ID: 1170791887

View in Genome Browser
Species Human (GRCh38)
Location 20:19515570-19515592
Sequence TACCCCTCTGTGCCTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170791885_1170791887 -2 Left 1170791885 20:19515549-19515571 CCTCCATGTGCTCTGTGTAAGTA 0: 1
1: 0
2: 0
3: 12
4: 150
Right 1170791887 20:19515570-19515592 TACCCCTCTGTGCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 32
4: 300
1170791886_1170791887 -5 Left 1170791886 20:19515552-19515574 CCATGTGCTCTGTGTAAGTACCC 0: 1
1: 0
2: 2
3: 10
4: 109
Right 1170791887 20:19515570-19515592 TACCCCTCTGTGCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 32
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170791887 Original CRISPR TACCCCTCTGTGCCTCTGCC TGG Intronic
900370167 1:2328740-2328762 CACCCATCTGTGTCTGTGCCTGG - Intronic
900494190 1:2969091-2969113 CACCCCTCTCTGCCCCTCCCAGG + Intergenic
900731972 1:4268053-4268075 TGACCCTCTCTGTCTCTGCCTGG - Intergenic
900755615 1:4432563-4432585 CATCCCTCCCTGCCTCTGCCAGG - Intergenic
901240965 1:7692953-7692975 AACCCCTCTGTGCCTCCATCTGG + Intronic
901323878 1:8355778-8355800 TGCCCTTGGGTGCCTCTGCCTGG + Intronic
901686322 1:10945578-10945600 TGCTCTTCTGTCCCTCTGCCTGG + Intergenic
901914235 1:12485899-12485921 TACCCTTCAGTGCCTCTACAAGG - Intronic
902391403 1:16109232-16109254 TCCCCTTCTGCCCCTCTGCCTGG + Intergenic
903010526 1:20326918-20326940 CACCCCTCTGAGCCTCAGCTAGG - Intronic
904379795 1:30103038-30103060 TACCACTCTCCGCGTCTGCCAGG + Intergenic
904926838 1:34056119-34056141 TACACCACTGTTCCCCTGCCTGG + Intronic
905270113 1:36782167-36782189 TGCCCCTCTGTCCTCCTGCCTGG + Intergenic
905647094 1:39632646-39632668 CACCCCTCTGTGTTTCTTCCTGG + Exonic
906166283 1:43688853-43688875 TGCACATCTGTGGCTCTGCCTGG - Intronic
907785476 1:57607920-57607942 GACCCCTCTGTGGTTCTGCCTGG - Intronic
909016719 1:70388062-70388084 TTCCCCTCTGGTACTCTGCCAGG + Intergenic
913289397 1:117258487-117258509 TCCACCTCTGTGGCTTTGCCAGG + Intergenic
913969855 1:143406505-143406527 TACCCCGCTGTGGCTCTACCAGG + Intergenic
914064229 1:144232099-144232121 TACCCCGCTGTGGCTCTACCAGG + Intergenic
914114921 1:144734255-144734277 TACCCCGCTGTGGCTCTACCAGG - Intergenic
915020837 1:152777175-152777197 CGCCCCTCAGTGCCTCAGCCAGG + Intronic
915545047 1:156592269-156592291 CACCCCTTTGTGCCTAGGCCAGG - Intronic
915952770 1:160200828-160200850 TGCCCCTCTGCGCTTCAGCCCGG + Intronic
915972239 1:160362957-160362979 CACCTCTCTGTGCCTCTGGAAGG - Intergenic
916680367 1:167098609-167098631 AACCCCACTGTGCCTCATCCAGG - Intronic
916716476 1:167451060-167451082 TCCACCTCTGCTCCTCTGCCCGG - Intronic
918907206 1:190512477-190512499 AGCACCTCTGTGCCTGTGCCTGG + Intergenic
920085050 1:203409222-203409244 AACCCAGCTGTGCCTCTGCCTGG - Intergenic
920379167 1:205525979-205526001 TCCCCATTTGTGCCTCTGCCTGG - Intronic
920729990 1:208474383-208474405 GACTTCTCTGTGCCTCTTCCAGG + Intergenic
921311924 1:213853137-213853159 TGCCACCCTCTGCCTCTGCCTGG + Intergenic
921608466 1:217182471-217182493 TTCCTCTGTGTCCCTCTGCCTGG - Intergenic
