ID: 1170792179

View in Genome Browser
Species Human (GRCh38)
Location 20:19517369-19517391
Sequence CAGTGAGTCCAGAGGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 408}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170792179_1170792184 -7 Left 1170792179 20:19517369-19517391 CCATCTCCCCTCTGGACTCACTG 0: 1
1: 0
2: 2
3: 41
4: 408
Right 1170792184 20:19517385-19517407 CTCACTGAGTCATCAGCTGGAGG 0: 1
1: 0
2: 0
3: 35
4: 391
1170792179_1170792183 -10 Left 1170792179 20:19517369-19517391 CCATCTCCCCTCTGGACTCACTG 0: 1
1: 0
2: 2
3: 41
4: 408
Right 1170792183 20:19517382-19517404 GGACTCACTGAGTCATCAGCTGG 0: 1
1: 0
2: 1
3: 13
4: 184
1170792179_1170792186 -1 Left 1170792179 20:19517369-19517391 CCATCTCCCCTCTGGACTCACTG 0: 1
1: 0
2: 2
3: 41
4: 408
Right 1170792186 20:19517391-19517413 GAGTCATCAGCTGGAGGTGGAGG 0: 1
1: 0
2: 3
3: 41
4: 393
1170792179_1170792189 2 Left 1170792179 20:19517369-19517391 CCATCTCCCCTCTGGACTCACTG 0: 1
1: 0
2: 2
3: 41
4: 408
Right 1170792189 20:19517394-19517416 TCATCAGCTGGAGGTGGAGGGGG 0: 1
1: 0
2: 1
3: 80
4: 802
1170792179_1170792187 0 Left 1170792179 20:19517369-19517391 CCATCTCCCCTCTGGACTCACTG 0: 1
1: 0
2: 2
3: 41
4: 408
Right 1170792187 20:19517392-19517414 AGTCATCAGCTGGAGGTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 296
1170792179_1170792188 1 Left 1170792179 20:19517369-19517391 CCATCTCCCCTCTGGACTCACTG 0: 1
1: 0
2: 2
3: 41
4: 408
Right 1170792188 20:19517393-19517415 GTCATCAGCTGGAGGTGGAGGGG 0: 1
1: 0
2: 2
3: 25
4: 356
1170792179_1170792185 -4 Left 1170792179 20:19517369-19517391 CCATCTCCCCTCTGGACTCACTG 0: 1
1: 0
2: 2
3: 41
4: 408
Right 1170792185 20:19517388-19517410 ACTGAGTCATCAGCTGGAGGTGG 0: 1
1: 0
2: 0
3: 33
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170792179 Original CRISPR CAGTGAGTCCAGAGGGGAGA TGG (reversed) Intronic
900706173 1:4081809-4081831 CAGTGAACCCACAGGGGAAATGG - Intergenic
900880344 1:5377049-5377071 CAGTGAGACCCGAGGGCAGCTGG - Intergenic
901074945 1:6548258-6548280 CAGTTACTCCAGAGGTGAGGCGG - Intronic
901318547 1:8324794-8324816 CTGAGGGTCCTGAGGGGAGAAGG + Intronic
901758294 1:11454629-11454651 AACTGAGTCCAGAGAGCAGAGGG + Intergenic
902099364 1:13973278-13973300 CAGTGGATCTAGAGGGGAAAGGG - Intergenic
902108205 1:14055743-14055765 TAGAGATTCCAGAGGGTAGAGGG - Intergenic
902443584 1:16447399-16447421 CAGTGAGCCCCGAGGAAAGAAGG - Intronic
902760123 1:18575580-18575602 CAGTGAGTCCGTGGGGGCGAGGG - Intergenic
902786239 1:18734408-18734430 CAGTGAGTTCAGAGGAGGGCAGG - Intronic
902998021 1:20242864-20242886 CAGGGATCCCAGAGGGGACAGGG + Intergenic
903511349 1:23877575-23877597 CAGTGAGCCGAGAGCCGAGATGG + Intronic
904449078 1:30599404-30599426 CACAGAGTCCAAAGTGGAGAAGG - Intergenic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
904966476 1:34378263-34378285 CAGTGAGATCATTGGGGAGATGG + Intergenic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
905552579 1:38855191-38855213 CAGTCAGTCCAGGGGGGAGGTGG + Intronic
907071003 1:51534826-51534848 CCCTGGGTCCAGAGGAGAGAAGG - Intergenic
907628855 1:56060126-56060148 TACAGAGTCAAGAGGGGAGAGGG + Intergenic
908451627 1:64261741-64261763 CAGAGATTGCAGAGGGGAGTAGG - Intronic
912557428 1:110526294-110526316 CAGAGAGACTAGATGGGAGAAGG - Intergenic
914903159 1:151723043-151723065 CACACAGTCCAGAGGGGAAATGG - Intronic
915514124 1:156402713-156402735 AACTGAGGCCAGAGAGGAGAAGG - Intergenic
915535155 1:156530925-156530947 CAGTGTGTGAAGTGGGGAGAGGG + Intronic
916193553 1:162201962-162201984 CAGTGTGTTCAGAGGAGAGTTGG + Intronic
918125546 1:181580440-181580462 CAGAGAGGCCAGGGAGGAGAGGG + Intronic
919678472 1:200409912-200409934 CGGTGGGTCCAGGAGGGAGAGGG - Intronic
919803113 1:201365345-201365367 CAAAGAGTCCAGAGGAGAGATGG + Intronic
919944103 1:202307371-202307393 CAGGGAGTGCAGGGTGGAGAAGG - Exonic
920128264 1:203711095-203711117 CTGTGCGCCCAGAGGTGAGAGGG + Exonic
920180026 1:204126953-204126975 CAGAGAATCCAGAGGGCACAGGG - Exonic
