ID: 1170793214 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:19525116-19525138 |
| Sequence | GGCTGGCTTGGGAGAGAAAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1170793214_1170793225 | 6 | Left | 1170793214 | 20:19525116-19525138 | CCCCTTTCTCTCCCAAGCCAGCC | No data | ||
| Right | 1170793225 | 20:19525145-19525167 | ATATAGTAGAGACTCCAGATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1170793214 | Original CRISPR | GGCTGGCTTGGGAGAGAAAG GGG (reversed) | Intronic | ||