923147897 1:231210482-231210504 GGCAGCTCTGTGCCTCTGCCCGG + Intronic
923546007 1:234923765-234923787 AACCCCTCAGTGGCTCTCCCTGG + Intergenic
924510201 1:244723797-244723819 TACTCCGCTGTTCCTCTGACTGG + Intergenic
1062773579 10:125626-125648 TTCCCCTTTGTCCTTCTGCCAGG + Intergenic
1064007353 10:11709218-11709240 CACTCCTCTGAGCCTCTTCCAGG - Intergenic
1065628962 10:27658516-27658538 TACCCCTCTATGCTCCTGCCTGG + Intergenic
1066068523 10:31780144-31780166 TAAGCCACTGTGCCTGTGCCTGG - Intergenic
1066558984 10:36647616-36647638 TCCTCCTCTGTGCTTCTGCCCGG - Intergenic
1066999003 10:42588637-42588659 GAACCCTTTGTGGCTCTGCCCGG - Intronic
1067078071 10:43199255-43199277 TGCCCCTCTGTTCCTCTGCCCGG - Intronic
1067385309 10:45813028-45813050 TACCCCTCACTGCTTCTGGCTGG + Intergenic
1067587535 10:47484840-47484862 AACCCCTCTCTGCTTCTGGCTGG + Intergenic
1067634591 10:47992606-47992628 AACCCCTCTCTGCTTCTGGCTGG + Intergenic
1068285006 10:54922761-54922783 TCCACCTCTGTGACTCTGCAGGG + Intronic
1069745149 10:70710235-70710257 TTCACCTCTGAGCCTCTGCAAGG + Intronic
1070897844 10:80000321-80000343 TCCCCCTCTCAGCCTTTGCCAGG + Intergenic
1071503410 10:86219129-86219151 CAGCCCTCTGTGCCGCTCCCTGG + Intronic
1071610452 10:87027076-87027098 TACCCCTCTAGGCTTCTGGCTGG - Intergenic
1071788622 10:88931365-88931387 TACATCTCTGGGCCTCTGCTTGG + Intronic
1072710288 10:97712050-97712072 TATCCATCTTTGCCTGTGCCTGG - Intergenic
1074361896 10:112830373-112830395 CTCCCCTCAGAGCCTCTGCCTGG + Intergenic
1074869900 10:117568212-117568234 TGCTCATCTGTGCCTCTGGCTGG + Intergenic
1075097087 10:119479241-119479263 TACCCGTCTGCCTCTCTGCCTGG - Intergenic
1075120386 10:119660206-119660228 GACCCTTCTGTGCCCCAGCCTGG + Intronic
1076270943 10:129151558-129151580 TCTCCCTCTGTCTCTCTGCCAGG + Intergenic
1076875705 10:133214589-133214611 ATCCCCTCTGTGCCTGAGCCTGG + Intronic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077244575 11:1529973-1529995 GGCCTCTCTTTGCCTCTGCCGGG - Intergenic
1077283975 11:1757793-1757815 TGCCCGTCTGTGCTCCTGCCTGG - Intronic
1077289301 11:1781561-1781583 CACCCATCTGTGCAACTGCCTGG + Intergenic
1077667578 11:4127473-4127495 TCCCCTTCTGTGCCTCTTGCAGG - Intronic
1080016574 11:27513283-27513305 TTTCCTTCTATGCCTCTGCCAGG + Intergenic
1080223681 11:29935609-29935631 TACCCCTCACTCCCTCTGCCTGG + Intergenic
1084144688 11:67258677-67258699 TACCACTGGGTGCCTCTGCAGGG - Intergenic
1084692173 11:70733904-70733926 TACCCCTGGGTGCCTTTGCTAGG + Intronic
1084959141 11:72707129-72707151 AACCCCGCCATGCCTCTGCCTGG + Intronic
1085818907 11:79771060-79771082 TCCACCCCTGTGGCTCTGCCAGG - Intergenic
1088369475 11:109073610-109073632 TACCCATCCATGTCTCTGCCTGG - Intergenic
1088388763 11:109290446-109290468 TCCACCTCTGTGGCTCTGCAGGG + Intergenic
1089970748 11:122691193-122691215 TTCTGCTCTGTGCCTTTGCCGGG + Intronic
1092075054 12:5665863-5665885 CACCCCCCTGTGCCACTGGCTGG + Intronic
1093743116 12:22710818-22710840 TGTGCCTTTGTGCCTCTGCCAGG + Intergenic
1094364191 12:29662772-29662794 CACCTCTCTTTTCCTCTGCCTGG + Intronic