920310314 1:205044472-205044494 CAGTGAGGCCAGGAGGGAGTGGG + Intronic
920727278 1:208447999-208448021 GAGTGAGGGCAGAGGAGAGAGGG + Intergenic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
921276548 1:213526254-213526276 CAGAGAGTCCAGAGGGTTGTTGG + Intergenic
921822268 1:219630808-219630830 CAGAGAGTCATGAGAGGAGAAGG + Intergenic
922241290 1:223756925-223756947 AACTGAGGCCAGAGAGGAGAGGG + Intronic
922982407 1:229838758-229838780 CATTGTTTCCAGAGGGGCGAGGG - Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923933214 1:238727083-238727105 TAGTGGGTCAAGAGGGGAGCTGG - Intergenic
924112919 1:240717484-240717506 GTGTGAGTGCAGAGGGGAAATGG + Intergenic
924220788 1:241873289-241873311 CATTGAGTCTAGAGGGAAGCAGG + Intronic
924258823 1:242209279-242209301 CAGGGAGTCCTGTGGGAAGACGG - Intronic
924637141 1:245798919-245798941 CAGTGAGTCCAGTTGGAAGCAGG - Intronic
1062822969 10:548480-548502 CAGTGAGGCCAGAGGTGATGTGG + Intronic
1064403442 10:15040077-15040099 GAGTAAGTCCATAGGAGAGAAGG - Intronic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1065169005 10:23009554-23009576 CAGTGAGCCAAGATGGGAGATGG - Intronic
1065597437 10:27328548-27328570 CATTTAATCCAGATGGGAGATGG - Intergenic
1065722754 10:28642447-28642469 CAGAGAGGGGAGAGGGGAGAAGG - Intergenic
1067793420 10:49304239-49304261 CAGAGAGTCAAGAGATGAGATGG - Intronic
1068963194 10:62886115-62886137 CAGTGAGTCAGGAGGGAAGCTGG + Intronic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070756084 10:78994108-78994130 CAGAGACTCTAGAGGGGAAATGG - Intergenic
1071180526 10:82978515-82978537 CAGTAAGCCCAGAAGGGATATGG - Intronic
1071328619 10:84540400-84540422 CAGTGAGTCCCCAGGGGAAAGGG + Intergenic
1072533153 10:96338691-96338713 CAGAGATTCCAGAGGGGATTTGG + Intergenic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1073379165 10:103065024-103065046 GATGGAGTCCAGAGGGAAGATGG + Intronic
1075341226 10:121648236-121648258 CAGTGACTGCAGAGGAGGGATGG - Intergenic
1075552865 10:123405963-123405985 CATTGAGAGCAGAGGGGAAAAGG - Intergenic
1075725140 10:124607134-124607156 CAGTGGGTACAGAGCGGAGAGGG - Intronic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076378685 10:130010454-130010476 CAGTGATTCCAAAAGGGAGGAGG + Intergenic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1077001595 11:326093-326115 CCTTGAGTCCAGGTGGGAGAAGG - Intronic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077136710 11:1003213-1003235 AGGAGAGGCCAGAGGGGAGATGG + Intronic
1077782154 11:5342828-5342850 CATTGCCTCCAGAGAGGAGAGGG - Exonic
1078028432 11:7722456-7722478 CAGTGGTTCAAGATGGGAGAGGG + Intergenic
1078067774 11:8089468-8089490 CAGTGAGCCCACATGGTAGAAGG - Intronic
1078664422 11:13312965-13312987 CAGTGAGACCGGGGTGGAGAGGG + Intronic
1079364987 11:19801307-19801329 CAGTCAGTGCAAAGAGGAGAGGG - Intronic
1079547244 11:21647464-21647486 CAGTGAATCCTGAGGGGAGGTGG - Intergenic
1080591061 11:33723503-33723525 CAGTGAGTCAAGCCTGGAGATGG + Intronic
1081853044 11:46287008-46287030 CAGTGGGTCCACAGGTCAGATGG + Intronic
1083388800 11:62333198-62333220 CAGCGAGGCCAGAAGGGGGATGG + Intergenic
1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG + Intronic
1084221565 11:67683637-67683659 CAGTAAGTCCAAAAGGGAGGAGG - Intergenic
1084670599 11:70604428-70604450 CAGTGAGTCCAGGAGGGCCAGGG + Intronic
1084712767 11:70854321-70854343 TAGTGAGTCCAGCAGAGAGAAGG + Intronic
1087718497 11:101636193-101636215 CACTGATTCCAGAGGGGTGAGGG + Intronic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1089260562 11:117221174-117221196 CAGTGAGTACAGTGGAGAAAGGG - Intronic
1090653422 11:128825255-128825277 CAGTGGCTCCAGAGAGGTGAGGG - Intergenic
1091364309 11:135004983-135005005 TAGTGACAGCAGAGGGGAGAAGG - Intergenic
1091624582 12:2112360-2112382 CAGTGAGTGCAGGGAGGACAGGG + Intronic
1091703928 12:2681079-2681101 TCATGAGGCCAGAGGGGAGAAGG - Intronic
