGAGGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172126682 20:32628720-32628742 CAGCACAAAGGAGGGGGACAAGG + Intergenic
1172491547 20:35342624-35342646 CAACACTCAGGAGTGCGGCAAGG + Intronic
1172667786 20:36612816-36612838 TAGCACACTGCAGTGAGGCCAGG - Exonic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173142879 20:40499619-40499641 CTGCACACAACAGTGGGGCCTGG - Intergenic
1174555687 20:51393883-51393905 CAGAACACAGGGCTGGGGCAGGG + Intronic
1174585411 20:51604383-51604405 CAGGACACAGCAGCAAGGCAGGG + Intronic
1175470093 20:59221465-59221487 CAGCAGCCAGCAGTGGGGTGAGG - Intronic
1175918699 20:62439846-62439868 CAGCTCACAGGTGTGGGGCCAGG - Intergenic
1176121203 20:63455366-63455388 CACCACTGAGCAGAGGGGCAGGG + Intronic
1176379041 21:6102525-6102547 GAGCACACAGCGGGGGAGCAGGG - Intergenic
1176845894 21:13876139-13876161 CTGCACACAGAGGGGGGGCATGG + Intergenic
1176848627 21:13895682-13895704 CTGCACACAGAGGGGGGGCATGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177393234 21:20502477-20502499 CTGCACACAGCACAGGGACACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178420209 21:32437331-32437353 GAGACCACAGCAGTGGGGAAGGG - Intronic
1179042439 21:37815946-37815968 AAGCAGACAGTAGAGGGGCAGGG + Intronic
1179744433 21:43435712-43435734 GAGCACACAGCGGGGGAGCAGGG + Intergenic
1180243145 21:46525405-46525427 CACCACAGAAGAGTGGGGCAAGG - Intronic
1180306347 22:11128995-11129017 CAGCACAGGGCAGTGATGCATGG + Intergenic
1180544866 22:16491178-16491200 CAGCACAGGGCAGTGATGCATGG + Intergenic
1180876956 22:19178995-19179017 CAGCTCCGAGCAGTGGGTCAAGG + Intergenic
1182879885 22:33724289-33724311 CAGCACACATCAGATGGGAAGGG + Intronic
1183483616 22:38077873-38077895 CAGCTCTGAGCAGTGGGGCTGGG + Intergenic
1183623632 22:38989021-38989043 CCACACCCAGCATTGGGGCAGGG - Intronic
1183784674 22:40022545-40022567 CAGCACTCAGCAGAGGGACGTGG - Intronic
1184049930 22:41996947-41996969 CTTCATTCAGCAGTGGGGCAGGG - Exonic
1184285336 22:43467713-43467735 CAGAACACAGCAGAGGGGGATGG - Intronic
1184808175 22:46809779-46809801 AAGAACACAGCAGCCGGGCAGGG - Intronic
1184997701 22:48222583-48222605 CAACCCACAGCAATGGGACATGG - Intergenic
1185114418 22:48923451-48923473 GAGAACGCAGCAGTGGGGGAAGG - Intergenic
1185125294 22:49007149-49007171 AAGCAGACAGCCGTGGGGCAGGG + Intergenic
1185315843 22:50178776-50178798 CTGCACACAGCAGTTGGCCTGGG - Intronic
949341425 3:3034837-3034859 CTGGACACAGCACTGTGGCAAGG + Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950189756 3:10968493-10968515 CAGCAGACAGCAGCTGGGCCTGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
952342924 3:32460198-32460220 CAGCACAGGGCAGTGGCACAGGG - Intronic
952494832 3:33906784-33906806 CACCACACAGCACTGGAGCACGG - Intergenic
953470135 3:43159368-43159390 GAGCACATAGCATTGGGGCAGGG - Intergenic
953700919 3:45195144-45195166 TAGAAGAGAGCAGTGGGGCAGGG - Intergenic
953752070 3:45616556-45616578 CAGCACACAGCAGGGACTCAGGG - Intronic
954108310 3:48420779-48420801 CAGAGCACAGCCATGGGGCAAGG + Intronic
954448937 3:50561405-50561427 CAGCTCAGAGCAGCAGGGCAAGG + Intronic
954516622 3:51183785-51183807 CCTCACACAGCAGTGGGGTAGGG + Intronic
954619103 3:51985672-51985694 CAGGAGACAGCAATGGGGGATGG + Intronic
954674074 3:52306121-52306143 CAGCCCACGTCAATGGGGCAAGG + Intergenic
954686264 3:52371883-52371905 CCGCAGCCAGGAGTGGGGCAGGG + Intronic
954947575 3:54439856-54439878 CTGCAGACAGTTGTGGGGCAGGG - Intronic