1099796742 12:87409577-87409599 TTCACCCCTGTGCCTCTGCAGGG - Intergenic
1102986865 12:117285332-117285354 TTCCGCCCTGTGCCTCTTCCAGG - Exonic
1103136329 12:118511003-118511025 TACCCCTCTTTCCTTGTGCCTGG + Intergenic
1103897894 12:124286074-124286096 TGCACCTCTGTTTCTCTGCCAGG + Intronic
1104192958 12:126501125-126501147 TACCCCTCTATACCTCTTCAGGG - Intergenic
1104713437 12:131001753-131001775 CACCCTTCTCTGCCCCTGCCTGG - Intronic
1105719586 13:23100730-23100752 TACCCCACTGTGCCCCAGCATGG + Intergenic
1106698669 13:32205935-32205957 TTCTCTTCTGTGCCTCTGCTTGG - Intronic
1110460949 13:75745157-75745179 TCCCTCTCTGTTCCTCTGTCTGG - Intronic
1111045952 13:82813115-82813137 TCCACCTCTGTGGCTCTGCAGGG - Intergenic
1112252179 13:97792557-97792579 TCCACCTCTGTGACTCTGCAGGG + Intergenic
1115757754 14:36546337-36546359 CTCCCCTCTGTACCTCTTCCTGG + Intergenic
1117203037 14:53412060-53412082 CATTCCTCTGTGCCTCAGCCAGG + Intergenic
1118477855 14:66135100-66135122 TACACCACTGTGCCTTTGCTGGG + Intergenic
1119351932 14:73973028-73973050 TACCCCTGTGCACCTTTGCCTGG - Intronic
1119901664 14:78265675-78265697 TTTCCCACTGTGCCTCTGCTGGG - Intronic
1121187249 14:91985023-91985045 TCCCCCTCTATCCCTCTTCCCGG - Intronic
1121255051 14:92525062-92525084 TACCCAGCTTTGCCTCAGCCAGG - Intronic
1121711471 14:96041902-96041924 TTCCCCTCTGTGTCTTAGCCGGG - Intronic
1122882822 14:104697665-104697687 TCCCCCTCTGGGCCTGGGCCTGG - Intronic
1125137978 15:36366569-36366591 GAACCCTCTGAGTCTCTGCCTGG - Intergenic
1128226412 15:66004383-66004405 CCCCCCTCTGTGCCCCTCCCTGG - Intronic
1128565602 15:68698844-68698866 TGCCCCTCTGCGCCTCTACTAGG - Intronic
1129163303 15:73759955-73759977 TTGCTCTCTGTGCCTCTGCCAGG + Intergenic
1130046893 15:80452761-80452783 GTCGCCTCTGAGCCTCTGCCAGG + Intronic
1131516697 15:93083058-93083080 TGGCCCTCTGAGCCTCGGCCGGG - Intronic
1135848096 16:25937492-25937514 TACGCTCCTGTTCCTCTGCCTGG - Intronic
1135855245 16:26003866-26003888 TACCCCTGTGTGCTGGTGCCTGG + Intronic
1135910647 16:26557784-26557806 AACCCCTGTGTGACCCTGCCTGG - Intergenic
1137984178 16:53093977-53093999 TAACAATGTGTGCCTCTGCCCGG + Intronic
1138238081 16:55402460-55402482 GCCCCTTCTGTCCCTCTGCCTGG + Intronic
1138396260 16:56707066-56707088 TACACCACTGTGCCCCAGCCTGG - Intronic
1139440908 16:66966372-66966394 ACCCCCTCTGTGCCATTGCCCGG - Intronic
1139574135 16:67830752-67830774 TACCTTCCTGTTCCTCTGCCTGG + Intronic
1140092442 16:71849635-71849657 TACCCCTCTCTGCTTCTGGCTGG - Exonic
1140648260 16:77057625-77057647 TTCCCCTCTGTTCCCCTGCCTGG - Intergenic
1141297662 16:82784785-82784807 CACCCTGCTGTGCATCTGCCTGG - Intronic
1143061618 17:4206780-4206802 AAACTCTCTGAGCCTCTGCCTGG - Intronic
1143502648 17:7348093-7348115 TCCCTGTCTCTGCCTCTGCCTGG + Intronic
1143889066 17:10088431-10088453 AACCCCTCATTGCCTCAGCCTGG - Intronic
1143901397 17:10177274-10177296 GACACCTCTGTGCCTTTGCTCGG - Intronic
1144061953 17:11590942-11590964 TTCCCCTCTGTGGTTCTGGCAGG + Intergenic
1144587032 17:16493040-16493062 TTCCTCCCCGTGCCTCTGCCAGG + Intergenic