1091710607 12:2737555-2737577 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1091713453 12:2759617-2759639 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1092117629 12:6020667-6020689 CTGAGAGTCCAAAGAGGAGATGG - Intronic
1093888091 12:24486546-24486568 AAGAGAGGCCAGAGGGGACAAGG - Intergenic
1093963232 12:25298659-25298681 CAGTGAGTCCGGTGGGGTGGGGG - Intergenic
1094042662 12:26133861-26133883 CAATGAGGACAGAGTGGAGAAGG + Intronic
1094720035 12:33053217-33053239 CAGGGAGGCCAAAGGGGAGTGGG - Intergenic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1095281969 12:40362600-40362622 CAGTGACACCAGTGGGGAAAAGG + Intronic
1096582918 12:52600038-52600060 CAGTGAGTGGAGAGGAGACAGGG - Intronic
1096985183 12:55751402-55751424 CAGTGAGTCCAGAGGAGAATGGG - Exonic
1097228181 12:57491520-57491542 CAGTGACAACAGAGAGGAGAAGG - Intronic
1097761759 12:63474283-63474305 CAGAGATTCCAGAGGGGGGAGGG - Intergenic
1100193491 12:92218185-92218207 AAGTGAGAACAGAGTGGAGAAGG + Intergenic
1100281194 12:93119977-93119999 CAGAGAGAACTGAGGGGAGATGG - Intergenic
1102039689 12:109792839-109792861 AAGAGAGGCCAGAGGGGAGAGGG + Intronic
1102547569 12:113667661-113667683 CAGAGAGAAAAGAGGGGAGATGG - Intergenic
1103188733 12:118982324-118982346 CACAGAGTCCAGAGGGCAGGTGG + Intronic
1104639914 12:130460882-130460904 CAGTGAGCCCAGTTGGGTGAGGG - Intronic
1105883125 13:24620974-24620996 CAGTGTTTCCAGAGGGGATTAGG + Intergenic
1105931921 13:25060568-25060590 AAGTGAGTCCTGAGCAGAGATGG - Intergenic
1106019362 13:25899916-25899938 CAGGGAGTCCAGCTGGGTGATGG + Intronic
1106333067 13:28756945-28756967 CAGTGAGAGTAGAGGAGAGAAGG - Intergenic
1106865520 13:33960030-33960052 CAGTGAGTTCACATGGGAGCTGG - Intronic
1107445469 13:40466552-40466574 CAGTCAGGCCAGTGGGGAAATGG - Intergenic
1107517175 13:41141437-41141459 CAGTTAGCCCACAGGAGAGATGG - Intergenic
1108473173 13:50787798-50787820 CACAGAGTCCATCGGGGAGATGG - Intronic
1108638160 13:52356777-52356799 TAGTGTGCCCAGAGGGGACATGG + Intergenic
1108980178 13:56501177-56501199 CAGTGAATCCATAGGGGACTAGG - Intergenic
1109720148 13:66265553-66265575 CAGTGACTCCTGATGGAAGAAGG + Intergenic
1112333932 13:98498714-98498736 CAGGGTGTACAGTGGGGAGACGG - Intronic
1115140209 14:30162120-30162142 AACAGAGTCCAAAGGGGAGAAGG - Intronic
1115238257 14:31229077-31229099 CACTGTGTACAGAGGGGACATGG + Intergenic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1116856719 14:49959140-49959162 CAGTGAGCCGAGATGGGAGGCGG - Intergenic
1118982601 14:70728859-70728881 CAGAGAGTCTTGAGGGAAGAGGG + Intronic
1121495409 14:94388632-94388654 CAGTGGATCCAGAGGGGCAACGG + Exonic
1121760638 14:96441898-96441920 CAGTGGGGACAGAGGGGTGATGG - Intronic
1122280373 14:100618701-100618723 CTGTGAGTCCAGAAAGGATAGGG + Intergenic
1123968466 15:25481846-25481868 TACAGACTCCAGAGGGGAGAGGG + Intergenic
1124642397 15:31404057-31404079 CAGGGAGTTCGGAGAGGAGAGGG - Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126693027 15:51302611-51302633 CTGTGAGGACAGTGGGGAGAGGG - Intronic
1127913393 15:63436613-63436635 CAGTGAGTCCAGAAGAGAACAGG + Intergenic
1128112057 15:65082660-65082682 CAATGAGGCCAGAGAGGAGTGGG - Intergenic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1128736144 15:70055049-70055071 CAGGCAGTCCAGCTGGGAGATGG + Exonic
1129191751 15:73941647-73941669 CCCTGAGGCCAGAGAGGAGACGG + Intronic
1129328976 15:74816996-74817018 CATTGAGCCCAGAGAGGGGAAGG + Intronic
1129832783 15:78681615-78681637 CAGTGAGGCCACAGGAGAGAGGG + Intronic
1131108465 15:89750162-89750184 CAGCCACTCCAGAGGCGAGAGGG + Exonic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1132551197 16:554452-554474 CAGGGAGGCCAAAGGGGAGTGGG - Exonic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1132860767 16:2070694-2070716 CAGTGGGTGCAGAGGAGGGACGG - Intronic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133228492 16:4354845-4354867 CAGTGAGACCAGGGGAGACAGGG + Exonic
1133255079 16:4511749-4511771 CAGTGAGGACACAGGGCAGACGG + Exonic
1135046917 16:19163495-19163517 CAGGGAGGCCAGTGAGGAGATGG - Intronic
