ID: 1170793214

View in Genome Browser
Species Human (GRCh38)
Location 20:19525116-19525138
Sequence GGCTGGCTTGGGAGAGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170793214_1170793225 6 Left 1170793214 20:19525116-19525138 CCCCTTTCTCTCCCAAGCCAGCC No data
Right 1170793225 20:19525145-19525167 ATATAGTAGAGACTCCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170793214 Original CRISPR GGCTGGCTTGGGAGAGAAAG GGG (reversed) Intronic