1146161947 17:30564855-30564877 TACCCCGCTGAGCCTCAGCGGGG + Intergenic
1147163765 17:38582518-38582540 TACCCCTCACTGCCTCCTCCAGG + Intronic
1148026715 17:44593771-44593793 TAGCCCTCTATGCCTGGGCCAGG + Intergenic
1148636927 17:49156162-49156184 TTCCCCACTGTCCCTCTCCCTGG + Intronic
1149564038 17:57628960-57628982 TCTACCTCTGTGCCTGTGCCTGG - Intronic
1150452709 17:65282215-65282237 TACCCATCTGGGCCTATGTCAGG - Intergenic
1150618414 17:66789998-66790020 CTCCCCATTGTGCCTCTGCCCGG + Intronic
1151541477 17:74767135-74767157 GAACCCTCTTGGCCTCTGCCTGG + Intronic
1151568759 17:74915634-74915656 GACCCCTCTGGGCCTCTGGAGGG + Intergenic
1153634741 18:7103932-7103954 AACCCCTCTGTCCGTCTGTCTGG + Intronic
1154284213 18:13036474-13036496 TAGCACTCTAGGCCTCTGCCTGG - Intronic
1156348820 18:36284986-36285008 CACACCTCTGACCCTCTGCCTGG + Intergenic
1156399828 18:36730056-36730078 TAGGCCTCTGTGCAGCTGCCTGG - Intronic
1156424413 18:36994226-36994248 TACTCCTCTGTGCCTGTCCCTGG + Intronic
1156579880 18:38362669-38362691 TACCACTCTGTGCCTGTTCTAGG + Intergenic
1157364435 18:47050875-47050897 TCTTCCTCTGTGCCTCTGCCAGG - Intronic
1157735859 18:50048493-50048515 TGCCCTTCTCTTCCTCTGCCTGG - Intronic
1158543697 18:58378510-58378532 CACCCCTCTGTGTCCCTGACTGG - Intronic
1159853201 18:73551582-73551604 TACCTCTCTATGCTTCTCCCAGG - Intergenic
1160413649 18:78691722-78691744 TACCACTGTGTGCCTCTGGGAGG - Intergenic
1161138139 19:2632908-2632930 CACCCGCCTGGGCCTCTGCCTGG + Intronic
1161165512 19:2785255-2785277 GACGCCTCTGAGCCTCTGCGCGG - Intergenic
1161403673 19:4080431-4080453 TACCTCTCTGGGCCTCCGCAGGG - Intergenic
1162479789 19:10921543-10921565 TCTCTCTCTGTGACTCTGCCTGG + Intronic
1163285205 19:16342544-16342566 TGCCTCTCTGTGGCACTGCCTGG - Intergenic
1163685883 19:18711365-18711387 TGCGCCTCTGTGCCTGGGCCGGG + Intronic
1165455390 19:35907727-35907749 TACCGCTCTGGGCCTGGGCCTGG + Exonic
1165523130 19:36330113-36330135 GACGCCTCTGTGTCTCTGTCTGG - Intergenic
1165902660 19:39175953-39175975 GAGCTCTCTCTGCCTCTGCCTGG - Intronic
1166240928 19:41493132-41493154 AACCCTTCTGTGCCTCATCCTGG - Intergenic
1166381435 19:42357236-42357258 GGGCCCACTGTGCCTCTGCCAGG + Intronic
1166393683 19:42423984-42424006 GGCGCCTCTGAGCCTCTGCCTGG + Intronic
1167644028 19:50696076-50696098 TACTCCTCCGTGCCTCTCGCTGG - Intronic
1168296513 19:55379598-55379620 TCCCCCTTTCTGCCTCTCCCTGG - Intronic
1168425741 19:56237027-56237049 TACCCCTCGGTGTCTTTGACAGG - Intronic
925193900 2:1908076-1908098 TTCTCCTCTGTGCCTCTGGCTGG - Intronic
925263925 2:2551269-2551291 TGCACCTCTCTGCCTCTGCCAGG - Intergenic
925473961 2:4192344-4192366 TCCACCTCTGTGGCTCTGCAGGG + Intergenic
925886974 2:8401702-8401724 TCCCCCTGTGTGCCTATGCTGGG - Intergenic
926315166 2:11704391-11704413 TACCCCGCTCTGCCTCCCCCGGG - Intronic
927197988 2:20561113-20561135 CATGCCTCTGTGCCTTTGCCTGG + Intronic
929994700 2:46817943-46817965 TTCCCATCTGTGCCTTTGCAGGG - Intronic
931090077 2:58876316-58876338 TCCCCAGCTGTGCCTCTTCCAGG + Intergenic