1135235748 16:20754177-20754199 CAGTGAAATAAGAGGGGAGAAGG + Intronic
1136098405 16:27975241-27975263 CAGGGAATCAAGAGGGCAGAAGG - Intronic
1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG + Intronic
1139757977 16:69160383-69160405 CAGTCAGTCCAGATGGGAATTGG + Exonic
1139868957 16:70088283-70088305 CAGTGAGAATAGGGGGGAGATGG - Intergenic
1140386430 16:74543889-74543911 CAGTGAGAATAGGGGGGAGATGG + Intronic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142154257 16:88526050-88526072 CAGTGAGGCCAGGGGGGCCAGGG + Intronic
1142180579 16:88667518-88667540 CACTGATTCATGAGGGGAGAGGG + Intergenic
1142427805 16:90009865-90009887 AAGTCAGTCCACAGTGGAGAGGG - Intronic
1142666785 17:1467902-1467924 CAGAGATTCCTGAGGGGAGAGGG + Exonic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1142809495 17:2388648-2388670 CAGGGAGTCTGGAGGGGAGTGGG - Intronic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143346725 17:6254995-6255017 CAGTGACCACAGAGGGGAGCTGG + Intergenic
1144344729 17:14339573-14339595 CACTGAGTCTAAAGGAGAGAGGG - Intronic
1144400567 17:14895112-14895134 CAGGAACTCCAGAGGGTAGAGGG + Intergenic
1145006622 17:19342191-19342213 CAGTAAGGCCAGAAGGCAGAGGG + Intronic
1145250534 17:21294662-21294684 CAGTGACTCCACAAGGGAGTAGG - Intronic
1146638163 17:34521164-34521186 CAGTGAGTCTAGAAGGTAGGTGG - Intergenic
1147122395 17:38343414-38343436 CCGTGAGTCCAGTGTGGAGGAGG - Exonic
1147895236 17:43746277-43746299 CTCATAGTCCAGAGGGGAGACGG + Intergenic
1148761403 17:50003594-50003616 CGGTGAGGCAAGAGGGTAGATGG + Intergenic
1148960630 17:51389711-51389733 AACTGAGGCCAGAGAGGAGAAGG + Intergenic
1149644882 17:58233141-58233163 GAGTGAGTTCAGAGCGGAGTCGG - Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150233563 17:63573868-63573890 CAGGGAGCCCAGAGGGGAACAGG - Intronic
1150768034 17:68018293-68018315 CAGTGAGCCGAGAGCCGAGATGG - Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151860408 17:76756895-76756917 CACAGAGGCCAGAGGGGAAAAGG + Intronic
1152320362 17:79605535-79605557 CGGTGGGTCCAGTAGGGAGACGG + Intergenic
1152330549 17:79670181-79670203 CAGTGAATGCAGAGGGAAGTGGG - Intergenic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1154166051 18:12015291-12015313 AAGTGGGTCAAGAGGGGAGGCGG - Intronic
1155334985 18:24754440-24754462 CAGTGAGTACAGTGTGGTGATGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156503918 18:37577193-37577215 GAGTGAGCCCAGAAGGGAAAGGG - Intergenic
1156719353 18:40050527-40050549 CAGTGAGCTTAGAGGGGTGAAGG - Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1159938352 18:74386459-74386481 CAGAGAGGCCAGACGGGAGGTGG + Intergenic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160435259 18:78847189-78847211 CAGAGAGTCAAGATGGGATAAGG - Intergenic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1161960301 19:7519605-7519627 CAGTGAGGCCAGAGGAGATGGGG - Exonic
1162028231 19:7906068-7906090 CAGGGAGTCCAAAGTGGAGCTGG - Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164629801 19:29754768-29754790 CTGTGAGCACAGTGGGGAGAGGG - Intergenic
1164923283 19:32105757-32105779 CAATGGGTCCAGGTGGGAGATGG + Intergenic
1164952524 19:32349324-32349346 CAGTGAGCCTAGAGGGCAAATGG + Intronic
1165281435 19:34801581-34801603 CAAAGAGTCCACAGTGGAGAAGG - Intergenic
1165429450 19:35764185-35764207 CAGTGACTCCAGTGGGAAGTGGG + Intronic
1166826567 19:45613520-45613542 GAGTGAGTCCCTTGGGGAGATGG - Exonic
1167220879 19:48197208-48197230 TAGGGAGTGCAGCGGGGAGAGGG + Exonic
925189521 2:1871494-1871516 CAGTGAAGCCGGAGGGCAGAGGG + Intronic
925234402 2:2265526-2265548 CAGTGGGTACAGAGGGGACCAGG + Intronic
925910086 2:8568121-8568143 CAGTGAGCCCAGAGGCCAGGAGG - Intergenic
926507145 2:13731261-13731283 CAGTGACTCCAAAAGGGAGAAGG - Intergenic
926913707 2:17874230-17874252 CAGTGAGCATAGAGGAGAGATGG + Intergenic
928933016 2:36645085-36645107 CTGTGAGTCTACAAGGGAGATGG + Intronic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929891142 2:45919423-45919445 AAGAGAGGCCAGAGGGCAGAAGG - Intronic