955167244 3:56526885-56526907 CTGCACAGGGCAGTGGGGCTGGG - Intergenic
955908122 3:63829302-63829324 CACCATACAGCAGTGGGGTAAGG + Intronic
956267086 3:67408813-67408835 CATCACACAGCAGTAGGCAATGG + Intronic
956798973 3:72739769-72739791 AAGGAAACAGGAGTGGGGCAGGG + Intergenic
956951336 3:74286916-74286938 CAGCAGACAGCAGGAGGGAAAGG + Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961621211 3:128226530-128226552 CAGGACACAGCAGGGGGCTACGG - Intronic
961651569 3:128419204-128419226 GTGCACAAAGAAGTGGGGCACGG + Intergenic
961659002 3:128458479-128458501 CAGAGCTCAGCAGAGGGGCAGGG - Intergenic
962709941 3:138077814-138077836 GAACCCACAGCAGTGGGGCCTGG - Intronic
962710622 3:138082704-138082726 AAGGAGACAGCAGTGGGGAATGG - Intronic
963296127 3:143548412-143548434 CAGCACACAGCAGTGTAGCCCGG - Intronic
964446115 3:156760313-156760335 TAGCACAACGCAGAGGGGCAAGG + Intergenic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
967290489 3:187915049-187915071 AAGTACAGAGCAGTGGGGGAAGG + Intergenic
967849139 3:194069480-194069502 CAGTCCATAGCAGTGGGGAAAGG - Intergenic
968195101 3:196699986-196700008 CAGCGCAAAGCAGTGGAGCTTGG - Intronic
968288378 3:197521277-197521299 TAGAATACAGCAGTGGGGGATGG - Intronic
968557179 4:1251476-1251498 CTGCACACAGGAGTGGCTCATGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969345687 4:6568385-6568407 CAGCACGGAGCAGTGGGGGTGGG + Intergenic
969381134 4:6798840-6798862 TAGTACACAGCAGCTGGGCACGG - Intronic
970477836 4:16441646-16441668 CAGGACACAGAAGTGAGGGAAGG + Intergenic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
970756809 4:19437184-19437206 CTGCACACAGCAGGGGGTCATGG - Intergenic
971325300 4:25638614-25638636 CAGAAGACAGCAGAGTGGCATGG + Intergenic
971440418 4:26679244-26679266 CTGCACAGAGCAGGGGGGCCCGG - Intronic
971727074 4:30327795-30327817 CAGCAAAGAGCAGTGGGTCGTGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975046193 4:69807556-69807578 CTGCACACAGTAGGGGGGCCTGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
976795803 4:88931117-88931139 CAGCTCACAGCAGGGTGGCAGGG + Intronic
976853444 4:89575997-89576019 CTGCACAGAGCAGTGGGTCCTGG - Intergenic
977039102 4:91992414-91992436 CAGGACAAAGAAGTGGGGAATGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977836046 4:101647460-101647482 CAGCACACTCCTGTGGAGCAGGG - Intronic
977950658 4:102966598-102966620 CAGCACAGGGCAGTGATGCATGG + Intronic
979268523 4:118732053-118732075 GGGCACACAGCACTGGGCCAGGG + Intronic
980094208 4:128472849-128472871 CAACACACAGCACTGGGGTCAGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980430195 4:132684131-132684153 CTGCACACAGCAGGGGGCCCTGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981015091 4:139965922-139965944 CAGCTCACAGGATTGGGGGAAGG + Intronic
981752828 4:148109052-148109074 GAGCACTCAGCAGTGAGTCAAGG + Intronic
982056853 4:151559415-151559437 CAGCACAGGGCAGTGGGGGCTGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
985878463 5:2619048-2619070 CAGCCCACAGCAGTGGGAAAGGG + Intergenic
986006449 5:3672602-3672624 GAGCATAGTGCAGTGGGGCAGGG - Intergenic
986731366 5:10637072-10637094 CAGGACACTGAAGTGGGGGAGGG + Intronic
987084434 5:14455954-14455976 GAGCCCACCGCAGTGGGGCTTGG + Intronic
987275182 5:16354885-16354907 CATCACACAGCAGTCCAGCAGGG + Intergenic
987516635 5:18918482-18918504 CAGCCCAGAGCAAGGGGGCAGGG + Intergenic
987562417 5:19540763-19540785 CTGCACACAGCAGGGGGCCCTGG + Intronic