931494053 2:62783200-62783222 TCCACCTCTGTGGCTCTGCAGGG + Intronic
933190021 2:79324217-79324239 TGCCCCTATGTGGCCCTGCCTGG - Intronic
934174547 2:89567418-89567440 TACCCCGCTGTGGCTCTACCAGG + Intergenic
934284863 2:91641768-91641790 TACCCCGCTGTGGCTCTACCAGG + Intergenic
935333855 2:101997256-101997278 CACCCCGCTGTGCCTCTCCCTGG + Intronic
936263816 2:110984372-110984394 GATCTCTCTTTGCCTCTGCCTGG + Intronic
938048591 2:128146265-128146287 TACCCCACTGTACCCCAGCCTGG + Intronic
938581745 2:132652612-132652634 CACATCTCTGTGCCTCTGCAGGG - Intronic
938784149 2:134610041-134610063 TTCCCCTTTCTGCTTCTGCCAGG - Intronic
940347600 2:152643573-152643595 TCCCCCTCTGTGTGTCTGTCAGG + Intronic
940399346 2:153229338-153229360 TTACCCTCTGTGCCTTAGCCAGG + Intergenic
941460577 2:165766679-165766701 CACCCTTCAGTTCCTCTGCCAGG + Intronic
941929949 2:170929368-170929390 TAGCCCTCGGTGCCCCCGCCCGG - Exonic
943493373 2:188585208-188585230 TCCACCTCTGTGGCTCTGCAGGG + Intronic
944366861 2:198931009-198931031 TACACATCTATGCCTTTGCCTGG + Intergenic
945357924 2:208860696-208860718 TCCACCTCTGTGCCTTTGCAGGG - Intergenic
948718301 2:239880502-239880524 CACCCCTCAGTGCCTCACCCTGG + Intergenic
1168901393 20:1367987-1368009 TACACTTTTGTGCCCCTGCCAGG - Intronic
1170149193 20:13210963-13210985 TTCTCCTATGTGGCTCTGCCTGG + Intergenic
1170791887 20:19515570-19515592 TACCCCTCTGTGCCTCTGCCTGG + Intronic
1171467019 20:25336864-25336886 CACCCCCCTGGGCATCTGCCTGG - Intronic
1172116239 20:32575042-32575064 CACCTCACTATGCCTCTGCCTGG + Intronic
1172174127 20:32961910-32961932 CTCTCCTCTCTGCCTCTGCCAGG - Intergenic
1172764448 20:37343862-37343884 TACCCCTCTGGGCTTTTGCTAGG - Intergenic
1172871683 20:38139654-38139676 TTCCCCTTTCTACCTCTGCCAGG - Exonic
1172945538 20:38685418-38685440 TCCCACTCAGTGCCTCTGCAAGG - Intergenic
1173245670 20:41335801-41335823 TTGTCCTCTGTTCCTCTGCCGGG + Intergenic
1174099378 20:48115567-48115589 CACCCCTCTCTGACTCTGCTTGG + Intergenic
1174139200 20:48400885-48400907 ATCACCTCTGAGCCTCTGCCAGG + Intergenic
1174563548 20:51448212-51448234 TCACCTTCTGTGCCACTGCCCGG - Intronic
1176169595 20:63690871-63690893 CAGCCCCCTGGGCCTCTGCCGGG - Exonic
1176186835 20:63784864-63784886 AACCCCTCTGTGCATCATCCCGG - Intronic
1177306005 21:19317047-19317069 TCCACCTCTGTGTCTCTGCAGGG + Intergenic
1177312345 21:19413515-19413537 TCCACCTCTGTGGCTCTGCAAGG - Intergenic
1177401699 21:20613836-20613858 TACCCCTCTGGGCCTGTGATGGG - Intergenic
1179584570 21:42366408-42366430 TACCTGTCTGGGCCTCGGCCAGG + Exonic
1179611272 21:42552870-42552892 AACCCATCTCTGCTTCTGCCTGG + Intronic
1179930753 21:44569444-44569466 TCCCACTCTGTGCCTGGGCCAGG - Intronic
1180050181 21:45327511-45327533 AAGCTCTCTGCGCCTCTGCCCGG - Intergenic
1180057691 21:45367357-45367379 CTCTCCTCTCTGCCTCTGCCTGG + Intergenic
1180979339 22:19871447-19871469 TACCTCTTTATGCCCCTGCCTGG + Intergenic
1183107631 22:35626236-35626258 AACCCTTCTGTGGCTCTCCCTGG - Intronic
1183977828 22:41523462-41523484 TGCCCCCCAGTGCCTCTGCAGGG - Intronic