930555852 2:52894786-52894808 CACTGAGCCTAGAAGGGAGAGGG - Intergenic
930709197 2:54534149-54534171 CAATGAGTCCAGGCGTGAGATGG - Intronic
931190314 2:59994033-59994055 CTGTAAGTCCAGAGTGGAGCAGG - Intergenic
932337976 2:70941911-70941933 CACTGAAGCCAGAGTGGAGAAGG + Exonic
934534096 2:95118605-95118627 CAGGGATTCCAGAGGGAAGGGGG - Intronic
934772047 2:96913405-96913427 CAGGGAGTCCACAGTGGAGAAGG + Intronic
935061805 2:99615214-99615236 CTGGGAGTCCAGATGGTAGAGGG + Intronic
936547953 2:113409099-113409121 TTGTGAGTCCAGAGAGGAGAAGG + Intergenic
937257961 2:120568197-120568219 CAGAGAAGCCAGAGGGGAGGTGG - Intergenic
937307477 2:120881368-120881390 CAGGGAGGACAGTGGGGAGAGGG + Intronic
938083356 2:128381968-128381990 CAGAGAGTCCAGAGAGGCTAAGG + Intergenic
938934394 2:136116362-136116384 CAGGGAGGGAAGAGGGGAGAAGG + Intronic
940086897 2:149870232-149870254 CACTCAGTCCATAGGGCAGATGG - Intergenic
942068501 2:172294219-172294241 CAGGGAGTCGAGAGGAGGGAAGG - Intergenic
942176086 2:173335937-173335959 CATTGAGACCTGAGGGGAGCAGG + Intergenic
943041127 2:182806878-182806900 CAGTGTGTCTAGAAGGGATAAGG - Intergenic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
944502516 2:200376829-200376851 GGGTGACTCCAGAGAGGAGAGGG - Intronic
945825117 2:214712152-214712174 CAGCCAGTCCAGATGGGAGTGGG + Intergenic
947996838 2:234534996-234535018 GAGTGAAACCAGAAGGGAGAGGG - Intergenic
948044695 2:234934760-234934782 CAGAGAGTCCAGAATGGAGACGG - Intergenic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
948976527 2:241466761-241466783 CAGGGAGGCCAAAGGGGAGTGGG - Intronic
1168781327 20:493337-493359 CAGTGAGACCAGTTAGGAGAAGG - Intronic
1168978200 20:1983666-1983688 CAGGGAGGCCAGCAGGGAGAGGG - Intronic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1170816693 20:19720311-19720333 CAATGCCTCCAGAGGGGAGAGGG - Intronic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1171330870 20:24337773-24337795 CAGTGAGGTCAGAGGGGAGCAGG + Intergenic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1174421255 20:50400481-50400503 AAGTGAGTTCAGAGGGGTGAAGG + Intergenic
1175365718 20:58454373-58454395 CAGTCAGTCCAGAGAGGAGCAGG - Intergenic
1175539060 20:59736845-59736867 CAGGGAAGGCAGAGGGGAGAGGG + Intronic
1175621993 20:60455103-60455125 CAGTGAAACCAGAGGACAGATGG + Intergenic
1176597421 21:8759678-8759700 CACTGATTCCACAAGGGAGATGG + Intergenic
1178724021 21:35035395-35035417 CAGAGAGGCCAGATGGGAGTGGG + Intronic
1180569063 22:16699080-16699102 CTGAGAGTCCAAAGAGGAGATGG - Intergenic
1180836156 22:18930517-18930539 CAGTGAGTGTAGAGGGCAGTTGG + Intronic
1181516140 22:23414836-23414858 CCGGGAGTCCCGAGGGGAGTCGG + Intergenic
1181533078 22:23528219-23528241 GATAGAGCCCAGAGGGGAGATGG + Intergenic
1182387575 22:29958555-29958577 CACTGAGACAAGAGGGGAGCAGG - Intronic
1182540222 22:31035938-31035960 CTGTGAGCCCAGAGAGGATAAGG - Intergenic
1183912772 22:41091881-41091903 CAGAGAGTGCGGAGGGGAGTCGG + Exonic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184242303 22:43217614-43217636 CAGTGAGGCCAGAGGTGATGGGG - Intronic
1184282577 22:43446602-43446624 AACTGAGTCCAGATGGGGGATGG + Intronic
1184468457 22:44682464-44682486 CAGAGAGGCCAGCGGGGACATGG - Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1184924354 22:47626620-47626642 AAGGGAGTTCAGAGGGGACAGGG - Intergenic
1185333269 22:50261021-50261043 CCGTGGGTCCCCAGGGGAGAAGG - Intronic
1203286248 22_KI270734v1_random:155816-155838 CAGTGAGTGTAGAGGGCAGTTGG + Intergenic
949930498 3:9074614-9074636 CAGTGAGCCCAGGGTGGAGCTGG + Intronic
950211391 3:11126281-11126303 CAGGGACTCCAGAGAGGATATGG + Intergenic
950407637 3:12814631-12814653 CTGGGACTCCAGAAGGGAGAAGG - Intronic
950725987 3:14917370-14917392 CAGGGAGACCCCAGGGGAGAAGG + Intronic
952268590 3:31810782-31810804 CAGTGAGTCCACAGGGTGTAAGG + Intronic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
954331840 3:49895365-49895387 CAGGGAGTGCTGTGGGGAGAGGG + Exonic