988541141 5:32111300-32111322 TAAGACACAACAGTGGGGCAAGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
992136832 5:73754387-73754409 CAGCACACAGGATTCAGGCATGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992392071 5:76338533-76338555 CAGCAGACTGCAGTGGGGGTGGG - Intronic
992475653 5:77099483-77099505 TAACACACAGCAGTGAGACATGG - Intergenic
992594764 5:78334921-78334943 CAGTGCACAGCAGAGGGGCTGGG + Intergenic
993879814 5:93348871-93348893 CAGCTCCCAGCAGGGGTGCAGGG - Intergenic
994590801 5:101769312-101769334 CTGCACACAGCAGGGGGTCCTGG + Intergenic
995019180 5:107347730-107347752 CAGCACCCACCAGTAGAGCAAGG - Intergenic
995393201 5:111661352-111661374 CTGCACACAGCAGGGGGTCCTGG + Intergenic
996880108 5:128287392-128287414 AAGCACACAGCAGTGGGTTCTGG + Exonic
998388069 5:141769590-141769612 CAGCACTCAGCACTGGGGTCAGG + Intergenic
999715167 5:154354600-154354622 CATCACACTACACTGGGGCATGG - Intronic
999932017 5:156443824-156443846 GAGCACACAGCAGTGGGCTGTGG + Intronic
999932352 5:156447373-156447395 GAGAACACAGCAGTGTGGCCAGG + Intronic
1000095391 5:157966936-157966958 AAGCTGACAGCAGTGGGGCCAGG - Intergenic
1000409339 5:160921779-160921801 GGGCACACAGCAGAGGGCCAAGG - Intergenic
1001235296 5:170024187-170024209 CACCTCGCAGCAGTGGGGTAAGG + Intronic
1001403658 5:171461181-171461203 CAGCAGAGGGCAGTGGGGAAGGG + Intergenic
1002754676 6:148059-148081 CAGCACACACCTTGGGGGCACGG - Intergenic
1002759204 6:188888-188910 CAGCCCAGAGCTGTGGGGAAAGG - Intergenic
1002919203 6:1554365-1554387 CAGCAGACACCAGTGGCGTAGGG - Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004670443 6:17791516-17791538 GAGCACATAGCACTGGGGAAAGG + Intronic
1004978844 6:20999322-20999344 CAGCATGCAGCAGTGGAGAAGGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006154804 6:32008302-32008324 GATGACACTGCAGTGGGGCAGGG - Intergenic
1006161116 6:32041037-32041059 GATGACACTGCAGTGGGGCAGGG - Exonic
1006446815 6:34084348-34084370 CAGGAGCCATCAGTGGGGCAGGG + Intronic
1006877230 6:37308377-37308399 CAGCAAAAAGCAGTGGAGAAAGG - Intronic
1007601350 6:43083594-43083616 ACACAGACAGCAGTGGGGCAGGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009546057 6:65020977-65020999 CTGCACACAGCAGTGGGGCCCGG + Intronic
1009982442 6:70741998-70742020 CTGCACACAGCAGGGGGCCCTGG + Intronic
1010055096 6:71556063-71556085 CTGCACACAGCAGGGGACCATGG - Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1012476167 6:99616569-99616591 CACATCACAGCAGGGGGGCATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013034016 6:106362447-106362469 CAGCACACAGGAGGGGATCAGGG + Intergenic
1013910662 6:115272494-115272516 CTGCACACAGCAGGGGGGCCTGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016557887 6:145360083-145360105 CAACTCAAAGCGGTGGGGCAGGG + Intergenic
1016587695 6:145708416-145708438 CTGCATACAGCAGTGGGCCCTGG - Intronic
1017372938 6:153735132-153735154 CAGGAAGCAGCAGTGGGGCCAGG - Intergenic
1017677351 6:156827655-156827677 CAGCACAAGGCACTGGGTCAAGG - Intronic
1017763663 6:157590374-157590396 CTGCACACAGCAGGGGGCCCTGG - Intronic
1018159640 6:161026088-161026110 GACCACACAGCAGTGCAGCAGGG - Intronic
1018935777 6:168273417-168273439 CAGCCCACAGAAGGGGGGCCTGG + Intergenic
1019178617 6:170173826-170173848 CAGGACTCAGCTGTGAGGCAGGG + Intergenic
1019604645 7:1902391-1902413 CAGCACACAGCTGTGACCCACGG + Intronic