1184749141 22:46474230-46474252 TCCCCATCTGTGCCACTGGCTGG + Intronic
1184839502 22:47044177-47044199 TTCTGCTCTGTGCCTCTGTCCGG + Intronic
1184859852 22:47167228-47167250 TTCCCCGCTGTGCACCTGCCTGG - Intronic
1184864850 22:47196382-47196404 TATCCCTCTGTACCTCTGCCAGG + Intergenic
1185225270 22:49648420-49648442 TACACCTCTGTGGCCATGCCTGG - Intronic
1185394504 22:50579788-50579810 CACCTTTCTTTGCCTCTGCCAGG + Exonic
953580049 3:44145622-44145644 GCCCCCTCCGTGCTTCTGCCAGG + Intergenic
953980492 3:47410790-47410812 TACCCCTATGCCCCTCAGCCTGG + Exonic
954214393 3:49116350-49116372 TATCCTGCTGTGCCTCTGCAGGG - Exonic
956327472 3:68069917-68069939 TCCACCTCTGTGCCTTTGCAGGG + Intronic
956614033 3:71153124-71153146 TACCCCTCTGTGCCTTTAACTGG - Intronic
958662105 3:97083225-97083247 TCCACTTCTCTGCCTCTGCCTGG + Intronic
959293331 3:104502794-104502816 TGCGCCTCAGTGCCTCTTCCAGG - Intergenic
960622327 3:119648790-119648812 TACCCCTCTATGGCCTTGCCTGG + Intronic
961577383 3:127848968-127848990 TTCCCCTCTCTTCCTCTGCCTGG - Intergenic
962935546 3:140077313-140077335 TACCCCTCTGTGCTCCTTCCTGG + Intronic
963547946 3:146685198-146685220 TCCCCCTCTGTGGCTTTGCAGGG + Intergenic
965249702 3:166327460-166327482 TACACCTCTGTGGCTTTGCAGGG + Intergenic
967978165 3:195046807-195046829 CACCCCACTGTGCCTTTCCCAGG - Intergenic
968265620 3:197360765-197360787 TCCGCCTCTGTGGCTCTGCAGGG - Intergenic
968732464 4:2276085-2276107 CACGCCTCTGTGCTTCTGCAGGG - Intronic
968755886 4:2416602-2416624 TGCCCCCATGTGCCTCTGCCGGG - Intronic
969146674 4:5130229-5130251 TGCCCTGCTGTCCCTCTGCCTGG - Intronic
969206406 4:5650263-5650285 TTCCCCTTTTTGCCTCTTCCAGG - Intronic
971825966 4:31622947-31622969 TACCTCTCTGTGCCACAGCCAGG - Intergenic
974267514 4:59603933-59603955 TCCACCTCTGTGACTCTGCAGGG - Intergenic
974455817 4:62128387-62128409 TACGCCTCTGGGCCTCTGATGGG - Intergenic
976605206 4:86976186-86976208 TAAACCTCTGTGCTTCTGCATGG - Intronic
976706762 4:88027246-88027268 TCCACCTCTGTGGCTCTGCAGGG - Intronic
977656052 4:99522019-99522041 TACACCTTTTTACCTCTGCCAGG + Intronic
978105906 4:104901594-104901616 CACTCCTCTGCTCCTCTGCCTGG - Intergenic
978479632 4:109174561-109174583 AACCCCTCTGTGGCACTGCAGGG + Intronic
979180622 4:117721867-117721889 TCACCCTCTGTGGCTCTGCAGGG - Intergenic
980534071 4:134092272-134092294 CACCACTCTGCTCCTCTGCCAGG - Intergenic
985094957 4:186403976-186403998 TACGCCCCTGTGGCTCTGCAGGG + Intergenic
985217972 4:187673027-187673049 TATCCCTCTGTTCCTGTGTCAGG + Intergenic
986836322 5:11642496-11642518 TGCCCTTCTCTTCCTCTGCCTGG - Intronic
987249962 5:16089910-16089932 TTCCAATCTGGGCCTCTGCCAGG - Intronic
987583707 5:19826915-19826937 TACCACTCTGTGCCTTTAACTGG - Intronic
989499525 5:42149608-42149630 TACCCCACTGGGCATCTGCGTGG - Intergenic
989530245 5:42499588-42499610 TGCGGCTCTGTGCCTGTGCCTGG - Intronic
990560357 5:56977857-56977879 GACCACTCTGTGCCTGAGCCTGG + Intergenic
991683446 5:69160820-69160842 TACCCCACCGTGCCTCCGCCTGG + Intergenic
991769353 5:70026023-70026045 CACCCCTCTCCGCCTCTGCATGG + Intronic
991848648 5:70901441-70901463 CACCCCTCTCCGCCTCTGCATGG + Intronic
991860809 5:71011403-71011425 TACCCCCTGGTGCCACTGCCAGG - Intronic
992081229 5:73235228-73235250 TCCACCTCTGTGCCACTTCCAGG - Intergenic
993503026 5:88683282-88683304 GACACCTGTGTGCATCTGCCTGG + Intergenic
994549199 5:101208964-101208986 TCCACCCCTGTGGCTCTGCCAGG - Intergenic
995395157 5:111679679-111679701 TGGCCATCAGTGCCTCTGCCCGG + Intronic
995779748 5:115762626-115762648 TCCACCTCTGTGGCTCTGCAGGG + Intergenic
996453654 5:123655967-123655989 TCCACCTCTGTGGCTCTGCAGGG + Intergenic
997504127 5:134402573-134402595 TGCACCTTTGTGCTTCTGCCTGG + Exonic
997737510 5:136224828-136224850 CACCCTTCTCTTCCTCTGCCTGG + Intronic
999754262 5:154652983-154653005 TACCCCCCTCTGTCTGTGCCTGG + Intergenic
1002596000 5:180323717-180323739 TGCCCCTCCCTGCCTTTGCCTGG - Intronic
1002961063 6:1915277-1915299 CAGCCCTGTGAGCCTCTGCCAGG - Intronic
1003484362 6:6563030-6563052 TCCACCTCTGTGGCTCTGCAGGG + Intergenic
1007178563 6:39912646-39912668 CACCCCTCTCTGCCACTTCCTGG + Intronic
1007423140 6:41731633-41731655 GACCCCACTGTGCCTCTCACTGG - Intronic
1008770698 6:54975396-54975418 AATCCCTCTTTGCCTCTTCCTGG - Intergenic
1011661874 6:89601939-89601961 TGCCCCTCTGGTGCTCTGCCAGG + Intronic
1012213700 6:96556641-96556663 TCCCCCTCTGTGGCGTTGCCGGG + Intergenic
1013969213 6:115996433-115996455 TGACCCTCTATGTCTCTGCCAGG - Intronic
1014144872 6:117986335-117986357 TACCTTTCTGAGGCTCTGCCTGG - Intronic
1014798083 6:125748483-125748505 CACCCCGCTGTGCGTCTGCGAGG - Intronic
1015593713 6:134845998-134846020 TCCCCGTCTGTGCCTTTTCCTGG + Intergenic
1015781323 6:136869283-136869305 CACCCCACTGTACCTCAGCCTGG - Intronic
1016705162 6:147098575-147098597 GACCACTCTGCTCCTCTGCCTGG + Intergenic
1017503504 6:155046746-155046768 GATCCCTCTGTGCCTCTCTCGGG + Intronic
1018417120 6:163611473-163611495 TAGCCCTCACTTCCTCTGCCTGG + Intergenic
1019312977 7:371744-371766 TACCCCTCTCTCCCTCTTCCTGG + Intergenic
1020989008 7:15172241-15172263 GACAGCTCTGTACCTCTGCCTGG - Intergenic
1021928408 7:25555186-25555208 TACCTCTCTGAGCCTCAGCTGGG + Intergenic
1022560624 7:31345606-31345628 GAAACCTCTGGGCCTCTGCCAGG - Intergenic
1023743844 7:43303875-43303897 TACCCATTTGTACCTCTGCTTGG - Intronic
1027220563 7:76211264-76211286 TGCCTCCTTGTGCCTCTGCCTGG - Intronic
1030673427 7:112362073-112362095 AACCCCTCTGTGCCCCCACCAGG - Intergenic
1032073938 7:128827466-128827488 ACCCCCTGTGTGCCCCTGCCTGG + Intergenic
1033273900 7:139956823-139956845 TTCTCCTCTCTGCCTCTGCAGGG + Intronic
1033784203 7:144710822-144710844 TTTGCCTCTGGGCCTCTGCCCGG - Intronic
1034100095 7:148443548-148443570 GACCCCTCTGTGCTTCTGGCTGG - Intergenic
1034421504 7:150993391-150993413 CACCCCTGTGTGCCTTTCCCTGG - Intronic
1035260684 7:157659498-157659520 TTCCCCTGTGCGTCTCTGCCCGG - Intronic
1035531917 8:359408-359430 TGCGCATCTGTGCCTCTGCTTGG + Intergenic
1035683995 8:1509285-1509307 TACGCCTCTGTGCTCCGGCCTGG + Intronic
1036191149 8:6671402-6671424 AACCTCACTGTGCCTCTGCAGGG - Intergenic