956519204 3:70085027-70085049 CAGTGATGGCAGAGGGGAGAGGG + Intergenic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
956939861 3:74145733-74145755 CAGTGAGACCCGGGGAGAGAGGG + Intergenic
960346402 3:116538741-116538763 CAGAGAGGCCAGAAGAGAGACGG - Intronic
961204299 3:125068618-125068640 CAGTGGGGCAAGAGGGGTGAAGG + Intergenic
961502993 3:127350694-127350716 TGGTGAGGCCAGAGGGGTGAGGG - Intergenic
961514836 3:127426027-127426049 CAGTGAGTCCTGGGGGAAGCTGG + Intergenic
962825864 3:139100670-139100692 CAGAGAGGCCAGAGGGGTCAGGG - Intronic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
964199367 3:154100799-154100821 GAGTGAGTCAAGCGTGGAGACGG - Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968813248 4:2809361-2809383 CACTGAGCCCAGAGGAGGGAGGG - Intronic
968813261 4:2809411-2809433 CACTGAGTCCAGGGGAGAGAGGG - Intronic
969144691 4:5112195-5112217 CAGTAAGGATAGAGGGGAGATGG + Intronic
969179093 4:5423774-5423796 CAGTGAGTCCAGAGGGGTGGTGG + Intronic
969511265 4:7619351-7619373 CAGTAAGTCCAGGGAGCAGAGGG + Intronic
971959848 4:33471502-33471524 CTGTCAGTACAGAGGAGAGATGG - Intergenic
972325375 4:38010580-38010602 GAGGGAGTGCAGAGTGGAGAAGG - Intronic
973014813 4:45125051-45125073 CAATGAGTTCAGTGGGGGGAGGG + Intergenic
973652950 4:53015066-53015088 CAGTGAGTCAGGAGGAGAAAAGG + Intronic
974478844 4:62419327-62419349 TAGTGAGTCAATAGGGGTGATGG + Intergenic
975556418 4:75670181-75670203 GAGGGACTCCAGAGGGGAAAGGG - Intronic
977557134 4:98497750-98497772 AGCTGAGTCTAGAGGGGAGACGG + Intronic
977620868 4:99135637-99135659 CAGTGAGTGCACAGTGGAAAGGG + Intronic
978744255 4:112174204-112174226 CAGTGAGTGCAGGGAGGGGAAGG - Intronic
980784419 4:137533449-137533471 CAGTGAATACAGGGGGGACATGG + Intergenic
982275348 4:153631932-153631954 AAGTGAGTCCAGTGGGTACAGGG - Intronic
986044320 5:4022800-4022822 CAGGGAGTCCAGCAGGGAGAAGG - Intergenic
986226945 5:5824606-5824628 CAGGGAGTCCTGAGGTGACAGGG - Intergenic
986277232 5:6287199-6287221 CAGGGAATCCAAAGGGGAGCAGG + Intergenic
987123273 5:14787916-14787938 AAGTGAGTCCAACAGGGAGAAGG - Intronic
988695975 5:33623249-33623271 CAGTAGGGCCTGAGGGGAGAGGG - Intronic
988714046 5:33807067-33807089 CAGAGAGGCCAGAGGAGAAAGGG - Intronic
989852921 5:46238490-46238512 CATTGAGGCCAGGGGTGAGAAGG - Intergenic
990013047 5:51023415-51023437 CAGGAAGGCCAGAAGGGAGAAGG - Intergenic
990523176 5:56599510-56599532 CAGGGAGACCTGAGGGGAGGAGG + Intronic
990678282 5:58213159-58213181 GAGTGAGTACAGAGGAGACATGG - Intergenic
992152087 5:73914824-73914846 CAGTGAGTCCAGGAGGTGGATGG - Intronic
992610943 5:78508116-78508138 AAGTGAGTCAAAAGGGGACAAGG + Intronic
994106615 5:95956727-95956749 CACTGAGTCCATAGGTCAGAGGG - Intronic
994106763 5:95958609-95958631 CAGTGAGTCCTGATAGGAGCTGG + Intronic
994182519 5:96783090-96783112 CCGTGCGTACAGAGGGCAGAAGG - Exonic
995033138 5:107502249-107502271 CAGTGAGTCATGAGAGGAAATGG - Intronic
995397798 5:111706438-111706460 CAGTTTGTCCAGGGTGGAGATGG + Intronic
995569364 5:113463174-113463196 CAGAGAGCCTAGAGGAGAGAGGG + Intronic
996546320 5:124682545-124682567 CAATCAGTCCAGATTGGAGAAGG + Intronic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
998031046 5:138868344-138868366 CAGTGAGTACAGATGGGAAAAGG - Intronic
998167821 5:139854554-139854576 CAGTGAGCCCAGAGGAGACTGGG - Intronic
999197232 5:149790731-149790753 CAGTGACTCCAGCTGTGAGATGG + Intronic
999217165 5:149944889-149944911 CTGTGGGGCCAGATGGGAGAAGG + Intergenic
999852859 5:155561658-155561680 CAGTGAGTTCAGAGGTGGGATGG - Intergenic
1000365137 5:160483675-160483697 CAGTGATTCCCCAGGGGTGAGGG + Intergenic
1001378559 5:171286325-171286347 CAGTGATTCCAGGGGAGAGCAGG + Intronic
1001893470 5:175359121-175359143 CAGTGAGCCCAAAGAGGACAGGG + Intergenic
1002000831 5:176195470-176195492 GAGGCAGTCCAGAGGGGTGAGGG + Intergenic
1002253505 5:177943500-177943522 GAGGCAGTCCAGAGGGGTGAGGG - Intergenic
1002522217 5:179798213-179798235 CAGTGCTTCCAGAGGGCCGAAGG + Exonic
1002719949 5:181252755-181252777 CACTGAGTCCACAGTGGAGGTGG - Intergenic
1003480000 6:6522158-6522180 GTGTGAGTGCAGTGGGGAGAAGG - Intergenic
1003540267 6:7012515-7012537 CAGTGAGTCCTGAAGGAAGGAGG + Intergenic
1005131431 6:22513026-22513048 CAGTGAGCCAAGAGAGAAGATGG + Intergenic
1005467689 6:26131209-26131231 CAGAGAGTACAGATGGGATAGGG - Intronic
1005822297 6:29607891-29607913 CAGTGAGGCCAGAGTGCAGCTGG - Intronic
1006415749 6:33902963-33902985 CTGTGAGCCCAGAGGGGATTGGG - Intergenic
1006435474 6:34023811-34023833 AACTGAGGCCAGAGGGGTGAGGG + Intronic
1006729066 6:36222082-36222104 CAGAGAGGGGAGAGGGGAGAAGG + Intronic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1012985652 6:105873705-105873727 GAGTGAGTCCACCGGAGAGATGG - Intergenic
1013069271 6:106713887-106713909 CAGTCAATCCTGAGTGGAGAGGG - Intergenic
1013655527 6:112242923-112242945 CAGAGGGTCCAGAGAGGAGAAGG - Intronic
1015555768 6:134459842-134459864 CAGTGAGTGCAGAAGGAAGCGGG - Intergenic
1015626364 6:135183158-135183180 CAGGTAGCCCAGAGGGGAGGCGG + Intronic
1015631319 6:135234838-135234860 CTTTGAGGCGAGAGGGGAGAAGG - Intergenic
1015920793 6:138264654-138264676 CAGGGAGTCTAGAGAGGGGAGGG - Intronic
1016648365 6:146435352-146435374 CTGTCAGCCCAGCGGGGAGAAGG - Exonic
1017726186 6:157277459-157277481 GAGTGGGACCAGAGGAGAGAAGG - Intergenic
1018081472 6:160262590-160262612 CAGTGAGTTCAGTGTGCAGAAGG + Intronic
1018362695 6:163087643-163087665 GAGTGAGACCAGAGGAGAGGAGG + Intronic
1018362721 6:163087775-163087797 GAGTGAGACCAGAGGAGAGGAGG + Intronic
1018720011 6:166565362-166565384 CAGTCAGTCCCGAGGGAAGCTGG - Intronic
1019210662 6:170401992-170402014 CAGGGAGTCCTGAGGGAGGATGG - Intronic
1019521359 7:1461832-1461854 CAGTGAGGCCAGAAGGCAGCGGG - Intergenic
1019738044 7:2660090-2660112 CAGTGAGTGCAGGGTGGAGGCGG - Intronic
1021419758 7:20432621-20432643 CTGAGAGTCCACAGTGGAGATGG - Intergenic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022849968 7:34250087-34250109 CAGTTAGTCCAGTTGGGAGGTGG + Intergenic
1023299979 7:38759702-38759724 CAGTTAGTCCAGAATGGGGATGG - Intronic
1023585887 7:41729322-41729344 CAGTGAAGCCAGAGGTGAAAGGG + Intergenic
1023857870 7:44196184-44196206 GAGTGAGGCCAGAGAGGAGCAGG + Intronic
1023943131 7:44782821-44782843 CAGTGAGGGCAGATGGCAGAGGG + Intergenic
1026364352 7:69632601-69632623 CAGAGAGGGAAGAGGGGAGAGGG - Intronic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1028210162 7:88064079-88064101 CAGTTAGTCCAGATGTGAGCAGG + Intronic
1029357685 7:100064582-100064604 CAGCGAGTCCACACTGGAGAGGG + Exonic
1030153273 7:106426973-106426995 AAGTGGGTCCAGAGAGGTGATGG + Intergenic
1033321429 7:140343258-140343280 CAGCTGGTCCTGAGGGGAGACGG + Intronic
1033800944 7:144901474-144901496 GAGAGAGTGCAGAGGGGAGTGGG + Intergenic
1034122831 7:148643083-148643105 CATTGAGTGAAAAGGGGAGATGG - Intergenic
1034312139 7:150098082-150098104 CAGTGAGTGCAGATAGGAGATGG - Intergenic
1034794716 7:154002576-154002598 CAGTGAGTGCAGATAGGAGATGG + Intronic
1034940670 7:155228309-155228331 CCCTGAGTCCGGAGGGAAGAAGG + Intergenic
1035056692 7:156040644-156040666 GAGGGAGTGCAGGGGGGAGAAGG - Intergenic
1035587157 8:785533-785555 CAGAGAGACCTGAGGGGAGGAGG - Intergenic
1036403723 8:8434311-8434333 CAGAGGGTGCAGAGGAGAGAAGG + Intergenic
1037291970 8:17360710-17360732 CAGTGAGTACATAGAGGAGCCGG + Intronic
1037778192 8:21849395-21849417 CAGTGAGCCCTGAGTGGAAACGG + Intergenic
1037822643 8:22142327-22142349 CAGTGGGTCCAGGAGGGAAAGGG + Intergenic
1038026039 8:23591642-23591664 CAGTGAGAACATAGGGGAAAGGG + Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040855317 8:51942962-51942984 CAGTGAGTGGAGAGGGGACCAGG - Intergenic
1041640366 8:60193320-60193342 CAGTCAGTCCAGATGTGAGCAGG - Intronic
1045016141 8:98003342-98003364 CACTGAGTCCTGGGGTGAGAGGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045498966 8:102730562-102730584 CAGTGAGTCCAGGTGGGAGGTGG - Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047429875 8:124781883-124781905 CAGTGAAGCCAAAGAGGAGAAGG + Intergenic