1019843777 7:3476279-3476301 CAGCAAACAGCTGTGGGTGATGG - Intronic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021340593 7:19458456-19458478 CAGCCCACAGCAGGGTGGCAGGG + Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1021894567 7:25221997-25222019 CAGCCCTCAGCCCTGGGGCATGG - Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022675600 7:32495862-32495884 GAGCACACAGAAGCAGGGCAGGG - Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023591727 7:41787753-41787775 CATCACAGAGCAATGGGGCCAGG - Intergenic
1023833785 7:44056891-44056913 CAGCACTCACCACTGGGGCCTGG - Exonic
1024053013 7:45641334-45641356 CAGCTCACAGAACTGGGGTATGG - Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1025029430 7:55545111-55545133 CAGACCACAACGGTGGGGCATGG + Intronic
1026804871 7:73423579-73423601 CGGCACACATCACTGGGGCAAGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028992398 7:97063118-97063140 CAGCACACACCTTTGGGGAATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029217169 7:98959054-98959076 CTGCACACTGCAGGGAGGCAAGG - Intronic
1030265839 7:107621048-107621070 CAGCCCACAGAGGTAGGGCAAGG - Exonic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032383067 7:131503891-131503913 GTGAACACAGCAGTGTGGCATGG + Intronic
1033559747 7:142520097-142520119 CAGCACCCAGCAGAGGAGCCCGG - Intergenic
1033653449 7:143358970-143358992 AAGCCCACAGCCATGGGGCAAGG - Exonic
1034078705 7:148257111-148257133 CAGGTCACAGCACAGGGGCAAGG + Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1037581012 8:20246026-20246048 CAGCACAGGGCAGTGGGAAAGGG - Intergenic
1038310817 8:26444956-26444978 CTGGACACAGCAGTGGGGTGAGG - Intronic
1039415050 8:37386370-37386392 CTGCACACACCAGCAGGGCAAGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039888830 8:41671015-41671037 CTGCACTCAGCGGAGGGGCATGG + Intronic
1041392507 8:57359541-57359563 CTGCACAGAGCAGTGGGACCCGG - Intergenic
1042058017 8:64787040-64787062 CTGCACAGAGCAGTGGGGCAGGG + Intronic
1043492529 8:80763534-80763556 CTGCACACAGCAGGGGGTCCTGG + Intronic
1044273605 8:90275143-90275165 CTGCACACAGCAGAGGGACTTGG - Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045690947 8:104759291-104759313 CAGAGAACAGGAGTGGGGCAAGG + Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046003278 8:108446836-108446858 CAGCACTCAAGAGTGTGGCAGGG + Intronic
1047254137 8:123203038-123203060 CATGACAGAGCAGTGGGGAAAGG + Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047586875 8:126282715-126282737 CTGCACACAGTAGGGGGGCCTGG - Intergenic
1047926083 8:129683926-129683948 CAGAACACAGCTGTTTGGCAAGG + Intergenic
1048299888 8:133244016-133244038 CAGCCCAGAGCAGAGGGACATGG - Intronic
1048470432 8:134699773-134699795 CCTCACACAGCACTGGGACACGG + Intronic
1048527266 8:135214505-135214527 CAGAAGACAGGAGTGGGCCATGG + Intergenic
1048534076 8:135276239-135276261 TAGCACACAAGAGAGGGGCAAGG - Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049150527 8:141032417-141032439 CAGCACAGGCCAGTGAGGCAGGG - Intergenic
1049202324 8:141346393-141346415 CAGCGAAGAGCAGTGGGGCTGGG - Intergenic
1049211485 8:141388502-141388524 CAGCCCTCCGCAGTGTGGCAGGG - Intergenic
1049219154 8:141420984-141421006 CAGATCACAGCAGGTGGGCAGGG + Intronic
1049263042 8:141649936-141649958 CAGCACACAGGGGTGGGGCCAGG - Intergenic
1049348539 8:142151966-142151988 CAGCTCACAGCCGTGGGCGAGGG - Intergenic
1049348819 8:142153224-142153246 CAGAACCCAGCCCTGGGGCATGG + Intergenic
1049432060 8:142569769-142569791 CTGCACAGAGCAGCTGGGCAGGG - Intergenic