1040377750 8:46842855-46842877 TATGCCTCTCTTCCTCTGCCTGG + Intergenic
1041249642 8:55921722-55921744 TGCCCCTCCCTGCCTCTCCCAGG - Intronic
1044693372 8:94900133-94900155 TACCCCTGCTTGTCTCTGCCAGG + Intronic
1045654579 8:104373709-104373731 TAACCATCAGCGCCTCTGCCAGG - Intronic
1046596803 8:116270962-116270984 TGCCACTCTGTGCCTTTGCTTGG + Intergenic
1046863145 8:119117323-119117345 TCCACCTCTGTGTCTCTGCAGGG + Intergenic
1048025670 8:130584401-130584423 GAGCTCTCAGTGCCTCTGCCCGG - Intergenic
1048038953 8:130706688-130706710 TCCGCCTCTGTGGCTCTGCAGGG + Intergenic
1048254937 8:132898496-132898518 TCCCCCTCTGTACATCTGCTGGG + Intronic
1048592561 8:135834266-135834288 TTCGCCTCTGTGCCTTTGCATGG - Intergenic
1049290098 8:141797309-141797331 TACCCCACCGTCCCTCTGCTGGG + Intergenic
1049383148 8:142327455-142327477 CACCCCTCTGTCCCTCTGTAAGG - Intronic
1049820853 8:144632424-144632446 AAACCCTCACTGCCTCTGCCTGG + Intergenic
1052422453 9:28260574-28260596 TAAACCTGTGTGCCTCTGTCAGG - Intronic
1053431266 9:38043271-38043293 TTCCCCACTGTGCCTATGCCTGG + Intronic
1053669313 9:40345358-40345380 TACTCCACTGTGCTTCAGCCTGG + Intergenic
1054380445 9:64485380-64485402 TACTCCACTGTGCTTCAGCCTGG + Intergenic
1054515303 9:66030932-66030954 TACTCCACTGTGCTTCAGCCTGG - Intergenic
1055337525 9:75247630-75247652 TCCACCCCTGTGGCTCTGCCAGG - Intergenic
1055994097 9:82138920-82138942 TTTCCACCTGTGCCTCTGCCAGG + Intergenic
1056881690 9:90400121-90400143 AAACTCTCTGTGCCTCTGGCGGG - Intergenic
1056969571 9:91191150-91191172 TAACCCTCTGAGACACTGCCTGG + Intergenic
1057220488 9:93255198-93255220 TACCCCTCCGTGCCTTTCCTGGG + Intronic
1057420544 9:94908653-94908675 TTCCCCTCTCTACCTCTGCATGG - Intronic
1058537117 9:105973215-105973237 AACCCTTCTTTGCCTCTGCGAGG + Intergenic
1059311176 9:113389967-113389989 TAAACCTCTGGGCCTCTGCAGGG - Intronic
1059325608 9:113502434-113502456 GACCCCTCTGGGCATCTCCCTGG - Intronic
1061632285 9:131880042-131880064 GACCTCCCTGTGCCACTGCCAGG - Intronic
1061791439 9:133061306-133061328 TCCCCTTCTGTCACTCTGCCTGG + Intergenic
1061920242 9:133778651-133778673 CTCACCTCTCTGCCTCTGCCTGG + Intronic
1062108653 9:134769757-134769779 TACCCCTCTTTCCTTCTGCGGGG + Intronic
1062229970 9:135476634-135476656 CTCCCCTCTGGGCCTCTGCTTGG - Intergenic
1062389437 9:136328038-136328060 CACCCCACGGTGCCCCTGCCAGG - Intronic
1185505190 X:627940-627962 TCCCCATCTCTGCCTCTGCTGGG - Intronic
1192194943 X:69021712-69021734 TAGCTCTCTGTGACTCTGGCTGG - Intergenic
1194378600 X:93166251-93166273 TACTTCCCTGTGCCTCTGCTAGG - Intergenic
1195775931 X:108406009-108406031 CACCCCTCTGTGCTCCAGCCTGG - Intronic
1198314405 X:135451801-135451823 TGCCCCTCTGATCCTCTTCCTGG - Intergenic
1199390857 X:147276717-147276739 TACCTCTCTGTCCCTCTTGCTGG - Intergenic
1200181883 X:154155712-154155734 TCCCCCACAGTGCCTCTGCCTGG + Intronic
1200187532 X:154192826-154192848 TCCCCCACAGTGCCTCTGCCTGG + Intergenic
1200193182 X:154229966-154229988 TCCCCCACAGTGCCTCTGCCTGG + Intronic
1200198937 X:154267770-154267792 TCCCCCACAGTGCCTCTGCCTGG + Intronic