1047928402 8:129702911-129702933 CAGGGAGTTCTGAGGGCAGAGGG - Intergenic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1048493666 8:134917625-134917647 TAGTGAATCCAGAGGGAAGGAGG - Intergenic
1048748491 8:137643509-137643531 CAGTGCCTCCAGAGTGGATAAGG + Intergenic
1048787262 8:138063470-138063492 GAGTGAGACCAGAGTGGAGTGGG + Intergenic
1049060497 8:140272724-140272746 CAGTGAGGGGAGAGGGGAGGAGG + Intronic
1049698804 8:143997264-143997286 AAGTGGGTCCAGAGGGTGGAGGG - Intronic
1049702304 8:144020802-144020824 AAGAGAGTTCTGAGGGGAGAGGG - Intronic
1049702333 8:144020914-144020936 GAGGGGGTCCTGAGGGGAGAAGG - Intronic
1049702423 8:144021236-144021258 AAGAGAGTCCTGAGGGGAGAGGG - Intronic
1049702438 8:144021284-144021306 AAGAGGGTCCTGAGGGGAGAGGG - Intronic
1049702481 8:144021462-144021484 AAGGCAGTCCTGAGGGGAGAGGG - Intronic
1049702496 8:144021510-144021532 CAGAGGGCCCTGAGGGGAGAGGG - Intronic
1049702512 8:144021589-144021611 CAGAGGGTCCTGAGGTGAGAGGG - Intronic
1049702645 8:144022118-144022140 AAGAGGGTCCTGAGGGGAGAGGG - Intronic
1049702688 8:144022309-144022331 AAGGCAGTCCTGAGGGGAGAGGG - Intronic
1049702703 8:144022357-144022379 CAGAGGGCCCTGAGGGGAGAGGG - Intronic
1049702719 8:144022436-144022458 CAGAGGGTCCTGAGGTGAGAGGG - Intronic
1049703126 8:144023982-144024004 TAGAGGGTCCTGAGGGGAGAGGG - Intronic
1049703184 8:144024179-144024201 AAGAGAGTCCTGAAGGGAGAGGG - Intronic
1049703392 8:144024911-144024933 AAGAGGGTCCTGAGGGGAGAGGG - Intronic
1049703469 8:144025203-144025225 AAGAGAGTCCTGAAGGGAGAGGG - Intronic
1051100356 9:13514006-13514028 AGATGAGTCCAGAGGGCAGATGG - Intergenic
1052821247 9:33139361-33139383 CAGCGAGTTCAGAAGGGAGCAGG - Intronic
1053481868 9:38422082-38422104 GAGTGAGGCCAGATGGCAGATGG - Intronic
1056779515 9:89538858-89538880 CAGTGTGTGCAGTGGGGTGATGG + Intergenic
1058944897 9:109847003-109847025 CAATGTGGCCAGTGGGGAGATGG + Intronic
1060984611 9:127812917-127812939 CAATGAGGCCAGAGTGGGGAAGG + Intronic
1061118329 9:128628374-128628396 CAGTAAGTCCACAGCTGAGAAGG + Intronic
1061247381 9:129407586-129407608 GACAGAGCCCAGAGGGGAGATGG - Intergenic
1061578532 9:131522758-131522780 CAGTGCATCCAGGTGGGAGATGG + Intronic
1061873031 9:133530713-133530735 AAATGAGTCCATATGGGAGAAGG - Intergenic
1062032517 9:134368108-134368130 CAGGGAGTCCCGGGGGGAGGGGG - Intronic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062573411 9:137195699-137195721 CAGAGAGCCAAGAGGGGAGGAGG + Intronic
1185490942 X:516579-516601 CAGTGAGAGGAGGGGGGAGAAGG - Intergenic
1185839609 X:3376369-3376391 CAGTGATTCCAAAAGGGAGGAGG - Intergenic
1186081238 X:5935460-5935482 CAGTGAATGCAGAGAGGACAGGG + Intronic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1187418534 X:19114471-19114493 CAGTGATTCCAGTGGGCAGCGGG + Intronic
1189368125 X:40405626-40405648 CAGTGAATCCAGAAGGAAAAAGG - Intergenic
1190326965 X:49212490-49212512 CAGTGAGACCAGAGGTGTGTTGG + Intronic
1190340217 X:49290401-49290423 GAATGAGGCCTGAGGGGAGATGG - Intronic
1190375155 X:49782132-49782154 CAGTAAGGCTTGAGGGGAGATGG - Intergenic
1190626595 X:52343564-52343586 AAATGAGGCCTGAGGGGAGATGG - Intergenic
1190701416 X:52992265-52992287 AAATGAGGCCTGAGGGGAGATGG + Intronic
1191842502 X:65523401-65523423 AACTGAGTCCAGAGAGGGGAGGG - Intronic
1193359924 X:80569976-80569998 CTGGGAGCACAGAGGGGAGAGGG - Intergenic
1194148731 X:90296987-90297009 CAGTAATTCCAAAAGGGAGAAGG + Intergenic
1195002109 X:100651722-100651744 CAGTGAGCCGAGAGCTGAGATGG + Intronic
1195010371 X:100727854-100727876 CAGGGAGTGCTGAGGGAAGAGGG + Intronic
1198649464 X:138845835-138845857 AAGTAAGTACAGAGGGGAAATGG + Intronic
1198683232 X:139203802-139203824 CCGTGCGTCCAGAGGGGAAGTGG + Intronic
1199602928 X:149553625-149553647 CTCTTAGTCCAGAGGGGAGATGG - Intergenic
1199647461 X:149925850-149925872 CTCTTAGTCCAGAGGGGAGATGG + Intergenic
1200495102 Y:3873719-3873741 CAGTAATTCCAAAAGGGAGAAGG + Intergenic
1201236206 Y:11914495-11914517 CAGTGATTCCAAAAGGGAGGAGG + Intergenic