1049731370 8:144180287-144180309 CAGCACGGCGCAGTGTGGCAGGG - Exonic
1051403075 9:16704823-16704845 CAGAACACAGCCTTGGGGAAGGG + Intronic
1051495336 9:17716535-17716557 CAGCACACTGCCATGGGGCCAGG - Intronic
1051612141 9:18971282-18971304 AGGCAAGCAGCAGTGGGGCATGG - Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053835463 9:42130078-42130100 TAGCACACAGCAGGTGCGCAAGG - Intergenic
1054091133 9:60848043-60848065 TAGCACACAGCAGGCGCGCAAGG - Intergenic
1054112544 9:61123599-61123621 TAGCACACAGCAGGCGCGCAAGG - Intergenic
1054595162 9:67058532-67058554 TAGCACACAGCAGGCGCGCAAGG + Intergenic
1054775533 9:69121229-69121251 CGCCACTCAGCGGTGGGGCAGGG - Intergenic
1056629485 9:88281414-88281436 AATCACACAGCAGCGGAGCAGGG - Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1056737973 9:89225970-89225992 CAGCAGGCAGCAGCGGGACAGGG - Intergenic
1056752243 9:89360742-89360764 AAGCACACAGCTCTGGGCCAGGG + Intergenic
1057044900 9:91878187-91878209 CTGCACACTGATGTGGGGCAAGG + Intronic
1058702308 9:107611392-107611414 CAGCACCTAGCACTGGGGCAGGG - Intergenic
1059332389 9:113543753-113543775 CAGCACACAGCCCTGGGGACAGG + Intronic
1061120693 9:128640634-128640656 GAGGAGACAGAAGTGGGGCAGGG + Intronic
1061245995 9:129401559-129401581 CAGGATCCAGTAGTGGGGCAAGG + Intergenic
1061328972 9:129880432-129880454 GGGCACTCAGCAGTGGGGCCGGG - Exonic
1061689714 9:132316670-132316692 CATCACAAATCAGTGGGGAAAGG - Intronic
1061887880 9:133601932-133601954 CAGCACACAGGAGTGCTGCAGGG + Intergenic
1062250106 9:135589559-135589581 CAGGACCCAGCCGTGGGGGAGGG - Intergenic
1062278232 9:135740576-135740598 CAGGACACAGCAGGGAAGCAGGG + Intronic
1062326930 9:136016973-136016995 CAGCAAGGGGCAGTGGGGCATGG + Intronic
1062448360 9:136605084-136605106 CAGCAAGCAGCGCTGGGGCAGGG + Intergenic
1062483286 9:136762321-136762343 CAGCTCACAGGAGTGCAGCACGG + Intronic
1062567695 9:137170551-137170573 CAGACCAGTGCAGTGGGGCAGGG + Intronic
1062627169 9:137448542-137448564 CAGCACACAGGCCTGGGGCTTGG - Exonic
1186639554 X:11440936-11440958 CAGCATTCAGCACTTGGGCATGG - Intronic
1186704652 X:12128438-12128460 CTGCACAGAGCAGAGGGGCCTGG + Intergenic
1187344248 X:18448604-18448626 GAGGCCACAGAAGTGGGGCAAGG - Intronic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188319580 X:28719843-28719865 CAGCACACAGGAATGGGGGATGG + Intronic
1188964126 X:36529800-36529822 CACCACAGAGCAGAGGGACATGG + Intergenic
1189609674 X:42718886-42718908 AAGAACCCAGCAGTGGGCCAGGG + Intergenic
1190683545 X:52850639-52850661 CAGCAGTAAGCAGTGGAGCATGG + Intergenic
1190738614 X:53272580-53272602 CAGTTCAGAGCAGTGAGGCATGG - Intronic
1190748462 X:53340988-53341010 CAGCACACAGCCCTGGAACAGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193320368 X:80114731-80114753 CTGCACACAGCAGGGGGCCCTGG - Intergenic
1193816238 X:86107654-86107676 CTGCACACAGCTGGGGGGCCTGG + Intergenic
1194876934 X:99201090-99201112 CTGCACACAGCACAGGGGCCTGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1195703104 X:107719634-107719656 CTGCACTGATCAGTGGGGCAGGG + Intronic
1195831195 X:109060901-109060923 CAGCATCCAGCAGTGGTGCCTGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198913429 X:141638696-141638718 CTGCACACAGCAGGGGGCCATGG + Intronic
1200572788 Y:4853447-4853469 CTGCACACAGCAGGGGGCCCTGG + Intergenic
1201185728 Y:11400393-11400415 CAGCACAGGGCAGTGATGCATGG + Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic