ID: 1170793817

View in Genome Browser
Species Human (GRCh38)
Location 20:19529482-19529504
Sequence TTGTGGAGATGGAGAGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1423
Summary {0: 1, 1: 0, 2: 15, 3: 152, 4: 1255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170793817_1170793825 8 Left 1170793817 20:19529482-19529504 CCATCTCCTCTCCATCTCCACAA 0: 1
1: 0
2: 15
3: 152
4: 1255
Right 1170793825 20:19529513-19529535 CTTGATCAGGCCGCTGCCCATGG 0: 1
1: 0
2: 1
3: 14
4: 92
1170793817_1170793822 -5 Left 1170793817 20:19529482-19529504 CCATCTCCTCTCCATCTCCACAA 0: 1
1: 0
2: 15
3: 152
4: 1255
Right 1170793822 20:19529500-19529522 CACAAGCATGGCCCTTGATCAGG 0: 1
1: 1
2: 1
3: 6
4: 81
1170793817_1170793829 25 Left 1170793817 20:19529482-19529504 CCATCTCCTCTCCATCTCCACAA 0: 1
1: 0
2: 15
3: 152
4: 1255
Right 1170793829 20:19529530-19529552 CCATGGCAAGAGCTCACTGATGG 0: 1
1: 0
2: 1
3: 13
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170793817 Original CRISPR TTGTGGAGATGGAGAGGAGA TGG (reversed) Intronic
900037370 1:427429-427451 TCATGGAGATAGAGAGTAGAAGG + Intergenic
900059000 1:663170-663192 TCATGGAGATAGAGAGTAGAAGG + Intergenic
900779074 1:4605779-4605801 GGGTGGAGATAGAGATGAGAAGG - Intergenic
900800435 1:4733748-4733770 TTGTGGGCAGGGATAGGAGAAGG + Intronic
900887537 1:5425822-5425844 TTGTGTTGATTGGGAGGAGAGGG - Intergenic
901003010 1:6158145-6158167 TTGGGGAGATGGAGAGGCCAGGG - Intronic
901150455 1:7097805-7097827 CTCTGGAGATGGAAAGTAGATGG + Intronic
901256753 1:7835497-7835519 TTTTGGAGATGGAGCGGTTATGG + Intronic
901773031 1:11540429-11540451 ATGAGGAGAGTGAGAGGAGAGGG + Intergenic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902144802 1:14389662-14389684 TCATGGAGATAGAGAGTAGAAGG + Intergenic
902408249 1:16198288-16198310 TTGAGGACATAGAAAGGAGAGGG + Exonic
902654755 1:17859585-17859607 TGGGGGAGGAGGAGAGGAGAGGG + Intergenic
902710996 1:18239694-18239716 TTGACCAGATGGAGGGGAGAAGG - Intronic
902729078 1:18356986-18357008 GAATGGAGATGGAGTGGAGATGG + Intronic
902779670 1:18696709-18696731 TCATGGAGATAGAGAGTAGAAGG + Intronic
903026143 1:20430962-20430984 GAGAGGAGGTGGAGAGGAGACGG - Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903310926 1:22454979-22455001 TTCTGGAGATAGAAAGTAGAGGG - Intronic
903481864 1:23659479-23659501 TTGTAGATATGGGCAGGAGAGGG - Intergenic
903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG + Intronic
903827058 1:26154022-26154044 TGGTGGAGGTGGAGAGGTGGTGG + Intergenic
904316402 1:29668898-29668920 TGGTGGAGAAGGAGAGGTGCTGG + Intergenic
904367393 1:30023121-30023143 TTGTGGAGCTGGGAAGGAGTGGG + Intergenic
904476260 1:30766479-30766501 TGATGGAGAGGGAGGGGAGACGG - Intergenic
904606112 1:31698605-31698627 TTCTGGAGATGGAGCAGGGAGGG + Exonic
904673291 1:32181597-32181619 TTGTGAAGCTGGTGAGGAGAGGG + Intronic
904995311 1:34626923-34626945 TTGTGCAGAGGAGGAGGAGAGGG + Intergenic
905223699 1:36466201-36466223 CTATGGAGATTGGGAGGAGAGGG + Exonic
905288032 1:36898084-36898106 TCATGGAGATAGAGAGTAGAAGG + Intronic
905453830 1:38074082-38074104 TTGAGGAGATGCAGATGAGCCGG - Intergenic
905807139 1:40885080-40885102 TTGTAGAGATGGAGTGGTGGGGG - Intergenic
905878236 1:41447188-41447210 TTCTGGGGAAGGAGAGCAGAAGG - Intergenic
905969881 1:42133689-42133711 TTGTGCATATGGAGAGGAAAGGG + Intergenic
906404261 1:45529058-45529080 TTGTGGAGATGGTGAAGGGGTGG - Intergenic
906426557 1:45718807-45718829 TCATGGAGATAGAGAGTAGAAGG + Intronic
906562738 1:46771133-46771155 AGCTGGAGATGGGGAGGAGATGG - Intronic
906686379 1:47765946-47765968 TGGTGGCGATGGCGGGGAGAAGG + Exonic
906819485 1:48914127-48914149 CTGTGGAGAACGAGAAGAGAAGG + Intronic
906826737 1:48989554-48989576 TCATGGAGATAGAGAGTAGAAGG - Intronic
906974895 1:50559747-50559769 TTGTGAAGAGGGAGGAGAGAAGG - Intronic
907039385 1:51244912-51244934 TTGAGAAGATGGAGATGGGATGG + Intronic
907342063 1:53742248-53742270 TAGTGAGGATGGAGAGGAGGAGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907831426 1:58068054-58068076 AAGTGGAGATGCTGAGGAGAGGG + Intronic
907901565 1:58746303-58746325 TGGTGGACATGGAGAGAAGGGGG - Intergenic
908105926 1:60842272-60842294 TTGTGGAGATGGCGAAGAACTGG - Intergenic
909040570 1:70644765-70644787 GTGGGGAGAAGGAAAGGAGAGGG - Intergenic
909208828 1:72796139-72796161 TCATGGAGATAGAGAGTAGAAGG - Intergenic
909756055 1:79227442-79227464 TAGCGGTGATGGAGAGGAGGTGG - Intergenic
910290169 1:85592841-85592863 TCATGGAGATAGAGAGTAGAAGG + Intergenic
910462511 1:87463641-87463663 TCGTGGAGGGGGAGAGGAAATGG + Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
911001041 1:93165943-93165965 TTATGGAGATAGAGAGTAGAAGG - Intronic
911283587 1:95961302-95961324 TCATGGAGATAGAGAGTAGAAGG - Intergenic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
911723517 1:101217274-101217296 CTGAGGAGATGGAGTGTAGAGGG + Intergenic
911968110 1:104393894-104393916 TTGTGTAGATGGAGAGTAGAAGG + Intergenic
912017407 1:105059356-105059378 TTCTGGAGCTGGGGAAGAGAAGG - Intergenic
912140973 1:106726842-106726864 TCATGGACATGGAGAGTAGAAGG + Intergenic
912439229 1:109686178-109686200 TGGTGGATCTGGAGAGGGGAGGG + Intronic
912582565 1:110734005-110734027 ATGGGGAGGTGGAGAGGAGAAGG + Intergenic
912606530 1:110995594-110995616 TTATGGAGATAGAGAGTAGAAGG - Intergenic
912749818 1:112277493-112277515 TCATGGAGATAGAGAGTAGAAGG + Intergenic
913963666 1:143357527-143357549 AGGGGGAGAAGGAGAGGAGAAGG - Intergenic
914058025 1:144183116-144183138 AGGGGGAGAAGGAGAGGAGAAGG - Intergenic
914121120 1:144783249-144783271 AGGGGGAGAAGGAGAGGAGAAGG + Intergenic
915337796 1:155157232-155157254 TCATGGAGATGGAGAATAGAAGG + Intergenic
915369595 1:155337481-155337503 TAGTGGAGAGGGAGAGGAAAGGG - Exonic
915727103 1:158025714-158025736 CAAAGGAGATGGAGAGGAGAGGG + Intronic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
916004624 1:160648119-160648141 TTGTGGGCATAGAGAGTAGAAGG - Intergenic
916029418 1:160863093-160863115 TTGTGGAGGTGGAGTGGAGAGGG + Intergenic
916146220 1:161742478-161742500 TTATGGAGATAGAGAGTAGAAGG + Intergenic
916334918 1:163660125-163660147 TCATGGAGATAGAGAGTAGAAGG - Intergenic
916401754 1:164457105-164457127 TTATGGAGATAGAGAGTAGAAGG + Intergenic
916911619 1:169354348-169354370 TCATGGAGATAGAGAGTAGAAGG + Intronic
916993160 1:170266503-170266525 TTATGGAGATAGAGAGTAGAAGG - Intergenic
917073179 1:171175012-171175034 GAGGGGAGATGGGGAGGAGAGGG + Intergenic
917225908 1:172782064-172782086 TTATGGAGATAGAGAGTAGAAGG - Intergenic
917231984 1:172847157-172847179 CTGTGAAGAAGGAAAGGAGAGGG + Intergenic
917258117 1:173138410-173138432 TCATGGAGATAGAGAGTAGAAGG + Intergenic
917271179 1:173276348-173276370 TGGTAGAGGTGGAGAGGAGAAGG - Intergenic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917727254 1:177839590-177839612 GTGTCGGGGTGGAGAGGAGAAGG - Intergenic
918333167 1:183479791-183479813 AGGTGGAGATGGGGTGGAGAGGG + Intronic
918445049 1:184609124-184609146 CTCTGGAGAGGGAGAGGTGAGGG - Intronic
918656862 1:187037654-187037676 TTGTGGTAATTGAGAGCAGAAGG - Intergenic
918660156 1:187078328-187078350 TAGTGGTGATGGAGAAGAAAAGG + Intergenic
919148923 1:193669952-193669974 TTGTGGAGATAGACAGTAGAAGG - Intergenic
919272383 1:195364605-195364627 TTGTGGACATAGAGAGTAGAAGG + Intergenic
919316377 1:195975677-195975699 TCATGGAGATAGAGAGTAGAAGG - Intergenic
919549461 1:198966414-198966436 TTGTGGAGAGGGACAGGTGTTGG + Intergenic
919656317 1:200200719-200200741 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
919725237 1:200878169-200878191 TTGTAGCCATGGAGAGGAGATGG + Intergenic
920010371 1:202862591-202862613 AAGTGGGGATGAAGAGGAGATGG - Intergenic
920104428 1:203541316-203541338 TGTTGGGGATGCAGAGGAGAAGG - Intergenic
920493990 1:206441132-206441154 TTATGGAGTTGGAGAAGACAAGG + Intronic
920594222 1:207252286-207252308 TCATGGAGATAGAGAGTAGAAGG - Intergenic
920953064 1:210591234-210591256 TTGTGGAGACAGAGAGTAAAAGG - Intronic
921032070 1:211342684-211342706 TTATGGAGACAGAGAGTAGAAGG - Intronic
921100254 1:211922655-211922677 TGATGGAGATTAAGAGGAGATGG - Intergenic
921271214 1:213471843-213471865 TTATGGAGATGGTGAGGACAGGG + Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922357004 1:224785960-224785982 TTGTGAACCTGGAGAGGAGGAGG + Intergenic
922504453 1:226118535-226118557 GTGTGGAGGAGGGGAGGAGATGG + Intergenic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
923467442 1:234261951-234261973 CTGTGGAGATAGAAAGGTGAAGG - Intronic
923710608 1:236385932-236385954 GTGGGGAGAGGGAAAGGAGAGGG - Intronic
924481449 1:244439074-244439096 TCATGGAGATAGAGAGTAGAAGG - Intronic
924768594 1:247057795-247057817 TTATGGAGATAGAAAGTAGAAGG + Intronic
924811022 1:247402160-247402182 CTGATGAGATGGAGAGGTGAAGG + Intergenic
924888440 1:248246111-248246133 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1063613475 10:7582799-7582821 TTATGGAGATAAAGAGTAGAAGG + Intronic
1063713769 10:8506895-8506917 TCATGGACATGGAGAGTAGAAGG - Intergenic
1063836189 10:10016172-10016194 TCGTGGAGATAGAGAGTAGAAGG - Intergenic
1064146984 10:12833486-12833508 TGGGGGAGAGGGAGAGGTGAGGG - Exonic
1064195971 10:13244367-13244389 TTTTGGGGAGGGAGAGGATAAGG + Intergenic
1064325135 10:14343433-14343455 GAGGGGAGATGGAGAGGAGCTGG - Intronic
1064521099 10:16202133-16202155 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1064563328 10:16614322-16614344 TCATGGAGATAGAGAGGAGAAGG + Intronic
1064833072 10:19493191-19493213 TTATAGAGATGGAGAGGAGAAGG - Intronic
1065197686 10:23282876-23282898 TTACGGAGATAGAGAGAAGACGG + Intronic
1065362904 10:24905929-24905951 TCATGGAGATAGAGAGTAGAAGG - Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065833657 10:29637917-29637939 TTATAGAAATGGAGAAGAGATGG + Intronic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066645158 10:37599486-37599508 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1067267311 10:44757242-44757264 TGGGGGAGATGGAGGTGAGAGGG - Intergenic
1067267386 10:44757473-44757495 TGGGGGAGATGGAGGTGAGAGGG - Intergenic
1067267396 10:44757499-44757521 TGGGGGAGATGGAGGTGAGAGGG - Intergenic
1067392316 10:45875006-45875028 TTGAAGAGATGGTGAGGAAAAGG - Intergenic
1067402616 10:45991424-45991446 TTGAAGAGATGGTGAGGAAAAGG + Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1067878462 10:50024431-50024453 TTGGGTAGATGGAGGGGGGAAGG - Intergenic
1067893260 10:50153497-50153519 TTGGGTAGATGGAGGGGGGAAGG + Intergenic
1068002647 10:51354115-51354137 TCATTGAGATAGAGAGGAGAAGG + Intronic
1068795828 10:61078970-61078992 ATGTGGAGATGGAAATGAGTTGG + Intergenic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069166931 10:65171894-65171916 TAGTGGAGATGGAGAAGAATAGG + Intergenic
1069172294 10:65247426-65247448 ATGTGGAGATGAAGATGAAAGGG - Intergenic
1069773388 10:70913229-70913251 GTGGGGAGAGAGAGAGGAGATGG + Intergenic
1070058794 10:72960929-72960951 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070834583 10:79440295-79440317 TTTAGGAGAAGGAGAGAAGATGG - Intronic
1071845198 10:89514780-89514802 TTGTAGAGATGAAAAGGAGCGGG + Intronic
1072138146 10:92566571-92566593 TCATGGAGATAGAGAGTAGAAGG + Intronic
1072235421 10:93449475-93449497 TTTTGGGGAAGGGGAGGAGAGGG - Intronic
1072310320 10:94148211-94148233 AAGTGGAGATGGAGCGAAGAAGG + Intronic
1072343059 10:94474486-94474508 TTTTGGAGGTGGAGGGGAGCTGG - Intronic
1072763788 10:98080058-98080080 ATGTAGAGATGAATAGGAGAGGG + Intergenic
1072972031 10:100025696-100025718 ATGTGGAGCTGGAAAGGGGATGG + Intergenic
1073139099 10:101236139-101236161 TTCTGGGGATGGCAAGGAGAAGG - Intergenic
1073208729 10:101782082-101782104 TTGAGTAGACGGAAAGGAGAGGG + Intronic
1073215497 10:101833971-101833993 GTGTGGAGATGAGGAGGTGAGGG - Intronic
1073328844 10:102657900-102657922 CTGGGAAGATGGTGAGGAGAAGG - Exonic
1073559318 10:104483248-104483270 TTGTGGAGATGGAGTGTCGCTGG + Intergenic
1074237470 10:111600293-111600315 AAGTGAAGATAGAGAGGAGATGG + Intergenic
1074369577 10:112889115-112889137 TTGTGGAGAAGAATAGAAGAAGG - Intergenic
1074384387 10:113005508-113005530 TTGTCGAGATCAAGGGGAGAGGG - Intronic
1074432155 10:113403480-113403502 TTGTGGAAATGGGGAGGAAGTGG - Intergenic
1074710049 10:116169681-116169703 ATGTGGAGCTGGAAAGGGGATGG - Intronic
1074733793 10:116406659-116406681 TTCTGGAGATGTAGTGGTGATGG - Intergenic
1074955416 10:118383931-118383953 TTCTGGAGAGGCAGAGGAGTAGG + Intergenic
1075006703 10:118835852-118835874 AGGTGGGGAGGGAGAGGAGATGG - Intergenic
1075781524 10:125020491-125020513 TTGTGGAGACAGACAGAAGAGGG + Intronic
1075820381 10:125302958-125302980 TAGTGGAGATGAAGAAGAGGGGG - Intergenic
1075848671 10:125568069-125568091 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
1075993651 10:126859368-126859390 TAGTGGAGATGAAGAGGAAGAGG - Intergenic
1076290706 10:129343457-129343479 GTGTGGAGATAGAGGGGTGAGGG - Intergenic
1076377171 10:129998963-129998985 TTATGGAGATAGAGAGTAGAAGG + Intergenic
1076619778 10:131779781-131779803 TCGTGGAGATGGAGAGGCCTTGG - Intergenic
1076738315 10:132468472-132468494 GGGAGGAGATGGGGAGGAGATGG + Intergenic
1076964096 11:65352-65374 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1077287742 11:1775317-1775339 GAGGGGGGATGGAGAGGAGATGG + Intergenic
1077287760 11:1775373-1775395 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287764 11:1775384-1775406 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287770 11:1775406-1775428 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287774 11:1775417-1775439 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287776 11:1775428-1775450 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287780 11:1775439-1775461 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287803 11:1775506-1775528 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287807 11:1775517-1775539 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287813 11:1775539-1775561 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287831 11:1775595-1775617 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287835 11:1775606-1775628 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287841 11:1775628-1775650 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287845 11:1775639-1775661 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287847 11:1775650-1775672 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287851 11:1775661-1775683 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287862 11:1775695-1775717 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287866 11:1775706-1775728 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287928 11:1775874-1775896 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287932 11:1775885-1775907 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287942 11:1775918-1775940 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287946 11:1775929-1775951 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287969 11:1775996-1776018 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287973 11:1776007-1776029 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077287988 11:1776052-1776074 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077288002 11:1776096-1776118 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077288006 11:1776107-1776129 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077288021 11:1776152-1776174 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077288032 11:1776186-1776208 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077288047 11:1776231-1776253 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077288062 11:1776276-1776298 GAGAGGAGATGGAGAGGGGATGG + Intergenic
1077343763 11:2037281-2037303 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1077971361 11:7194542-7194564 TTGAGGAGAAAGAGAGGAGTGGG + Intergenic
1078008132 11:7547843-7547865 TTGTGGAGGGGGAGAGGGCAGGG - Intronic
1078105461 11:8355522-8355544 TTTTGTAGATGGAGAGGACAGGG - Intergenic
1078282309 11:9915072-9915094 TTGTGAAGATGGAGATGAAATGG + Intronic
1078399275 11:11009988-11010010 GTTTGGAGAGGGAGGGGAGAAGG + Intergenic
1078660648 11:13282863-13282885 TTGTGGAGGAGGAGATGGGATGG + Intronic
1078868953 11:15326312-15326334 TTGGGGAAGTGGAGAGGAGAAGG + Intergenic
1079092014 11:17487480-17487502 TCATGGAGATAGAGAGTAGACGG - Intergenic
1079287944 11:19156735-19156757 TTGTGGAGATGGAGACAGGCAGG - Intronic
1079748326 11:24161430-24161452 TTGTGAAGATGCAGAGAAAAGGG + Intergenic
1079807898 11:24957895-24957917 TTGTGGGGTTGGGGAGGGGAGGG - Intronic
1079892872 11:26079938-26079960 GAGAGGAGAGGGAGAGGAGAGGG + Intergenic
1080049580 11:27845807-27845829 CTGTGGAGATTGAGAGAAAAAGG - Intergenic
1080056939 11:27916280-27916302 TAATGGAGATGGAAAGGAGGGGG + Intergenic
1080097238 11:28423664-28423686 TGATGGAGATAGAGAGTAGAAGG + Intergenic
1080312030 11:30905711-30905733 TTAAGGAGATGGTGAGGAGTTGG - Intronic
1080927682 11:36775089-36775111 TTTGGCAGATGGAGAAGAGAGGG + Intergenic
1081043936 11:38249117-38249139 TGGAGGAAATGGAGAGGAAAAGG + Intergenic
1081525986 11:43928147-43928169 ATGTTGAGCTGGAGGGGAGACGG + Intronic
1081729457 11:45359532-45359554 GTGTTGGGATGGAGAGGTGATGG + Intergenic
1082651576 11:55800343-55800365 TTGGGAAGAGGGAGAGGAGCAGG + Intergenic
1083116445 11:60464249-60464271 TGGGGGAGATGGAGAGGGGGTGG - Intronic
1083533290 11:63445027-63445049 TCATGGAGATAGAGAGCAGAAGG - Intergenic
1083725017 11:64623386-64623408 CCTTGGAGCTGGAGAGGAGAGGG - Intronic
1083732107 11:64658017-64658039 GTGTGCCCATGGAGAGGAGAGGG + Intronic
1083790424 11:64981320-64981342 TAATGGAGATAGAGAGTAGAAGG - Intergenic
1083795912 11:65016588-65016610 TTGCTGAGATGGAGAGGACTGGG + Intronic
1083883663 11:65560298-65560320 TGGTGGAGAGGGAGAGCCGAAGG + Intergenic
1084018638 11:66403346-66403368 ATGTGAAGATAGAGAGAAGAAGG + Intergenic
1084030525 11:66478095-66478117 TTCTGGAGATGAAGAGAAGAAGG + Intergenic
1084624008 11:70294321-70294343 GTTTGGAGATGGCGAGGTGATGG + Intronic
1084951703 11:72670007-72670029 TGGTGGAGCAGGAGAGGAGTGGG - Intronic
1084974647 11:72790135-72790157 TTGGGAAGATGGAGAGGTAAGGG - Intronic
1085068649 11:73521534-73521556 TGGTGGAGATGGAGAGGTAGGGG + Intronic
1085302579 11:75467154-75467176 TTGTGGAGATGGAAAGAGCACGG + Intronic
1085304460 11:75477253-75477275 TGGAGGAGAGGGTGAGGAGATGG - Intronic
1085331354 11:75654446-75654468 TTGAGGAGTTGTAGAGGAAAGGG - Intronic
1085523795 11:77153009-77153031 TTGTGGACAGGGAGAGGATTTGG + Intronic
1086010591 11:82098585-82098607 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1086074866 11:82839777-82839799 TAGTGGAGTGGGAGAGGAGTTGG - Intronic
1086173426 11:83861681-83861703 TCATGGAGATTGAGAGTAGAAGG + Intronic
1086457279 11:86971802-86971824 TTGTGCAGATGGGGTGGGGAGGG + Intergenic
1086583310 11:88424022-88424044 TTGTGGAGATGGGCAGGGCATGG + Intergenic
1087177605 11:95109756-95109778 CAGTGGTGATGGGGAGGAGAAGG - Intronic
1087195824 11:95303357-95303379 TAGTGAGGATGGAGAGGAGAGGG + Intergenic
1087218948 11:95524973-95524995 TTCTTTAGATGGAGAGGACAGGG + Intergenic
1087720333 11:101657457-101657479 TCATGGAGATAGAGAGTAGAAGG - Intronic
1087896261 11:103589981-103590003 ATGAGGAGCTGGAGAGGGGATGG - Intergenic
1088044411 11:105430472-105430494 TTGGGGGGATGGAGAGGATGGGG - Intergenic
1088327653 11:108617272-108617294 TTGTGGGGAGTGAGAGGATAAGG + Intergenic
1088543815 11:110940096-110940118 TTTTGGAGAGTGACAGGAGATGG - Intergenic
1088656442 11:112004427-112004449 TAGTGGGGATGGAAAGGAAAAGG + Intronic
1089408593 11:118219772-118219794 TAGTGGAGTTGGAGAGGCAAGGG - Intronic
1089723830 11:120455177-120455199 CTGAGGACATGGAGAAGAGATGG + Intronic
1089937846 11:122384234-122384256 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1089939966 11:122406011-122406033 TAGGGGAGAGGGACAGGAGAAGG + Intergenic
1089943024 11:122439489-122439511 TTTTGAAGAAGGAGAGGAAAGGG + Intergenic
1090317785 11:125810995-125811017 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1090451435 11:126809849-126809871 TTCTGGAGATTGAGTGGGGAAGG - Intronic
1090531239 11:127593064-127593086 TTGATGAAATGGAGAGGAGGAGG + Intergenic
1091082203 11:132681518-132681540 AAGGGGAGCTGGAGAGGAGATGG - Intronic
1202826749 11_KI270721v1_random:92470-92492 GTGGGGAAGTGGAGAGGAGAAGG - Intergenic
1091595088 12:1872826-1872848 TGGGGTAGAGGGAGAGGAGAAGG + Intronic
1091618237 12:2066304-2066326 TTGGGGAGAGAGAGAGCAGAGGG + Intronic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1091715420 12:2773115-2773137 TCATGTAAATGGAGAGGAGAGGG - Intergenic
1091789092 12:3261029-3261051 TTGTGGTGACAGAGAGGAGGTGG + Intronic
1091925782 12:4347359-4347381 TCATGGAGATAGAGAGTAGAAGG + Intronic
1092202228 12:6592994-6593016 ACTTGTAGATGGAGAGGAGAGGG - Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1093087971 12:14887706-14887728 TTCTGGAGATGGAGTGGGGATGG - Intronic
1093377465 12:18448545-18448567 ATGTGGACAGGGAGAGGAAATGG - Intronic
1093620972 12:21288473-21288495 TCATGGAGATAGAGAGCAGAAGG + Intronic
1093688430 12:22082723-22082745 TTGTGGAGAGAGAGAGGAGATGG - Intronic
1093765188 12:22954229-22954251 TTGTGGGGATGGTTAGGAAAAGG - Intergenic
1094083738 12:26566041-26566063 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083745 12:26566079-26566101 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083781 12:26566249-26566271 GAGAGGAGAGGGAGAGGAGAAGG + Intronic
1094083796 12:26566320-26566342 GAGAGGAGAGGGAGAGGAGAAGG + Intronic
1094123518 12:26998723-26998745 GTGTGGGGATGGATTGGAGAGGG - Intronic
1094128196 12:27045648-27045670 TTTAAGAGAGGGAGAGGAGAAGG + Intronic
1094146404 12:27232968-27232990 TCATGGAGATAGAGAGTAGAGGG - Intergenic
1094405844 12:30115404-30115426 TTGGGGAGAAGGTGTGGAGATGG + Intergenic
1094745605 12:33341227-33341249 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
1095187786 12:39221880-39221902 GAGTGGAGAGGGAAAGGAGAAGG - Intergenic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095668208 12:44827502-44827524 TCATGGAGATAGAGAGTAGAAGG - Intronic
1095919260 12:47513043-47513065 TTGTGGAGGGGGAGGGGAGAGGG + Intergenic
1096040759 12:48514302-48514324 TCATGGAGATAGAGAGTAGAAGG - Intronic
1096675773 12:53225005-53225027 TAAAGGAGATGGAGTGGAGAGGG - Intronic
1096739876 12:53685274-53685296 TAGTGGGGATGGTGAGGAGTAGG + Intergenic
1096758483 12:53819573-53819595 TTGTGGAGATGGTAAAGAAATGG - Intergenic
1096843686 12:54393627-54393649 TGGTGGAGATGAAAAGGAGAAGG - Intergenic
1097021173 12:56021664-56021686 CTGAGGAGATGGAGAGGATGGGG + Intronic
1097153572 12:56996488-56996510 TTGGGGGGATGTAGAGGGGAGGG + Exonic
1097296009 12:57963763-57963785 TTGTGGGGAAGAAGAGGAGGAGG + Intergenic
1097332379 12:58345473-58345495 TTGGAGAGTTGAAGAGGAGAAGG - Intergenic
1097669237 12:62516280-62516302 TGGTGGAGATGGGGAGCAGGGGG + Intronic
1098480944 12:70960361-70960383 TCGTGGTGATAGAGAGGAAAAGG + Intergenic
1098666395 12:73168923-73168945 TTGTGGTGCTGGAGAGGATGTGG + Intergenic
1098981673 12:76962959-76962981 TTGTGGAGGAGGGGTGGAGATGG + Intergenic
1099125338 12:78748608-78748630 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1099242602 12:80155797-80155819 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1099394580 12:82121627-82121649 TTGTGGAGCAGGAGTGGACAGGG - Intergenic
1099459731 12:82907456-82907478 TTTTTGAGATGGAGTTGAGAAGG - Intronic
1099674744 12:85744043-85744065 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1099763688 12:86954395-86954417 TCATGGAGATAGAGAGCAGAAGG - Intergenic
1100177921 12:92051804-92051826 TTCTGGAGATGGGGAAGAGTTGG - Intronic
1100225410 12:92551312-92551334 TTTTTCAGATGGAGAGAAGACGG + Intergenic
1100267149 12:92988432-92988454 TTGTAGAGATGGGAAGGGGAGGG + Intergenic
1100300042 12:93298486-93298508 TCGTGGAGACAGAGAGTAGAAGG + Intergenic
1100346649 12:93738237-93738259 GTGGGGAGCTGGAGAAGAGAAGG + Intronic
1100527241 12:95431356-95431378 TTGTGGAGACAGAGTGAAGAGGG + Intergenic
1100569749 12:95836956-95836978 GGGAGGAGATGGAGAGGAGAGGG + Intergenic
1100648471 12:96558040-96558062 TTGTGGAGGTGGCAGGGAGATGG + Intronic
1100995882 12:100300676-100300698 TCATGGAGATGGAGAGTAGAAGG - Intronic
1101217496 12:102599151-102599173 TTGTTGAGTTGTAGAGGAAAGGG - Intergenic
1101238483 12:102813931-102813953 TTGTGAAGATTGTGAGAAGATGG + Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101575093 12:105990065-105990087 TTATTGAGATGGGGAAGAGAAGG - Intergenic
1101744422 12:107527734-107527756 TTATGGAGAAGGAGAGATGAAGG - Intronic
1102172585 12:110853381-110853403 TGGGGGAGATGGAGAGGAGTGGG - Intronic
1102213062 12:111140971-111140993 TTCTGAAGATTGAGAGGAGATGG + Intronic
1102631901 12:114288418-114288440 TTGGGGAGAGGGAGAGAGGAGGG + Intergenic
1102658133 12:114501068-114501090 TTTTGGAGAAGGACCGGAGAAGG + Intergenic
1102676531 12:114663276-114663298 TGGTGGCAGTGGAGAGGAGAGGG + Intergenic
1102739070 12:115190085-115190107 TTGTGGAGAGGAAGAGGAATGGG - Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1102979597 12:117230922-117230944 TCATGAAGATGGAGAGTAGAAGG + Intronic
1103099298 12:118158597-118158619 TAATGGAGATGGAGAGGAGTGGG - Intronic
1103561659 12:121796051-121796073 TTGTGGTGATGGAGGGGGGCTGG + Intronic
1103608470 12:122106147-122106169 TGGTGGTGATGGAGAAGGGAGGG + Intronic
1103781581 12:123402319-123402341 GAATGGAGATGGAGAGGAGGTGG + Intronic
1103949013 12:124541519-124541541 GAGTGGAGATGGAGAGGGAAGGG + Intronic
1103993656 12:124815354-124815376 TTTTGTAGATGGAGAGACGATGG - Intronic
1104286760 12:127431136-127431158 GTGTGACGATGGGGAGGAGAAGG - Intergenic
1104329714 12:127833537-127833559 TGGTGGACATGGAGAGATGATGG + Intergenic
1104757662 12:131279158-131279180 GTGGGGAGAGGGAGAGGGGAAGG + Intergenic
1105675748 13:22670134-22670156 ATGTGCAGAGGGAGAGGAAAGGG - Intergenic
1105675959 13:22671875-22671897 TTGGGGAGATGGTGAAGAGTTGG + Intergenic
1105892726 13:24693363-24693385 TCATTGAGATGGAGAGGAAAAGG - Intronic
1105972984 13:25447827-25447849 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1106015385 13:25864171-25864193 TTGTGGTGATGGACAATAGATGG + Intronic
1106112980 13:26793098-26793120 TAGGGGAGAAGGACAGGAGAAGG - Intergenic
1106263842 13:28092234-28092256 TTGGGGAGAGGGAGGAGAGAGGG - Intronic
1106265314 13:28104317-28104339 TTTTGGAGAGAGAGAGGAAAGGG - Intergenic
1107389765 13:39951752-39951774 TTGTGGAGATAAAAAGGAAAGGG - Intergenic
1107823384 13:44306194-44306216 TTGAGAAGATGGAGGTGAGAGGG + Intergenic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108106228 13:47013699-47013721 TGAAGGAGATGGGGAGGAGAAGG + Intergenic
1108138488 13:47392274-47392296 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1108165774 13:47691833-47691855 GTGTGAAGATGGAGAAGAGAGGG - Intergenic
1108299786 13:49061732-49061754 GAGAGGAGAGGGAGAGGAGAGGG - Intronic
1108299789 13:49061743-49061765 GAGAGGAGAGGGAGAGGAGAGGG - Intronic
1108483246 13:50897251-50897273 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1108506614 13:51118186-51118208 TTGTGGAGTTAGGAAGGAGAAGG + Intergenic
1108846139 13:54679887-54679909 ATGTGGAGCTGGACAGGGGATGG - Intergenic
1109119589 13:58437654-58437676 TTGGGGAGAGTGGGAGGAGAGGG + Intergenic
1109450829 13:62512480-62512502 GAGTGGACCTGGAGAGGAGAGGG - Intergenic
1109852042 13:68077913-68077935 TTGAGTATATGAAGAGGAGAAGG + Intergenic
1110009012 13:70308063-70308085 TCGTGGACATTGAGAGTAGAAGG + Intergenic
1110581424 13:77133953-77133975 GGGTGGAGATGCAGAGGGGAGGG - Intronic
1110610759 13:77485273-77485295 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1110952762 13:81516498-81516520 TTAGGCAGATGGAGAGGAAAAGG - Intergenic
1111022307 13:82467814-82467836 TTATGGACATAGAGAGTAGAAGG - Intergenic
1111153177 13:84285902-84285924 TGGTTGACATGGAGAGGAAAAGG - Intergenic
1111417536 13:87968496-87968518 TGGTGGAGAAAGAGAGGACAAGG + Intergenic
1111426355 13:88089277-88089299 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111706747 13:91759553-91759575 TCATGGAGATGGAGAGTAGAAGG - Intronic
1112002596 13:95225099-95225121 TGGGGGAGAGGGAGAGAAGAAGG - Intronic
1112199440 13:97260809-97260831 TGGGGAAGGTGGAGAGGAGAAGG - Intronic
1113240916 13:108336056-108336078 GGGTGGAGAGAGAGAGGAGAAGG - Intergenic
1113775497 13:112942863-112942885 ATGTGGGGATGGTGCGGAGAAGG - Intronic
1113789604 13:113021357-113021379 TTCTGGTGATGGGGATGAGAGGG + Intronic
1114339217 14:21725355-21725377 TTGTTGAGAAGGTGAAGAGAAGG + Intergenic
1114747324 14:25163635-25163657 TCCTGGAGATAGAGAGTAGAAGG - Intergenic
1114794081 14:25692667-25692689 TTGTGAAGATGGAGAGCAAGGGG + Intergenic
1114908639 14:27164001-27164023 GAGAGGAGCTGGAGAGGAGATGG - Intergenic
1115042316 14:28946629-28946651 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1115053045 14:29088657-29088679 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1115502430 14:34061153-34061175 TCGTGGAGAGGGAGACGAGGTGG + Intronic
1115678471 14:35709036-35709058 TCATGGAGATAGAGAGTAGAAGG + Intronic
1115949292 14:38701718-38701740 TCATGGAGATAGAGAGCAGAAGG + Intergenic
1116140190 14:40983441-40983463 TCATGGAGATGGAGAATAGATGG - Intergenic
1116754159 14:48925190-48925212 TTGTGATGATGGAAATGAGATGG + Intergenic
1116930100 14:50682216-50682238 TCATGGAGATAGAGAGGAGAAGG - Intergenic
1117125007 14:52613533-52613555 TCATGGAGATAGAGAGTAGAAGG - Intronic
1117161004 14:52989542-52989564 TTATGGAGATAGAGAGTAGAAGG - Intergenic
1117660266 14:57997211-57997233 TTGTTTAGATGGAGAGATGAGGG - Intergenic
1117705514 14:58463216-58463238 GTGAGGAGATGGAGAGGAACAGG - Intronic
1117985038 14:61378834-61378856 TAGAAGGGATGGAGAGGAGAGGG - Intronic
1118130900 14:62962132-62962154 AGATGGAGATGGAGATGAGAAGG + Intronic
1118843068 14:69527159-69527181 TTGAGGAGAGGGAAATGAGAAGG - Intronic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1119687002 14:76640909-76640931 TTATGGAGCAGGAGAGGAGAAGG - Intergenic
1119770506 14:77217899-77217921 TCATGGAGATAGAGAGTAGAAGG + Intronic
1120049353 14:79847234-79847256 GTGTGGAGATGGAGATTGGAAGG - Intronic
1120068743 14:80078285-80078307 TTGTGGAGACAGAGACGAGAAGG - Intergenic
1120668656 14:87337877-87337899 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1120904651 14:89609808-89609830 TTGTGGAGATGAACAGGAGGTGG + Intronic
1121293086 14:92793933-92793955 TAGGGGAGATGGTGAGGAAAGGG + Intergenic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1122426352 14:101608151-101608173 AGGTGGAGGAGGAGAGGAGAAGG - Intergenic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1122625135 14:103081422-103081444 TGGTGGATATGGATAAGAGATGG + Intergenic
1122629156 14:103099438-103099460 TGGTGGAGAGGGAGAGGAGTGGG + Intergenic
1122654991 14:103252416-103252438 TCGTGGAGACAGAGAGTAGAAGG + Intergenic
1122930115 14:104929244-104929266 TAGTGGGGATGCGGAGGAGAGGG + Intronic
1123685525 15:22794593-22794615 CTGTGGAGATGTGGAGGGGAAGG + Intronic
1123992864 15:25696341-25696363 GTGTGGAGATGGATAGGAGAGGG + Intronic
1124828679 15:33126412-33126434 TTCTGGAGGGTGAGAGGAGAAGG + Intronic
1124902479 15:33837237-33837259 ATGGGGAGAGGGAGAGGATAGGG - Intronic
1124964475 15:34423120-34423142 GAGGGGAGAGGGAGAGGAGAGGG - Intronic
1124981094 15:34569346-34569368 GAGGGGAGAGGGAGAGGAGAGGG - Intronic
1125135961 15:36342887-36342909 GTCTGAGGATGGAGAGGAGAAGG + Intergenic
1125150660 15:36528279-36528301 ATGTGGACATGGAAAAGAGAAGG - Intergenic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125351573 15:38772791-38772813 TTGGGGAGTGGGAGTGGAGAGGG + Intergenic
1125382428 15:39101394-39101416 TATTGGAGATGGAAAAGAGAAGG - Intergenic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1125467987 15:39973787-39973809 TTGTGGAAATGGAACAGAGAAGG - Intronic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125705251 15:41729273-41729295 TGATGGAGATGGGGAGGAGGAGG - Exonic
1125973736 15:43933232-43933254 TGGTGGAGGAGAAGAGGAGAAGG + Intronic
1125976135 15:43953383-43953405 TGGTGGAGATGGGTGGGAGAGGG + Intronic
1126132275 15:45353289-45353311 TTGCGGAGATGGGGAGAAGAGGG + Intergenic
1126144709 15:45463922-45463944 TGGTGGTGATGGTGTGGAGATGG - Intergenic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126669596 15:51104215-51104237 CCGTGGAGATGGAAAGGAAAGGG - Intronic
1126848066 15:52779933-52779955 ATGTGGAGCTGGGGAGGAAAAGG + Intronic
1127002791 15:54529720-54529742 GTGTGGAGGAGGAGAGGAGTGGG + Intronic
1127038089 15:54941932-54941954 TGGTAGAGGTGGAGAGAAGAGGG - Intergenic
1127390471 15:58501147-58501169 TTGTAGAGACGCAGAGGAAAGGG - Intronic
1127406324 15:58651437-58651459 TCATGGAGATAGAGAGTAGAAGG - Intronic
1127492703 15:59480047-59480069 TGGTGGAGATGGGGAGAAGATGG + Intronic
1127613189 15:60657241-60657263 ATGGGGAGAGGGAGAGGAGGAGG - Intronic
1127815688 15:62606981-62607003 TGGTGGTGATGGTGAGGAGGAGG - Intronic
1127932992 15:63609722-63609744 ATGAGGACAGGGAGAGGAGAGGG - Intronic
1128254117 15:66184686-66184708 GGGTGGAGAGTGAGAGGAGAGGG - Intronic
1128665506 15:69535101-69535123 TTGTGGGGAGGGGGATGAGATGG + Intergenic
1128681830 15:69658009-69658031 TAATGGAGAGGGAGAAGAGATGG - Intergenic
1128731563 15:70024942-70024964 TTGTGGCGAGGGAGTGGTGATGG - Intergenic
1128839400 15:70837485-70837507 TTGAGGGGATGGAGTAGAGAAGG - Intronic
1128843888 15:70872405-70872427 TAGGGGAGAGGGAGAGGAGGAGG + Intronic
1129135770 15:73549326-73549348 TCGTGGAGATAAAGAGTAGAAGG + Intronic
1129545951 15:76395030-76395052 TCATGGAGATGGAGAGTAGAAGG - Intronic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1130440596 15:83949187-83949209 TCATGGAGATAGAGAGTAGAAGG - Intronic
1130606342 15:85320630-85320652 TCTTGGAGATAGAGAGTAGAAGG + Intergenic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1130985439 15:88841917-88841939 GTGGGGAGATGGGGAGGGGAAGG - Intronic
1131263071 15:90899414-90899436 GTGTGAAGATGGAGGGGAAAAGG + Intergenic
1131314662 15:91323968-91323990 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1131354419 15:91732285-91732307 TTGTGGAGATGGAGGGTTTAGGG + Intergenic
1131673632 15:94648681-94648703 CTGTGTTGATGGAGAGGTGAAGG - Intergenic
1131950019 15:97672037-97672059 TTGTGGACATAGAGAGTAGAAGG - Intergenic
1132026980 15:98412093-98412115 TTGCGGAGTAGGAGAGGATATGG + Intergenic
1132237372 15:100232327-100232349 TTGAGGGGAAGGAGAGGAGTTGG - Intronic
1132444455 15:101899831-101899853 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1133172927 16:3992864-3992886 TTTGGCAGATGGAGAGCAGATGG + Intronic
1133256316 16:4518545-4518567 ATGTGGATATGGAGGGGTGAGGG - Intronic
1133334678 16:4999434-4999456 TTGTGGAGATGTGGTGGAGGGGG - Intronic
1133721556 16:8499002-8499024 TTGTGGAGTTGGAGTTGAGATGG - Intergenic
1134784647 16:16930646-16930668 TTGAGGAGAGAGAGAAGAGAAGG + Intergenic
1134793388 16:17011751-17011773 TTATGGAGATAGAGAGTAGAAGG - Intergenic
1135162298 16:20107778-20107800 TTGTGTAGGTGTGGAGGAGAAGG - Intergenic
1135299835 16:21316433-21316455 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1135481892 16:22827494-22827516 TGGTGGAGAGAGAAAGGAGAGGG + Intronic
1135604741 16:23813841-23813863 TCGTGGAGATCAAGAGTAGAAGG + Intergenic
1135678393 16:24436695-24436717 ATGGGGAGTTGGAAAGGAGATGG - Intergenic
1136068730 16:27775657-27775679 TGGTGGAGAGGAAGGGGAGAGGG + Intronic
1136344684 16:29667040-29667062 TCGTGCAGTGGGAGAGGAGACGG + Exonic
1136351121 16:29708794-29708816 TTAGGCAGATGGAGAGGAAAAGG + Intergenic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136532729 16:30880580-30880602 CTGGGGAGTTGGAGATGAGAAGG + Intronic
1136566215 16:31072386-31072408 TTGTGGAGTTGGAAAGGTGGAGG - Intronic
1136617939 16:31410197-31410219 GGGTGGAGAGTGAGAGGAGAGGG + Intronic
1136624727 16:31455271-31455293 TTATGCAATTGGAGAGGAGAGGG + Intergenic
1137270550 16:46899972-46899994 TTGTGCAGATGAAGAGAAGCTGG + Intronic
1137364936 16:47852485-47852507 TTGGGGGGGTGGAGAGGACAGGG - Intergenic
1137564589 16:49525099-49525121 GTGTGCAGAGGGCGAGGAGAGGG + Intronic
1137712547 16:50576329-50576351 ATCTGGAGGAGGAGAGGAGAGGG - Intronic
1137847720 16:51708470-51708492 TAGTGGAGCTGGAGAAAAGATGG + Intergenic
1138311332 16:56026015-56026037 TTGTGTGGATGGAGAGGACTGGG - Intergenic
1138347859 16:56331067-56331089 TTGTTGTGCTGGAAAGGAGAGGG + Intronic
1138436270 16:57001930-57001952 TCATGGAGATAGAGAGTAGAAGG - Intronic
1138454682 16:57114470-57114492 TTGGGGGGATGGGCAGGAGACGG - Intronic
1139099158 16:63744493-63744515 GTGTGGGGAAGGAGAGGTGATGG - Intergenic
1139422298 16:66856168-66856190 TTGAGGAGATGGTGAGGAGAGGG + Intronic
1139944427 16:70630036-70630058 TCATGGAGATAGAGAGTAGAAGG - Intronic
1140104162 16:71944013-71944035 TTTTGGGTATGGAGAGGAAATGG - Exonic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1140544678 16:75795664-75795686 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1140624233 16:76772236-76772258 TTAGGGACATAGAGAGGAGAAGG - Intergenic
1140857532 16:78991100-78991122 TTGTGGAGAAGGAAAAGTGAAGG + Intronic
1140941238 16:79723305-79723327 TGGTGGTGATGGTGAGGATAGGG + Intergenic
1140997990 16:80279635-80279657 TTGTAAAGATGGAGAAGACAGGG + Intergenic
1141019621 16:80482996-80483018 TTGGGGAGCTGCAGAGGGGATGG + Intergenic
1141267328 16:82508861-82508883 TTATGGAGAAGGGGAAGAGATGG + Intergenic
1141651662 16:85396191-85396213 TTGGGGAACTGGGGAGGAGACGG - Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1141909009 16:87045793-87045815 CTGGGGAGATGGGTAGGAGATGG - Intergenic
1142064807 16:88055620-88055642 TTTTGGAGAGAGCGAGGAGAAGG + Intronic
1142609438 17:1100541-1100563 TTTTGGAGTTGGAGAGGAAAGGG - Intronic
1142918704 17:3165111-3165133 TTCTGGGGAGAGAGAGGAGATGG + Intergenic
1142969328 17:3600854-3600876 TGGTGGAGCTGGAGAAGATAAGG - Intergenic
1142993220 17:3745866-3745888 ATGTGGGGAAGCAGAGGAGACGG - Exonic
1143352167 17:6296999-6297021 TAGTAGAGATGGGGAGGAGGTGG - Intergenic
1143411841 17:6713811-6713833 GTAAGGAGATGGAAAGGAGAGGG - Intergenic
1143420343 17:6786307-6786329 TCATGGAGATAGAGAGTAGAAGG + Intronic
1143668056 17:8376016-8376038 TTGTTGAGATGAAGGAGAGATGG - Exonic
1143944681 17:10580202-10580224 TTGATGAGATGTAGAGGATATGG + Intergenic
1144162061 17:12569406-12569428 ATGCGGATAGGGAGAGGAGATGG + Intergenic
1144227554 17:13164886-13164908 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144979349 17:19158948-19158970 ATGTGGAAGTGCAGAGGAGAAGG - Exonic
1144988873 17:19219284-19219306 ATGTGGAAGTGCAGAGGAGAAGG + Exonic
1145084511 17:19925450-19925472 TTGTGGAGGTGGGGAGTAGGAGG - Intronic
1145123307 17:20279842-20279864 GTTGGGATATGGAGAGGAGAAGG + Intronic
1145742274 17:27285325-27285347 TTGGGGGTAAGGAGAGGAGAGGG + Intergenic
1145994350 17:29096961-29096983 AGGTGGAGAAGGTGAGGAGAGGG + Intronic
1146076008 17:29729898-29729920 TTGTGGAGAGGAAGTGGGGATGG + Intronic
1146177484 17:30675384-30675406 TTTTGGAGTTGGAGTGGACAGGG + Intergenic
1146570331 17:33946907-33946929 TTGGGGTGAAGGGGAGGAGATGG + Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146733577 17:35216904-35216926 TAGTGGAGATGGAGAAGGGCAGG + Intergenic
1146824667 17:36012199-36012221 ATGTGGAGCTGGAAAGGGGATGG - Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147699884 17:42387369-42387391 TTGGGTAAATGCAGAGGAGAGGG - Intronic
1147748091 17:42708269-42708291 TTGTGGGGAGGGTGTGGAGATGG + Intronic
1148065761 17:44868571-44868593 TGGTGGAGATGGAGAGGCTTGGG - Intronic
1148193686 17:45698205-45698227 TTGGGGAGATGGAGATGGGGAGG + Intergenic
1148242067 17:46006390-46006412 TCATGGAGATAGAGAGTAGAAGG + Intronic
1148246325 17:46033124-46033146 GTGAGGAGATGGAGAGGGCACGG - Exonic
1148393424 17:47289966-47289988 TTGTGGTGGTGGAGGGGAGGTGG + Intronic
1148690025 17:49521741-49521763 TTGTGGGGCTGGAAAGGAGCTGG + Intergenic
1149092447 17:52800408-52800430 TTATGGAGATTGAGAATAGAAGG - Intergenic
1149142841 17:53455242-53455264 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1149598222 17:57876360-57876382 ATGTGGAGAAGCAGAGGACAGGG - Intronic
1149830783 17:59869967-59869989 TTTTGGAGCTGGAGAGCAAATGG + Intronic
1149902877 17:60497308-60497330 TCATGGATATAGAGAGGAGAAGG + Intronic
1149950996 17:60985700-60985722 TCATGGAGATAGAGAGTAGAAGG - Intronic
1150120728 17:62599540-62599562 TTGCGGGGAGGGAGAGGAGGTGG - Intronic
1150156326 17:62856643-62856665 TTGTAGAGCTGGAAAAGAGAGGG + Intergenic
1150398048 17:64836573-64836595 TTGGGGAGCTGGACAGGGGATGG + Intergenic
1150478569 17:65492122-65492144 ATTTGGAGAGGAAGAGGAGAGGG + Intergenic
1150628610 17:66859846-66859868 GGGTGGAGAGGGAGAGAAGAGGG - Intronic
1150829261 17:68504648-68504670 TGATGGAGATAGAGAGCAGAAGG + Intergenic
1150935928 17:69635694-69635716 CTGTGGAGATGGACAGAAAAGGG + Intergenic
1151190176 17:72392628-72392650 TTGGGGAGATGGAGAGGGAAAGG - Intergenic
1151251781 17:72841509-72841531 TCATGGAGATAGAGAGGAGAAGG + Intronic
1151683479 17:75633860-75633882 TCGGGGAGAGGGAGAGGAGGAGG + Intronic
1203167796 17_GL000205v2_random:114059-114081 TTGGGTAGATGAAGATGAGACGG - Intergenic
1153129342 18:1836767-1836789 TTGCGGAGATAGGGAGTAGAAGG + Intergenic
1153248059 18:3093034-3093056 TTTTGAAAGTGGAGAGGAGACGG + Intronic
1153266469 18:3275276-3275298 TCATGGAGATGGAAAGTAGAAGG + Intronic
1153504172 18:5779110-5779132 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1153899569 18:9604746-9604768 TGTTGGGGAGGGAGAGGAGAAGG - Intronic
1153961034 18:10140435-10140457 TAGTGCAGGTGGAGAGGATACGG + Intergenic
1153992509 18:10412939-10412961 TTGGTGAGATAGAGAAGAGATGG - Intergenic
1154183765 18:12161707-12161729 TTGTGGAGATAGAGAGTAGAAGG - Intergenic
1154327271 18:13400552-13400574 ACGTGGTGATGGGGAGGAGACGG + Intronic
1155045632 18:22100666-22100688 GTGTGGAGATGGACACCAGAGGG + Intergenic
1155104016 18:22642639-22642661 TGGAGGAGATGGGGAGAAGATGG + Intergenic
1155282858 18:24258433-24258455 ACATGGAGATAGAGAGGAGAAGG + Intronic
1155309208 18:24507887-24507909 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1155325305 18:24658504-24658526 TGGGGGAGATGGAGAGGAGGAGG + Intergenic
1155493931 18:26424703-26424725 ATTTGGAGAAGGAGAGGACATGG - Intergenic
1156006820 18:32452060-32452082 TTCTTGAGAAGGAGAAGAGATGG + Intronic
1156124404 18:33886130-33886152 TTATGGACATAGAGAGTAGAAGG + Intronic
1156558953 18:38099642-38099664 ATGTGGAGAGGAAGAGGAAAAGG + Intergenic
1156635504 18:39023597-39023619 TTGCACAGATGGAGAGGAGAAGG + Intergenic
1156674367 18:39509851-39509873 TTGTGAAGAGGAAGAAGAGAGGG - Intergenic
1156911901 18:42420883-42420905 TTATGCAGATAGAGAGTAGAAGG - Intergenic
1156993364 18:43437300-43437322 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1157680130 18:49598559-49598581 AAGAGGAGAAGGAGAGGAGAAGG - Exonic
1157987332 18:52453098-52453120 TTTTGGTGATAGAGAGGAGGTGG - Intronic
1158163440 18:54512157-54512179 TCATGGACATGGAGAGTAGAAGG + Intergenic
1158251093 18:55488441-55488463 ATTAGGAGATGGAGAAGAGAGGG + Intronic
1158561355 18:58516472-58516494 TTGTGGAGAGGGAGAGGGGTGGG - Intronic
1158938015 18:62383048-62383070 GTGTGGAGAGGGGGTGGAGAAGG + Intronic
1158948479 18:62468681-62468703 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1159018331 18:63121406-63121428 TTCTGGGGATGGAGGAGAGAGGG - Intergenic
1159081027 18:63736355-63736377 TTATGGAGATAGAGAATAGAAGG + Intergenic
1159108176 18:64027124-64027146 TAGTGGAGATGGAGGGGCGGGGG + Intergenic
1159270789 18:66147580-66147602 TTATGGAGATAGAGAGTGGAAGG - Intergenic
1159612161 18:70538137-70538159 ATGTGGTGGTGCAGAGGAGATGG + Intergenic
1160133006 18:76246414-76246436 CATTGGAGATGGACAGGAGAAGG - Intergenic
1160327714 18:77966379-77966401 GGGTGGAAAGGGAGAGGAGAGGG + Intergenic
1160504838 18:79421244-79421266 CTGTGCAGAGGGAGAGGAGCTGG - Intronic
1160612825 18:80101769-80101791 TTGAGGTGATGGTGAGAAGATGG + Intergenic
1160640899 19:134984-135006 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1160783591 19:889548-889570 TGCTGGTGATGGAGAGGAGAGGG + Intronic
1161590884 19:5128683-5128705 GCGTGGAGATGCAGAGGGGAGGG - Intronic
1161966254 19:7550824-7550846 CTGGGGAGAGGGAGAGGACAGGG - Intronic
1162223645 19:9201157-9201179 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1162335220 19:10055968-10055990 ATGTGGGGATGAAGAAGAGATGG - Intergenic
1162698284 19:12494579-12494601 TCATGGAGATAGAGAGTAGAAGG + Intronic
1162981006 19:14239860-14239882 TTTTGGAGTTGGAGTGGACAGGG - Intergenic
1163013570 19:14440415-14440437 TTGGGAACAAGGAGAGGAGATGG + Intronic
1163107314 19:15132395-15132417 TCTTGGAGATAGAGAGTAGAAGG - Intergenic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163185647 19:15637436-15637458 TCATGGAGATAGAGAGTAGAAGG - Intronic
1163255953 19:16155968-16155990 TGGTGGAGATGGAAAGAAGGAGG + Intronic
1163336032 19:16672270-16672292 TGGTGGGGATAGCGAGGAGAGGG + Intronic
1163671963 19:18634724-18634746 TTAGGAAGAGGGAGAGGAGAGGG - Intergenic
1163889315 19:19996920-19996942 ATGTGGAGAAGGAGAGCACAGGG - Intergenic
1164025692 19:21350120-21350142 TTGAGGAGAAGGATGGGAGAGGG - Intergenic
1164302441 19:23973612-23973634 TGGAGGAGAGGAAGAGGAGATGG + Intergenic
1164389203 19:27803603-27803625 TTGTGAAGATGTGGAAGAGAAGG - Intergenic
1164485502 19:28652527-28652549 TTGAGAAGATGGGAAGGAGAAGG - Intergenic
1164633381 19:29776036-29776058 TTTTGCAGATGGAAAGGAGAAGG + Intergenic
1165990352 19:39808295-39808317 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1166213189 19:41320320-41320342 GTCTGCAGAGGGAGAGGAGAGGG - Exonic
1166301569 19:41914396-41914418 AGGAGGAGATGGAGACGAGAGGG - Intronic
1166302804 19:41921879-41921901 TGGTGGAGATGAGGAGGAGGAGG - Intronic
1166411444 19:42558077-42558099 TTAGGGAGATAGAGAGGAAAGGG + Intronic
1167284512 19:48591584-48591606 GTGTGCGGATGGTGAGGAGAGGG - Intronic
1167612305 19:50513417-50513439 CTGGGGAGAGGGAAAGGAGAGGG + Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168098259 19:54127754-54127776 ATGGGGAGAGGGAAAGGAGAAGG - Intronic
1168318000 19:55492434-55492456 TTGAGGCTCTGGAGAGGAGAGGG + Intronic
1202697509 1_KI270712v1_random:135784-135806 AGGGGGAGAAGGAGAGGAGAAGG - Intergenic
925085281 2:1102778-1102800 TGCTGTAGGTGGAGAGGAGAAGG + Intronic
925384983 2:3455531-3455553 TCATGGAGATGGAGAGCAGGAGG - Intronic
925706324 2:6687083-6687105 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
925811701 2:7707787-7707809 TTGAGGAGAAGGAGAGTAGAGGG - Intergenic
927232672 2:20840243-20840265 TTATGGAGATAGAGAGTAAAAGG + Intergenic
927387346 2:22550221-22550243 TTGTGGAAAGGAAAAGGAGAGGG + Intergenic
927394182 2:22630671-22630693 TGGTGAACAAGGAGAGGAGAGGG - Intergenic
927432004 2:23034717-23034739 TTGTGGAGGTGCTGAGGGGAGGG - Intergenic
927466138 2:23338101-23338123 GTGTGGAGAGGGAGAGTGGATGG + Intergenic
928001897 2:27530718-27530740 TTATGGAGATAGAGAATAGAAGG + Intergenic
928932972 2:36644662-36644684 TTATGGAGATGGAGAATAGAAGG + Intronic
929324307 2:40588874-40588896 TCGTGGAGATAGAGAGTAGAAGG + Intronic
929388173 2:41436171-41436193 TTATGGATATAGAGAGTAGAAGG - Intergenic
929418780 2:41769878-41769900 TGCAGGAGAAGGAGAGGAGATGG - Intergenic
929467483 2:42158372-42158394 TCATGGAGATAGAGAGTAGAAGG + Intergenic
929973280 2:46604669-46604691 TCATGGAGATAGAGAGTAGAAGG + Intronic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930229824 2:48832112-48832134 TCATGGAGATAGAGAGTAGAAGG - Intergenic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930970494 2:57389390-57389412 TTGTGGACATAGAAAGTAGAAGG + Intergenic
930985664 2:57584768-57584790 TAGTGGGGATGGCGAGGAGGTGG - Intergenic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931572890 2:63688456-63688478 TCATGGAGATAGAGAGTAGAAGG + Intronic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
931811073 2:65855713-65855735 TGGGGGAGATGTAGAGGAAAGGG + Intergenic
931854620 2:66288965-66288987 TTGGGGGGATTGAGGGGAGATGG - Intergenic
932297798 2:70641571-70641593 TTATGGCAATGGAGGGGAGAAGG - Intronic
932360771 2:71103826-71103848 GAGGGGAGCTGGAGAGGAGATGG - Intergenic
932433303 2:71688064-71688086 TTCTGGAGAAGGAGAGGAGGGGG + Intergenic
932715104 2:74094989-74095011 GAGTGCAGATGGAGAAGAGAGGG + Intronic
933021778 2:77203329-77203351 TCCTGGAGATGGACAGGGGATGG + Intronic
933348640 2:81124460-81124482 TCATGAAGATGGAGAGTAGAAGG - Intergenic
933529168 2:83484311-83484333 TTGTGGAAGTACAGAGGAGAGGG - Intergenic
933601549 2:84337190-84337212 TCATGGAGATGGAGAATAGAAGG + Intergenic
933627432 2:84617578-84617600 TCATGGAGATAGAGAGGAGAAGG - Intronic
933945411 2:87281985-87282007 GTGTGGAGTTGGAGATGAGGAGG + Intergenic
934097518 2:88620267-88620289 GTGTGGAGCTGGGAAGGAGAGGG - Intronic
934278682 2:91592808-91592830 AGGGGGAGAAGGAGAGGAGAAGG - Intergenic
934539821 2:95164672-95164694 TTATGGAGATGGAGAGTAGAAGG + Intronic
934851460 2:97704344-97704366 TCATGGAGATAGAGAGTAGAAGG - Intergenic
934854227 2:97718918-97718940 TGGAGAAGATGGAGGGGAGAGGG + Intronic
935152331 2:100449320-100449342 TGGTGGAGATGGGAAGGTGAAGG - Intergenic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935442542 2:103118390-103118412 TCATGGAGATAGAGAGCAGAAGG + Intergenic
935445284 2:103149795-103149817 TTGTTGAAATGGTGAGGTGAGGG - Intergenic
935585404 2:104796320-104796342 TTGTGGAGATGGAAAGGAACTGG + Intergenic
935984708 2:108661484-108661506 TTGTGAAGATGGACAGGAGCAGG + Intronic
936137142 2:109905135-109905157 TTGTGAAGATGGACAGGAGCAGG + Intergenic
936207555 2:110466350-110466372 TTGTGAAGATGGACAGGAGCAGG - Intronic
936334799 2:111579605-111579627 GTGTGGAGTTGGAGATGAGGAGG - Intergenic
936474201 2:112825272-112825294 CTGTGTACCTGGAGAGGAGAAGG - Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936903019 2:117505365-117505387 AGGAGGAGATGGGGAGGAGAAGG - Intergenic
936911902 2:117602240-117602262 TGGGGGAGATGGAGAGAAGCAGG - Intergenic
936989633 2:118348864-118348886 TGGTGGGGATGGAAAGGAAAGGG + Intergenic
937116610 2:119409603-119409625 TCTTGGAGATGAAGAGTAGAAGG - Intergenic
937153401 2:119701437-119701459 TTGAGGGGATTGAGAGCAGAGGG + Intergenic
937262986 2:120598223-120598245 TTGTGGAGAAGCAGTGCAGAGGG - Intergenic
937628714 2:124074150-124074172 TTATGGATATAGAGAGTAGAAGG + Intronic
937954916 2:127416767-127416789 GGGTGGAGGTGGAGAGGAGGTGG - Intergenic
938112511 2:128578505-128578527 ATGAGGTGATGGAGAGGGGATGG - Intergenic
938391886 2:130913197-130913219 TTGTGGAGTTGGAGGGAAGCAGG + Intronic
938821509 2:134964878-134964900 TTCAGGAGCTGGAGAGCAGAAGG + Exonic
938822128 2:134969364-134969386 GTGGGGAGAGGGAGACGAGAGGG + Intronic
939167141 2:138652145-138652167 TAGTGGAGAGGGAGAGGTGTGGG + Intergenic
939853665 2:147330924-147330946 ATGTGAAGATGAAGAGGGGAGGG + Intergenic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
940314456 2:152312794-152312816 TCATGGAGATAGAGAGCAGAAGG - Intergenic
940559346 2:155274735-155274757 TCATGGAGATAGAGAGTAGAAGG - Intergenic
940901403 2:159129704-159129726 TAGTGGAGATTGTGAGGGGAGGG + Intronic
941042370 2:160636861-160636883 TCATGGAGATAGAGAGTAGAAGG - Intergenic
941679148 2:168377972-168377994 TCCTGGAGATAGAGAGTAGAAGG + Intergenic
941939660 2:171020828-171020850 TTGGGGAGAAGGGTAGGAGAAGG + Intronic
941987860 2:171525672-171525694 ATTTGGAGATGAAGAAGAGAAGG + Intronic
942392940 2:175515039-175515061 TTATGAGGATGGAGAGAAGAGGG + Intergenic
942413261 2:175733572-175733594 GTGTGGAGGTGGTGAGGTGATGG + Intergenic
942529670 2:176895951-176895973 TCATGGAGATGGAGAATAGAAGG - Intergenic
943060345 2:183037389-183037411 TTTTGAAGGTGGAGAGGAGGGGG - Intronic
943151285 2:184116499-184116521 TTGGAGAGGTGGAGAGGTGATGG + Intergenic
943207730 2:184921805-184921827 TCACGGAGATGGAGAGTAGAAGG - Intronic
943374995 2:187065742-187065764 TCGTAAAGATGGAGAAGAGAAGG - Intergenic
943530148 2:189069157-189069179 TTGTGGAGGTTCAGAGGAGAGGG - Intronic
943749191 2:191494081-191494103 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
944291312 2:198008836-198008858 TGGTGAAGATGTAGAGAAGATGG - Intronic
944361257 2:198860076-198860098 TCATGGAGATAGAGAGTAGACGG + Intergenic
944463450 2:199976469-199976491 TCATGGAGATAGAGAGTAGAAGG - Intronic
944585287 2:201166950-201166972 GTGGGGAGAGGGAGAAGAGAGGG + Exonic
945179517 2:207077471-207077493 AGGTGCAGGTGGAGAGGAGATGG + Exonic
945566011 2:211400586-211400608 TTATGGAGATAGAGAGTAGAAGG + Intronic
945713914 2:213334765-213334787 TAATGGAGATAGAGAGTAGAAGG + Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
945838838 2:214864776-214864798 TCATGGAGATAGAGAGTAGAAGG + Intergenic
945972998 2:216248376-216248398 TCATGGAGATAGAGAGTAGAAGG - Intergenic
946530393 2:220564186-220564208 AAGTGGAGACGGAGACGAGAAGG - Intergenic
946714804 2:222542079-222542101 TTGGGGAGATGCACAGTAGAAGG - Intronic
946988000 2:225295518-225295540 TAGTGGGCATGGAGAAGAGATGG - Intergenic
946994982 2:225381213-225381235 TCATGGAGATAGAGAGTAGAAGG - Intergenic
947283155 2:228479078-228479100 TGCTGGTGATGGAAAGGAGATGG - Intergenic
947283162 2:228479127-228479149 TGCTGGTGATGGAAAGGAGATGG - Intergenic
947283188 2:228479352-228479374 TGCTGGTGATGGAAAGGAGATGG - Intergenic
947289549 2:228557207-228557229 TGGTGGAAATGGAAAGAAGAGGG - Intergenic
947584926 2:231349383-231349405 TCATGGAGATAGAGAGTAGAAGG + Intronic
947686591 2:232091334-232091356 TCATGGAGATAGAGAGTAGAAGG - Intronic
948083189 2:235224488-235224510 TTCTGTGGATGGAGACGAGACGG + Intergenic
948334737 2:237199133-237199155 TTTTGGAGAGGGAAAGCAGATGG + Intergenic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
948745007 2:240084088-240084110 TTGTGGAAATGCAGAGAACATGG + Intergenic
948853675 2:240720246-240720268 TTGTGGAGATGAAGAGATGCTGG - Intronic
1169268041 20:4179367-4179389 TTGTGGATATGGAGTGGATATGG + Intronic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169794968 20:9452085-9452107 TTTAGGAGAAGGAGTGGAGAAGG - Intronic
1170236554 20:14112172-14112194 TCATGGAGATAGAGAGTAGAAGG + Intronic
1170335581 20:15267168-15267190 GAGTGGGGATGCAGAGGAGAGGG - Intronic
1170593206 20:17786837-17786859 TAGAGGAGAAGGGGAGGAGAGGG - Intergenic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1170818082 20:19731950-19731972 TCATGGAGATGGAGAGTAGAAGG - Intergenic
1170996799 20:21369093-21369115 TCGTGGAGACAGAGAGTAGAAGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171024924 20:21621568-21621590 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1171250420 20:23642035-23642057 TTGGGGAGAGAGAGGGGAGAAGG - Intergenic
1171273055 20:23831443-23831465 TTGAGGAGAGGGAGAAAAGAAGG - Intergenic
1172261287 20:33568043-33568065 TTGGACAGATGGAGAGAAGACGG + Intronic
1172557624 20:35856137-35856159 TTACGGAGATAGAGAGTAGAGGG - Intronic
1172841303 20:37904058-37904080 GTGTGGAGAGGAAGAGGACAAGG - Intronic
1173038498 20:39436070-39436092 TCGTGGGCATGGAGAGTAGAAGG - Intergenic
1173614550 20:44394324-44394346 ATGGGGAGATGGAGATCAGAGGG - Intronic
1173648060 20:44646022-44646044 CTGGGGAGGTGGAGAGGAGCAGG - Intronic
1173854724 20:46242676-46242698 TTGGGGCGAGGGAGAGGAGAGGG + Intronic
1173856704 20:46254928-46254950 TTGGGGTGTTGGGGAGGAGAAGG + Intronic
1174050630 20:47765027-47765049 ATTTGGAGGTGGAGAGAAGATGG - Intronic
1174070791 20:47897682-47897704 TTGTGGACCTGGGGAGGAGCCGG + Intergenic
1174209153 20:48863442-48863464 TTGTGGAGAAGGAGCGGGGAGGG - Intergenic
1174469156 20:50743009-50743031 TTCGGGAGATGGGGAAGAGAAGG + Intronic
1175062294 20:56254637-56254659 ATGAGGGGAAGGAGAGGAGAAGG + Intergenic
1175216355 20:57393367-57393389 CCGTGGAGATGAAGTGGAGAGGG + Intronic
1175452058 20:59077748-59077770 TGTTGGAGAGGGAGAGGAGGAGG + Intergenic
1175774995 20:61647579-61647601 TTGTGAGGAGAGAGAGGAGAGGG - Intronic
1176403961 21:6345077-6345099 TTGGGTAGATGAAGATGAGACGG + Intergenic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176433196 21:6644027-6644049 TTGGGTAGATGAAGATGAGACGG - Intergenic
1176685925 21:9848484-9848506 TTGCTGAGATGTAGAGGAGTGGG - Intergenic
1177211260 21:18074823-18074845 TTGTGGAGACTGAGAAGAAAAGG + Intronic
1177605055 21:23367250-23367272 ATGGGGAGCTGGAGAGGAGATGG + Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1177867860 21:26534533-26534555 GACTGGAGATGGAGAGGAAAGGG + Intronic
1178500053 21:33118255-33118277 TGTTGGAGATGGACAGGGGAGGG + Intergenic
1178748300 21:35274976-35274998 TGGTTGAGAGGGAGAGCAGAAGG - Intronic
1178779081 21:35582355-35582377 TTGTGGAGATGCAGAGTTGCTGG - Intronic
1178808154 21:35856700-35856722 TCATGGAGATGGGGAGTAGAAGG + Intronic
1178808449 21:35859282-35859304 TCATGAAGATGGAGAGTAGAAGG + Intronic
1178859358 21:36276047-36276069 TGGTGGAGCTGGAGCGGAGTCGG + Intronic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1179761439 21:43532329-43532351 TGGTGGAGGAGGAGAGGAGGGGG - Intronic
1179992810 21:44957453-44957475 TGGTGGAGATGAAGAGGAGGAGG - Intronic
1180077690 21:45471472-45471494 TTGTGGAGAGGCTGAGGAGGAGG - Intronic
1180994460 22:19958701-19958723 TGGTAGAGATGGAGTGGAGGTGG - Intronic
1181680148 22:24489779-24489801 TCATGCAGATGGAGAGTAGAAGG + Intergenic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1182578840 22:31291634-31291656 AGGAGGAGATGGAGAGGAGGAGG + Intronic
1183030064 22:35097109-35097131 TTGTGTAGGTGGAGATAAGATGG - Intergenic
1183065837 22:35362102-35362124 TAGTGGAGGTGGGGAAGAGAGGG + Intergenic
1183438631 22:37810004-37810026 CTGAGGTGAAGGAGAGGAGATGG - Exonic
1183530499 22:38350931-38350953 TGGTGATGATGGAGAGGAGGAGG + Intronic
1183581342 22:38728347-38728369 TGGTGACCATGGAGAGGAGAAGG + Intronic
1183799196 22:40147358-40147380 TTGTGGAGATGGATGGTTGATGG + Intronic
1183875242 22:40774939-40774961 TGGTGGCACTGGAGAGGAGAGGG - Intronic
1184937796 22:47737741-47737763 TTTTGGAGAAGGAGTAGAGAAGG - Intergenic
949183049 3:1157682-1157704 TCATGGAGATAGAGAGTAGAAGG - Intronic
949442159 3:4093468-4093490 TTGGGGAGAAGGAAAGGAGGAGG + Intronic
949898757 3:8792667-8792689 TGGGGGAGATGGAGAGGGAAAGG - Intronic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950154081 3:10708887-10708909 GTGAGGAGATGGGGAGGGGAGGG + Intergenic
950195506 3:11006537-11006559 GTGGGGAGGAGGAGAGGAGAGGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950694972 3:14691924-14691946 TCATGGAGATGGAGAGCAGATGG - Intronic
950792939 3:15487795-15487817 AAGTGGAGGTGCAGAGGAGATGG - Intronic
950890443 3:16399820-16399842 CCGTGGAGAGGGAGAGGACAAGG - Intronic
951227604 3:20139078-20139100 TTGTAGAGATGGTGAGGGGTTGG + Intronic
951893087 3:27584964-27584986 TGGTGTATATGGTGAGGAGAGGG + Intergenic
952538826 3:34344811-34344833 TCATGGAGATAGAGAGTAGAAGG + Intergenic
952726297 3:36589374-36589396 TCATGGAGATAGAGAGTAGAAGG + Intergenic
952755136 3:36859116-36859138 GTGGGGAGCTGGAGAGGAGGCGG - Intronic
952835363 3:37597445-37597467 TGGTGGAGGTGAAGAGAAGAGGG + Intronic
952849926 3:37719501-37719523 TTGTGCAGAGGGAGAGGATGTGG + Intronic
952917030 3:38254421-38254443 TTGGGGAGGAAGAGAGGAGATGG + Exonic
953087808 3:39689189-39689211 TTATAGACATGGAGAGTAGAAGG + Intergenic
953374280 3:42415691-42415713 TTGTGGGGAGGAAGAAGAGAAGG + Intergenic
953472656 3:43180161-43180183 TTGTGGGGAGGGAGAGGAAGAGG + Intergenic
953549301 3:43888791-43888813 TCGTGGAGATAGAGAGTAGAAGG + Intergenic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954439539 3:50514208-50514230 TTCTGGAGGTGGAGTAGAGAAGG + Intergenic
954617654 3:51977850-51977872 GTCTGGAGAGGGAGAGGAGAGGG - Exonic
954934683 3:54315541-54315563 TTGTGGGGAAGGGGAGTAGAGGG - Intronic
955051584 3:55416026-55416048 TTGTGGAGATGGGGAGGGAAGGG - Intergenic
955108863 3:55927782-55927804 TCATGGAGATAGAGAGTAGAAGG - Intronic
955570314 3:60298035-60298057 TGGAAGAGATGGAGAGGACAAGG + Intronic
956014499 3:64867385-64867407 TAGTGGAGAAGGAAAGAAGAGGG + Intergenic
956231088 3:67017496-67017518 TTGTGTAGCTGGAGATGACAGGG + Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956861458 3:73327924-73327946 TTGTAGAAATAGAGAGGAGGAGG - Intergenic
957124585 3:76142623-76142645 TTATGGACATAGAGAGTAGAAGG + Intronic
957266758 3:77976893-77976915 TGGAGGAAAGGGAGAGGAGAAGG + Intergenic
957521576 3:81325220-81325242 TTGTCAGGAGGGAGAGGAGAGGG + Intergenic
957670272 3:83292240-83292262 TTGTGGGGTAGGAGAGGGGAGGG + Intergenic
957864632 3:86005897-86005919 TCATGGAGATAGAGAGTAGAAGG - Intronic
958039009 3:88204083-88204105 TTATGGACATAGAGAGTAGAAGG + Intergenic
958100690 3:89005606-89005628 TCATGGAGATAGAGAGTAGAAGG - Intergenic
958129992 3:89406171-89406193 ATTAGGAGATGGAGAGGAGAAGG + Intronic
958422268 3:93942204-93942226 TTGCGGAGAGGGAGTGGAGGGGG - Intronic
958740171 3:98059614-98059636 TTGTTGAGATGGAGACTAGATGG + Intergenic
958900464 3:99880079-99880101 TTGTGTAGCAGCAGAGGAGAAGG - Intronic
959227347 3:103602959-103602981 TTTTGGGGATGGAGAGGTGCAGG - Intergenic
959307148 3:104682181-104682203 TCATGGAGATAGAGAGTAGAAGG + Intergenic
959408431 3:105990373-105990395 TCATGGAGATAGAGAGTAGAAGG - Intergenic
959682374 3:109109972-109109994 TTCAGGACCTGGAGAGGAGAAGG + Intronic
959717971 3:109454385-109454407 TCATGGAGATAGAGAGTAGAAGG + Intergenic
960078302 3:113513710-113513732 TAGTAGAGATGGAGAAGAGCGGG - Intronic
960312571 3:116134395-116134417 TTTTGGAGCTGGTGAGGATAGGG - Intronic
960401434 3:117204230-117204252 TTGAGGAGAAGGAGAGGTGTGGG - Intergenic
960418347 3:117412755-117412777 ATGAGGAGGAGGAGAGGAGAAGG - Intergenic
960427628 3:117528351-117528373 TCCTGGAGATGGAGAGTAGAAGG - Intergenic
960505713 3:118490919-118490941 TTATGGAAATAGAGAGTAGAAGG + Intergenic
960537036 3:118826034-118826056 TGGTGGAAATGGAGAGAAGGAGG + Intergenic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
960835027 3:121897064-121897086 TTGCTGGGAAGGAGAGGAGAGGG + Intronic
960861513 3:122158920-122158942 TCATGGAGATAGAGAGTAGAAGG - Intergenic
961040817 3:123676795-123676817 TTTTGGAGATGGACAGGACCTGG + Intronic
961248872 3:125482378-125482400 ATGAGGTGAAGGAGAGGAGAAGG - Intronic
961490521 3:127254026-127254048 TGGTGCAGATGGAGTGGGGAGGG - Intergenic
962284659 3:134075842-134075864 ATTTGGAGATGGAGAAGCGAGGG - Intronic
962338650 3:134562305-134562327 CTGTGGAGAGAGAGAGGAGCAGG + Exonic
962418437 3:135204972-135204994 TCATGGAGATAGAGAGTAGAAGG - Intronic
962580448 3:136793062-136793084 GTGGGGAGTTGGGGAGGAGAGGG - Intergenic
963168718 3:142230275-142230297 TCATGGAGATAGAGAGTAGAAGG - Intergenic
963828075 3:149977058-149977080 TTGTGGAGCAGGAGGGGAAAGGG + Intronic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964630525 3:158804962-158804984 TTGAGGGGATGGAGAGGGTAGGG + Intronic
964781620 3:160345397-160345419 TCATGGAGATAGAGAGTAGAAGG + Intronic
965725635 3:171712298-171712320 TTCTAGGGATGGAGACGAGAGGG + Intronic
965933636 3:174078879-174078901 TTGTTGATTTGGAAAGGAGAGGG - Intronic
965992419 3:174836288-174836310 TTATAGAGATAGAGAGTAGAAGG + Intronic
966243487 3:177780525-177780547 TTATGTAGATAGAGATGAGATGG + Intergenic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966565572 3:181377089-181377111 TTGAGGTGAAGGAGAGGATAGGG - Intergenic
966597048 3:181733448-181733470 TTGTGGAGGTGGAACAGAGAAGG - Intergenic
966669344 3:182509337-182509359 TTGTGGGGCTGGAGAGCAAAGGG + Intergenic
966679631 3:182627835-182627857 TCATGGAGATAGAGAGTAGAAGG - Intergenic
967299012 3:187993826-187993848 TTGTGGAAATGGATTGGACAAGG + Intergenic
967502305 3:190212938-190212960 TTATGGACATAGAGAGTAGAAGG + Intergenic
967570007 3:191017324-191017346 TTGAGAAGGTGCAGAGGAGAAGG - Intergenic
967870303 3:194224050-194224072 TGGTGGAGGTGTGGAGGAGATGG - Intergenic
967924926 3:194638560-194638582 TTGTGGAGATGCAGTGTAGGAGG - Intergenic
968042592 3:195600495-195600517 TTGGGGAGAGGGAGAGGAAGAGG + Intergenic
968062403 3:195735605-195735627 AAGTGGATATGTAGAGGAGAAGG - Intronic
968215873 3:196889858-196889880 TGGTGGAAGTGGAGAGGAAAGGG + Intronic
968631217 4:1653180-1653202 TTGGGGAGATGGGTGGGAGAAGG - Intronic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969359717 4:6655646-6655668 TTGTGGGGTTGGTGGGGAGAGGG + Intergenic
970123411 4:12782819-12782841 AGGTGGAAATGGTGAGGAGAGGG - Intergenic
970377520 4:15474403-15474425 TCATGGAGATAGAGAAGAGAAGG + Intronic
970479452 4:16458561-16458583 ATGGGGAGCTGGAGAGGAGATGG + Intergenic
970563361 4:17305571-17305593 TGGCGAAGATGCAGAGGAGAGGG - Intergenic
970592347 4:17570407-17570429 TTCTGCAGATAGAGAGGAAAAGG - Intergenic
970943321 4:21661183-21661205 ATGGGGAGCTGGAAAGGAGATGG - Intronic
971162788 4:24150912-24150934 GCGTGGAAATAGAGAGGAGAGGG - Intergenic
971214327 4:24649469-24649491 TTGTGGAGATGGGGTGGGAAGGG + Intergenic
972236658 4:37142392-37142414 TCGTGGACATAGAGAGTAGAAGG - Intergenic
972410070 4:38784673-38784695 GTTTGGAGATGGAGGAGAGATGG - Intergenic
972835963 4:42870029-42870051 TTATGGTGATGAAGAGGAGGAGG - Intergenic
972974001 4:44610919-44610941 TTGTGGAATTGGAAATGAGATGG + Intergenic
973115371 4:46451158-46451180 ATGTGGAGGTAGTGAGGAGAAGG + Intronic
973158053 4:46982409-46982431 ATGTGAACATGGAGAGAAGATGG + Intronic
973762170 4:54127687-54127709 TTGTGGAGATAGAGAGTAGAAGG - Intronic
973765535 4:54158346-54158368 TTAAGGAGAAGGAGAGGAGGAGG + Intronic
973805239 4:54519329-54519351 TTGTGGAGAGTGGGAGGAGAAGG + Intergenic
974290566 4:59924491-59924513 TCATGGAGATAGAGAGTAGAAGG + Intergenic
974369568 4:60998158-60998180 TCATGGAGATAGAGAGTAGAAGG - Intergenic
974669046 4:65004713-65004735 TGGTGGAGATAGAGAAAAGACGG - Intergenic
975268845 4:72405046-72405068 TTGAGGAGATGTAGAGAAAAGGG + Intronic
975275144 4:72488965-72488987 TTATAGAAATGGAGAGTAGAAGG - Intronic
975630266 4:76394441-76394463 TCATGGAGATAGAGAGTAGAGGG + Intronic
975908032 4:79238967-79238989 TTGTTGAGTTGGACAGGAGCTGG + Intronic
976071535 4:81245786-81245808 TGTTGGAGGTGGAGAGGAGGAGG + Intergenic
976152161 4:82103259-82103281 TGGAGGAGATGTAGAGGTGAAGG + Intergenic
976619124 4:87110546-87110568 TCATGGAGATAGAGAGTAGAAGG - Intronic
976645062 4:87378704-87378726 TCTTGGAGATAGAGAGTAGAAGG - Intronic
976748967 4:88434527-88434549 GGTTGGGGATGGAGAGGAGATGG + Intronic
976770580 4:88647949-88647971 TGGTGGTGAGGAAGAGGAGAGGG - Intronic
977573830 4:98657352-98657374 TTGTAGAAATGCAAAGGAGAAGG - Intronic
977765122 4:100788520-100788542 ATCTGGAGATGGGGAGGAGATGG - Intronic
977850329 4:101819912-101819934 TTGTAGAAAAGAAGAGGAGAAGG + Intronic
978008379 4:103648466-103648488 TCATGGAGATAGAGAGTAGAAGG - Intronic
978547217 4:109883905-109883927 TTGTGGACATAGAGAGTAGAAGG + Intergenic
978789345 4:112644297-112644319 GTGTTGCGATGGAGAGGAGGGGG + Intronic
978978653 4:114914143-114914165 TCATGGAGATAGAGAGTAGAAGG + Intronic
979453789 4:120903565-120903587 TTGTGCAGCTGGACAGGGGAAGG - Intronic
979583103 4:122383226-122383248 TTGGGGAGTGGGAGAGGAGGTGG - Intronic
979847311 4:125531961-125531983 TCATGGAGATAGAGAGTAGAAGG - Intergenic
979859296 4:125674149-125674171 TTATGGAGATGTAAAGAAGAGGG + Intergenic
979915383 4:126426274-126426296 CTATGGAGATAGAGAGTAGAAGG - Intergenic
980006148 4:127544562-127544584 ATGTGGAGCTGGAAAGGGGATGG - Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980753237 4:137120276-137120298 TCATGAAGATGGAGAGTAGAAGG + Intergenic
981002324 4:139839819-139839841 TAGTGGATATGAAGGGGAGATGG + Intronic
981103447 4:140855304-140855326 ATGGGGAGCTGGACAGGAGATGG + Intergenic
981203248 4:142008662-142008684 TCATGGAGATAGAGAGTAGAAGG - Intergenic
981351238 4:143732098-143732120 TGGTGGAGGTGGAGGGGAGCAGG - Intergenic
981725660 4:147844510-147844532 TCATGGAGATAGAGAGTAGAAGG - Intronic
981954720 4:150455848-150455870 TAATGGAGATAGAGAGTAGAAGG - Intronic
982341038 4:154299216-154299238 CTGTGGACATGTAGAAGAGAAGG - Intronic
982687523 4:158508940-158508962 TGGGGGAAATGGAGAGGTGATGG + Intronic
982977239 4:162079340-162079362 TTCTGGAGATAGAGTAGAGAAGG + Intronic
983544384 4:168947533-168947555 TTGGGGAGAAGGATGGGAGAGGG - Intronic
983586584 4:169362274-169362296 TCATGGAGATAGAGAGTAGAAGG + Intergenic
983625796 4:169800853-169800875 TTGAGGGGAAGGAGAGGAGTAGG - Intergenic
983708929 4:170690717-170690739 TTTTATAGATGGAAAGGAGAAGG - Intergenic
984239259 4:177197944-177197966 TCATGGACATGGAGAGTAGAAGG - Intergenic
984354875 4:178645143-178645165 TCATGGAGATTGAGAGTAGAAGG - Intergenic
984438020 4:179728319-179728341 TTGTGGTGCGGGGGAGGAGAGGG + Intergenic
984457513 4:179988848-179988870 TTGGAGAGATCCAGAGGAGAGGG + Intergenic
984627569 4:182024862-182024884 TTATGGAGATAGAGAGTAGAAGG - Intergenic
984748855 4:183252575-183252597 ATGTGGACAGGGACAGGAGAAGG - Intronic
984846183 4:184109987-184110009 TGGGGGAGATGGAAGGGAGAAGG + Intronic
984941476 4:184936030-184936052 TTAGGCAGATAGAGAGGAGAAGG + Intergenic
985230078 4:187806266-187806288 TCATGGAGATTGAGAGTAGAAGG + Intergenic
985269906 4:188184041-188184063 ATGGGGAGGTGGAGAGGGGATGG - Intergenic
985379921 4:189382817-189382839 TTGTGTGAAAGGAGAGGAGAGGG - Intergenic
985641020 5:1063606-1063628 AGGTGGAGGTGGGGAGGAGAAGG - Intronic
985960306 5:3297415-3297437 CTGTGGAGAAGGAAAGGATAGGG - Intergenic
986198202 5:5557349-5557371 TCATGGAGATAGAGAGTAGAAGG - Intergenic
986502825 5:8418010-8418032 TTGTGGGGTTGCAGTGGAGAAGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987374274 5:17218747-17218769 TTCTGGAAATGGAGGGGGGACGG - Intronic
987805435 5:22759527-22759549 TTGAGGGGCTAGAGAGGAGATGG - Intronic
988692156 5:33583171-33583193 TTATGGACATAGAGAGTAGAAGG - Intronic
988855345 5:35222851-35222873 TTGTAAAGTTGGAGAGGTGAGGG + Intronic
988922845 5:35960800-35960822 ATGGGGAGCTGGAAAGGAGACGG + Intronic
988998554 5:36737922-36737944 ATGTGGAGAAGGAGAGGTGGAGG - Intergenic
989234625 5:39132089-39132111 TAGTGGAGAAGGAAAAGAGAAGG + Intronic
989630021 5:43472754-43472776 TCGTGGACATAGAGAGTAGAAGG + Intronic
989786090 5:45332511-45332533 TCATGGAGATAGAGAGTAGAAGG - Intronic
990140406 5:52696828-52696850 CTATGGAGATGGAGAGGATGGGG - Intergenic
990499023 5:56376539-56376561 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
990524545 5:56611991-56612013 TCATGGAGATGGAGAGTGGAAGG + Intergenic
990849695 5:60188594-60188616 GAGTGGAGATGGAGGGGAAATGG + Intronic
990858505 5:60299532-60299554 TTGTGGAGAGGGAGAGTATCAGG - Intronic
990932307 5:61106726-61106748 TTATGGAGATAGAGAGTAGAAGG - Intronic
991054846 5:62308763-62308785 TGGTGGGGAAGGAGAGGAAATGG + Intronic
991238421 5:64426853-64426875 TCATGAAGATGGAGAGTAGAAGG + Intergenic
991316854 5:65318691-65318713 TTATGGACATAGAGAGTAGAAGG + Intronic
991938051 5:71822093-71822115 TCATGGAGATAGAGAGTAGAAGG - Intergenic
992587786 5:78259330-78259352 TTATGGACATAGAGAGTAGAAGG + Intronic
992905580 5:81342407-81342429 TTGGGTAGATGGAGAAGAGAAGG + Intronic
992966872 5:82011765-82011787 TTGTGTAGACGCAGAGGACATGG - Intronic
993235217 5:85297072-85297094 TCATGGAGATAGAGAGTAGAAGG - Intergenic
993667769 5:90722260-90722282 TTGTGCAGTTGGATGGGAGAAGG + Intronic
993773542 5:91962501-91962523 GTGGGGAGCTGGAAAGGAGATGG - Intergenic
993875376 5:93300333-93300355 TTTTTGAGATGGAGAGCAAAAGG - Intergenic
993914040 5:93719756-93719778 TTTTGGAGATAGATAGTAGATGG - Intronic
994274296 5:97816582-97816604 TCATGGAGATAGAGAGTAGAAGG - Intergenic
994399450 5:99260916-99260938 TCATGGAGATAGAGAGTAGAAGG + Intergenic
994457740 5:100034151-100034173 TCATGGAGATAGAGAGTAGAAGG + Intergenic
994660511 5:102648357-102648379 TCATGGACATGGAGAGTAGAAGG + Intergenic
995145145 5:108779823-108779845 ATGTTGAGAAGGAGAGGTGACGG + Intronic
995154058 5:108889510-108889532 TCCTGGAGATAGAGAGTAGAAGG + Intronic
995256403 5:110051640-110051662 TTGTTGAGAAGGCAAGGAGAAGG + Intergenic
995322133 5:110847419-110847441 TCATGGAGATAGAGAGTAGAAGG - Intergenic
995692081 5:114838629-114838651 TCATGGAGATAGAGAGTAGAAGG + Intergenic
995916946 5:117258586-117258608 TTCTGCAGATGGAGAGGAAATGG + Intergenic
995926645 5:117382970-117382992 TTGGGGAGAAAAAGAGGAGAAGG - Intergenic
996025043 5:118636329-118636351 TCATGGAGATAGAGAGTAGAAGG + Intergenic
996078290 5:119224080-119224102 TTGTGGAGAAGGTGGGGAGTTGG - Intronic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996688280 5:126309362-126309384 TCATGGAGATAGAGAGCAGAAGG + Intergenic
996690743 5:126337289-126337311 GTGTGGAGTTGGCGAGGGGAAGG + Intergenic
996789531 5:127277858-127277880 TTGCTGAGATGGAGATGACAAGG + Intergenic
996968772 5:129337943-129337965 TCATGGAGATAGAGAGTAGAAGG + Intergenic
997188828 5:131910381-131910403 TCGTGGAGATAGAGAATAGAAGG + Intronic
997870765 5:137503340-137503362 TTATGGACATAGAGAGTAGAAGG - Intronic
997880156 5:137582214-137582236 TTTTGGGGAAGGAGAAGAGAGGG - Intronic
997883934 5:137614202-137614224 TTGTGGAGATGAACATGAAAAGG - Intergenic
998545391 5:143023258-143023280 TTGAGGACCAGGAGAGGAGATGG + Intronic
998762625 5:145449337-145449359 ATGGGGAGCTGGATAGGAGATGG + Intergenic
998877669 5:146617184-146617206 TCATGGAGATAGAGAGTAGAAGG + Intronic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999329000 5:150660241-150660263 ACAAGGAGATGGAGAGGAGAGGG - Intergenic
999620001 5:153463251-153463273 TTCTGGAAATGGAGGGGAAATGG + Intergenic
999875634 5:155802789-155802811 TTTTAGAGTTGGAGAAGAGATGG + Intergenic
999889374 5:155960152-155960174 AGGTGGAAATGAAGAGGAGAAGG - Intronic
1000043514 5:157502796-157502818 CTGTGGAGAAGAAGAGGTGAGGG - Exonic
1000942483 5:167379044-167379066 GGGTGGACATGGAGAGGGGAGGG - Intronic
1000957863 5:167563424-167563446 TTGTGGTCAAGGAGAAGAGAAGG - Intronic
1001665046 5:173425666-173425688 GTGTGGAGATGAAGAGGTGTGGG + Intergenic
1001901609 5:175435038-175435060 TTTTGGAGAGGGACATGAGAGGG - Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002606435 5:180385499-180385521 TTGGGGAGAGGGAGTGGAGAGGG + Intergenic
1002723464 5:181280267-181280289 TTGGGTAGATGGAGAAGGGAAGG - Intergenic
1002736451 5:181391437-181391459 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1002748246 6:83387-83409 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1002766540 6:244800-244822 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1003151714 6:3557975-3557997 TTCTGGGGATGGGGAGGAGTGGG + Intergenic
1003200936 6:3959721-3959743 GTGACTAGATGGAGAGGAGAGGG + Intergenic
1003318859 6:5035306-5035328 GTGACTAGATGGAGAGGAGAGGG - Intergenic
1003390932 6:5712190-5712212 TAGTGAGGATGGAAAGGAGAAGG - Intronic
1003901485 6:10659607-10659629 GTGAGGAGGGGGAGAGGAGAGGG + Intergenic
1004955363 6:20722920-20722942 AAGTGGAGGTGGAGAGGGGATGG - Intronic
1005001311 6:21244521-21244543 TTAGGGAGATGGAGGGGAGAGGG - Intergenic
1005191664 6:23230404-23230426 TTGTGAAGAGGGAGAGGAGCAGG + Intergenic
1005408295 6:25515584-25515606 TCGTGGAGAATGAGAGGGGATGG - Intronic
1006404005 6:33833558-33833580 GTGGGGAGAGGGAGACGAGAGGG + Intergenic
1006462009 6:34165031-34165053 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1006750140 6:36371861-36371883 TTGGGCAAATGGAGAGGACATGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007099074 6:39232120-39232142 GTGGGGAGATGGGGAGGGGAGGG - Intergenic
1007168272 6:39843828-39843850 ATGGGGAGATGGGGAAGAGATGG + Intronic
1007256316 6:40531727-40531749 TAGTGGAGATGGAGAAGCTATGG - Intronic
1007303273 6:40884733-40884755 TTGGGGAGCTGGAGAGGGGATGG + Intergenic
1007341434 6:41193713-41193735 GTCTGTGGATGGAGAGGAGAGGG - Intronic
1007409865 6:41655252-41655274 GCGTGGAGATGGAGTGGGGAGGG - Intergenic
1007494686 6:42251766-42251788 TTGTGGAGATGGAGGAGACCTGG - Intronic
1007795440 6:44343137-44343159 TGCTTGAGATGGAGGGGAGACGG - Exonic
1007924906 6:45642961-45642983 AGGAGGAGATAGAGAGGAGAAGG - Intronic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1009447966 6:63765826-63765848 TCATGGAGATAGAGAGCAGAAGG - Intronic
1009609070 6:65914822-65914844 TAGTGGAGATTGAGAGGAGTTGG - Intergenic
1010016585 6:71111174-71111196 TATTGGAGATGGAGAGAAAATGG - Intergenic
1010040621 6:71378663-71378685 CTGTGGAGATGGAGAAGTCATGG + Intergenic
1010116174 6:72315273-72315295 TAGTGAAGATGGTGAGAAGAGGG + Intronic
1010259506 6:73798971-73798993 GAGAGGAGAAGGAGAGGAGAGGG - Intronic
1010761116 6:79724471-79724493 ATCTGGAGATGGAGCAGAGAAGG - Intergenic
1010837004 6:80600746-80600768 TTATGGAGACAGAGAGTAGAAGG - Intergenic
1011123398 6:83979841-83979863 TCCTGGAGATAGAGAGAAGAAGG - Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011385472 6:86792974-86792996 TCATAGAGATGGAGAGTAGAAGG - Intergenic
1011532152 6:88334546-88334568 TCGTGGAGATAGAGAGTAGAAGG + Intergenic
1011654623 6:89539822-89539844 TTATGGACATAGAGAGTAGAAGG - Intronic
1012028857 6:94032361-94032383 TCATGGAGATAGAGAGCAGAAGG + Intergenic
1012272636 6:97233426-97233448 TTGTGGAACTCCAGAGGAGAGGG - Intronic
1012446679 6:99314208-99314230 TTGTGGTGATGGAGAGGGGCGGG - Intronic
1012671999 6:102064296-102064318 AGGAGGAGAAGGAGAGGAGAAGG - Intronic
1012932300 6:105329900-105329922 GTGTGGAGATGGAGGGGAAATGG + Intronic
1013687799 6:112605801-112605823 TCGTGGAGATAGAGAGTAGAAGG + Intergenic
1014060508 6:117066091-117066113 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1014072578 6:117200299-117200321 TTGTAGAGAAAGAGAGAAGAGGG - Intergenic
1014109790 6:117607772-117607794 TTGTGGCCATGGTGAGCAGAGGG + Intergenic
1014339689 6:120188402-120188424 TTGTGGAGACGGAGAGTAGAAGG + Intergenic
1014561485 6:122896240-122896262 TTGTGGGGCTGGAGTGGGGAAGG + Intergenic
1014812412 6:125901851-125901873 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1015350929 6:132218790-132218812 TCGTGGAGCTAGAGAGTAGAAGG + Intergenic
1015486405 6:133774962-133774984 TTGGGGGGATAAAGAGGAGAAGG + Intergenic
1016075743 6:139793845-139793867 TTATGGACATAGAGAGTAGAAGG - Intergenic
1016085114 6:139903927-139903949 TGGGGGGGATGGAGAGGAAAGGG - Intergenic
1016542039 6:145177540-145177562 TTATGGATATAGAGAGCAGAAGG + Intergenic
1017337221 6:153275668-153275690 TTGGGGAGAGGGAGAGGATTGGG - Intergenic
1017388203 6:153909926-153909948 TCATGGAGATGGAGGGTAGAAGG + Intergenic
1017553929 6:155542624-155542646 TTGTGGGGATGAAGAGGAATTGG + Intergenic
1017554244 6:155545862-155545884 TTCTGAATATAGAGAGGAGATGG + Intergenic
1017910703 6:158790316-158790338 TTGAGGAGGTGGAGATGGGAGGG + Intronic
1018342070 6:162861692-162861714 TCGTGGAGATGCAGAGGTGCTGG + Intronic
1018361440 6:163074385-163074407 TCATGGAGATAGAGAGTAGAAGG + Intronic
1018669029 6:166164517-166164539 AAGTGGAGATGGAGAAGACAAGG - Intronic
1018988826 6:168658097-168658119 ATGGGGAGATGGAGAGCAGGTGG + Intronic
1019106632 6:169673077-169673099 TGATGGAGATGGAGAGGAGATGG + Intronic
1019241549 6:170666966-170666988 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1019271201 7:150078-150100 TGGTGGCGGTGGAGGGGAGATGG + Intergenic
1019315035 7:380376-380398 TTGTGCAGAAGGGGAGGTGATGG + Intergenic
1020168730 7:5828016-5828038 TTTGGGAGATGTAGATGAGAAGG + Intergenic
1020218204 7:6212106-6212128 TCATGGAGATAGAGAGTAGAAGG - Intronic
1020297710 7:6771015-6771037 TTGGGGAGAGAGAGAGGGGAGGG + Intronic
1020389881 7:7646671-7646693 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1020699722 7:11464583-11464605 TTGTGGAGTTTGTGATGAGAAGG - Intronic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021672641 7:23047363-23047385 ATGGGGAGAGGGAGACGAGAGGG + Intergenic
1021884196 7:25122455-25122477 TTATGGAGATGGTGAGCACAAGG - Exonic
1021926709 7:25540807-25540829 ATGGGGAGATGGGGAGGGGATGG + Intergenic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022403604 7:30065203-30065225 TTGTGCCGAAGGAGAAGAGAGGG - Intronic
1022575516 7:31493286-31493308 TTGTGGAGTTAGAGAAGAGCAGG + Intergenic
1022728698 7:33003356-33003378 ATGTGGAGAGAGAGAGGAAAAGG - Intronic
1022814126 7:33897732-33897754 TTGTGTAAATGGAAAGGAGTTGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023083653 7:36548534-36548556 GAGTGGAGTTGGTGAGGAGAGGG + Intronic
1023348553 7:39296427-39296449 GTGAGGAGAGGAAGAGGAGAAGG - Intronic
1023421540 7:39985149-39985171 TCATGGAGATAGAGAGTAGAAGG - Intronic
1023486982 7:40698115-40698137 TCCTGGAGATGGAGGAGAGATGG + Intronic
1023877432 7:44294654-44294676 TTGGGGAGATGAGGAGCAGAGGG - Intronic
1024049713 7:45610788-45610810 TGGTGGAGGTGGGGAGGTGATGG + Intronic
1024049747 7:45610948-45610970 TAGTGGAGGTGTAGAGGTGATGG + Intronic
1024049782 7:45611087-45611109 TGGTGGAGGTGGGGAGGTGATGG + Intronic
1024145110 7:46507013-46507035 TCTTGGAGATAGAGAGTAGAAGG + Intergenic
1024459480 7:49645338-49645360 TTATAGAGATGGGGAGGAGGCGG - Intergenic
1024905745 7:54376682-54376704 TCCTGGAGATGGGGAGGGGATGG + Intergenic
1024985481 7:55190129-55190151 GGGTGGAAAGGGAGAGGAGAGGG - Intronic
1025012311 7:55407318-55407340 TTGGGGTGAGGGAGAGGTGACGG - Intronic
1025044949 7:55684633-55684655 ATGTGGAGAGAGAGAGGAAAAGG + Intergenic
1025275469 7:57578749-57578771 TTGGGTAGATGGAGAAGGGAAGG - Intergenic
1025764564 7:64430790-64430812 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1026021936 7:66715088-66715110 TGGAGGAGGAGGAGAGGAGAAGG - Intronic
1026315400 7:69223234-69223256 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1026338125 7:69412212-69412234 TTGTAGAGATAGGGAGGAGGGGG - Intergenic
1026461016 7:70615175-70615197 TTCTGTAGTTGGAAAGGAGATGG + Intronic
1026618646 7:71930826-71930848 TTTTAAAGATGGAGAAGAGAAGG - Intronic
1026886297 7:73949379-73949401 TGGAGGAGAAGGAGAGGAGAAGG - Intergenic
1027043546 7:74976561-74976583 TTGTGATGATGGTGAGGAGGAGG - Intronic
1027801073 7:82749679-82749701 ATTTGGAGTGGGAGAGGAGAAGG + Intergenic
1027994322 7:85405283-85405305 TGGTGGAGTTGCAGAGGAAAGGG + Intergenic
1028008087 7:85603927-85603949 TTATGGAGACAGAGAGTAGAAGG - Intergenic
1028026262 7:85844326-85844348 TTACGGAGATAGAGAGCAGAAGG + Intergenic
1028147557 7:87335035-87335057 TTATGGAGATAGAAAGTAGAAGG - Intergenic
1028225687 7:88250052-88250074 TCGTGGAGATAGAGAGTAGAAGG - Intergenic
1028299090 7:89174275-89174297 TCAGGGAGATGGAGAGTAGAAGG - Intronic
1028354065 7:89885365-89885387 ATATGGAGATAGAGAGTAGAAGG - Intergenic
1028895669 7:96039173-96039195 TTATGGAGATGCAGAGTTGAGGG + Intronic
1029608737 7:101615334-101615356 GCCTGGAGAAGGAGAGGAGAGGG - Intronic
1029853069 7:103484762-103484784 CTGAGGACATGGAGAGGACATGG + Intronic
1030107122 7:105996584-105996606 TTTTGGATATGGTGGGGAGAAGG + Intronic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1030162017 7:106518621-106518643 AAGGGGAGAAGGAGAGGAGAGGG - Intergenic
1030379936 7:108800633-108800655 TTGTGGAGAGGTAGAGGCAAGGG - Intergenic
1030509049 7:110460516-110460538 GGGAGGAGAAGGAGAGGAGAAGG + Intergenic
1030693940 7:112563612-112563634 TTATGGACATAGAGAGTAGAAGG - Intergenic
1030844821 7:114396195-114396217 TCATGGAGATAGAGAGTAGAGGG - Intronic
1030985869 7:116241134-116241156 TTGTGGAATTGGAGAAGAAAAGG - Intronic
1031123207 7:117744361-117744383 TCATGGAGATAGAGAGTAGAAGG - Intronic
1031350979 7:120730799-120730821 ATATGGAGATGGAGAGGAATTGG - Intronic
1031392452 7:121232251-121232273 TTTTGGGGAAGGTGAGGAGATGG + Intronic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1032078145 7:128845833-128845855 TTGGGGAGTGGGAGAGGAGGGGG + Intronic
1032078162 7:128845888-128845910 AAGAGGAGAGGGAGAGGAGAGGG + Intronic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032400434 7:131620544-131620566 TTGTGGAGGTACAGAAGAGAGGG + Intergenic
1032411382 7:131695421-131695443 TGGTGGAGATGGACAGCAGCTGG + Intergenic
1032612475 7:133430144-133430166 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1033023154 7:137747483-137747505 TTGTGTAAATGGAGAGGATGAGG - Intronic
1033453552 7:141482546-141482568 TTGTGGAGGTGGATGGGGGAAGG - Intergenic
1033976046 7:147101647-147101669 ATGGGGAGCTGGAAAGGAGATGG + Intronic
1034390349 7:150782203-150782225 TTGTGGAGATGAGGATGGGAGGG - Intergenic
1034445594 7:151112550-151112572 CTCTGGAGACGGAGAGGGGATGG - Intronic
1034469203 7:151246649-151246671 CTGTGGAGACTGAGAGGAGGCGG + Intronic
1034872312 7:154695583-154695605 GTTTGGAGAAGGAGAGGTGAAGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035035798 7:155892985-155893007 TAGTGGTGATGGAGAGGGCAAGG + Intergenic
1035370346 7:158375868-158375890 ATGGGGAGCTGGAGAGGGGATGG - Intronic
1035391680 7:158508550-158508572 GTGGGGAGCTGGAGAGGAGCAGG + Intronic
1035506567 8:141130-141152 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1035659673 8:1337556-1337578 TGGTGGTGATGAAGAGGAGGAGG + Intergenic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1035823935 8:2624263-2624285 TTGTGGAGATGTGGAGAAAAGGG + Intergenic
1036141565 8:6213744-6213766 TTGTGGAGATGGAAAAGATGAGG + Intergenic
1036707520 8:11056332-11056354 ATGTGGAGAAGGGAAGGAGATGG - Intronic
1037208606 8:16356992-16357014 TTATGGACATAGAGAGTAGAAGG - Intronic
1037386409 8:18347422-18347444 GTGTGCAGGTGGAGGGGAGATGG + Intergenic
1037543937 8:19899373-19899395 TTATGGTGATGGAGAAGAGGAGG + Intergenic
1037644758 8:20783251-20783273 CTGTGCAGATGGCGAGGGGATGG + Intergenic
1037698868 8:21253708-21253730 TGAGGGAGATGGAGAGGAGAGGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037836883 8:22219871-22219893 GTGTGGAGAAGGAGAGAACATGG - Exonic
1038007392 8:23444359-23444381 TGATGATGATGGAGAGGAGAAGG + Intronic
1038324350 8:26561325-26561347 AGGTAAAGATGGAGAGGAGAGGG - Intronic
1038510579 8:28130666-28130688 TTGTGCAGATGGAGGGGAAGGGG + Intronic
1038529034 8:28302137-28302159 TCATGGACATGGAGAGTAGAAGG - Intergenic
1038574811 8:28695808-28695830 TGGTGGTGATGGGGAGGAGGTGG + Intronic
1038873782 8:31525384-31525406 GTGAGGAGATGGAGAGGAAGTGG - Intergenic
1039103977 8:33970609-33970631 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
1039236446 8:35507563-35507585 TCATGGAGATAGAGAGCAGAAGG + Intronic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1039610664 8:38916445-38916467 TCATGGAGATAGAGAGTAGAAGG - Intronic
1039656954 8:39420666-39420688 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1039727023 8:40229428-40229450 TTGGGGAGAGAAAGAGGAGAAGG - Intergenic
1039822358 8:41145356-41145378 GTGGGGAGATGGGCAGGAGAGGG + Intergenic
1040577292 8:48664923-48664945 TGGCAGAGCTGGAGAGGAGAGGG - Intergenic
1040867317 8:52061374-52061396 TCATGGACATGGAGAGTAGAAGG - Intergenic
1041342294 8:56858651-56858673 GTAAGGAAATGGAGAGGAGAGGG - Intergenic
1041387171 8:57316991-57317013 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1041750946 8:61260514-61260536 ATGGAGAGGTGGAGAGGAGATGG - Intronic
1042051137 8:64708962-64708984 TTGTGGAGAGGCAAAGGAGGAGG - Intronic
1042281202 8:67058294-67058316 TTGAGGAGAAGGAGATGGGAAGG - Intronic
1042450054 8:68933683-68933705 TTTTTGAGATGTAGAGGAGAGGG - Intergenic
1042692252 8:71513737-71513759 GTGAGGAGCTGGAGAGGAGGTGG - Intronic
1042933781 8:74038373-74038395 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1042955020 8:74240438-74240460 TCATGGAGATGGAGAGTAGAAGG - Intronic
1043149109 8:76691135-76691157 TTGTGGAGATGGTGAAGAGTTGG + Intronic
1043220454 8:77655814-77655836 TTGGGGAGCTGGAAAGGGGATGG - Intergenic
1043477273 8:80617461-80617483 TCGTGGAGATAGAGAATAGAAGG - Intergenic
1044340055 8:91036542-91036564 TGGTAGAGATGGAGAGATGAAGG - Intronic
1044394658 8:91696548-91696570 TCATGGACATGGAGAGTAGAAGG - Intergenic
1044683821 8:94808028-94808050 TTATGGAGATAGAGAGTGGAAGG - Intergenic
1044833889 8:96277311-96277333 TAGTGGAGATGGTGGGGAGTTGG + Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045124313 8:99072477-99072499 TTGAGGAGTGGGAGAGGAGAGGG - Intronic
1046113684 8:109758976-109758998 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1046133940 8:110002675-110002697 TCGTGGAGATAGAGAGTGGAAGG - Intergenic
1046150491 8:110217970-110217992 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1046713837 8:117545622-117545644 TGGGGGAGAGGGAGAGGAGTCGG + Intergenic
1046773792 8:118142440-118142462 TGGTAGGGATGGACAGGAGAAGG - Intergenic
1046776832 8:118173321-118173343 TTATGGAGGTGGAGAGCAGAAGG + Intergenic
1047100804 8:121674000-121674022 TTTTGAAGAGGAAGAGGAGAAGG - Intergenic
1047551567 8:125878487-125878509 TAGTGGAGAGGGAGAGGGGAGGG + Intergenic
1047810543 8:128403859-128403881 TTGTGGTGAAGGACAGGAGTCGG + Intergenic
1048105805 8:131407856-131407878 TTATGGACATAGAGAGAAGAAGG - Intergenic
1048183136 8:132214562-132214584 TTGTGCATATGGAGAAGGGAGGG - Intronic
1049272905 8:141705528-141705550 ATGTGGAGATGATGGGGAGATGG + Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049833911 8:144720726-144720748 TTCTGGAAATGGTGAGGTGATGG + Intergenic
1049853472 8:144847177-144847199 TTGTGGAGAGGGAGAGGAAGAGG + Intronic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050137764 9:2485455-2485477 TCATGGAGATGGAGAATAGAAGG + Intergenic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051219861 9:14836913-14836935 TTATGCAGATAGAGAGGAAAAGG + Intronic
1051432025 9:16988984-16989006 TATTGGAGTTGGAAAGGAGACGG - Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1051990639 9:23147808-23147830 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1052208564 9:25872672-25872694 TCATGGAGATGGAGAGTAGAAGG - Intergenic
1052402012 9:28012265-28012287 ATGTGAAGGTGGAGAGGAGCTGG + Intronic
1052420127 9:28233627-28233649 TGCTGGAGTTGGAGAGGAGATGG - Intronic
1053019230 9:34683482-34683504 CTGTGGATAGGAAGAGGAGAGGG - Intergenic
1053205446 9:36182538-36182560 TCATGGAGATAGACAGGAGAAGG + Intergenic
1054983119 9:71230276-71230298 TTGTGCAGATCGAGAGCAGAAGG + Intronic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1056069935 9:82975756-82975778 TTGTGAAGCTGGAAAGCAGATGG - Intergenic
1056180520 9:84078153-84078175 ATATGGAGATGGAGAGTAGAAGG + Intergenic
1057268843 9:93635919-93635941 CTGGGGAGGTGGGGAGGAGACGG + Intronic
1057291247 9:93808808-93808830 TTGGGGACAAGGAGAGGATAAGG + Intergenic
1057379657 9:94556070-94556092 TTGGGTAGATGGAGAAGGGAAGG + Intergenic
1057613538 9:96567640-96567662 TTGTAGAGATAGAGAGTAGAAGG + Intronic
1057717178 9:97503857-97503879 TAGTGGACCTGGAGTGGAGAGGG + Intronic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1058059646 9:100481652-100481674 TGGTGAAGATGGAATGGAGAAGG + Intronic
1058170471 9:101674427-101674449 TAGCAGAAATGGAGAGGAGATGG + Intronic
1058306499 9:103448591-103448613 TTTTGAAGATGGAGAAGAGTAGG + Intergenic
1058466727 9:105236352-105236374 TTTGGGGGATGGAGAGAAGACGG + Intergenic
1058811020 9:108639608-108639630 GTCTGGAAAGGGAGAGGAGAGGG - Intergenic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1058990373 9:110249927-110249949 TAGTGGAGAAGGAAAGGCGATGG - Intronic
1059118285 9:111618232-111618254 GTGGGGAGAGGGAGAGGAGAGGG + Intergenic
1059163476 9:112057128-112057150 TGGTGGGGATGGAGTGGGGAGGG - Intronic
1059166925 9:112086134-112086156 TTGTAGAGATGGTGGTGAGAGGG - Intronic
1059468255 9:114483382-114483404 TTGTAGAAATGGAGACAAGAAGG - Intronic
1059540528 9:115125904-115125926 TCATGGAGATAGAGAGCAGAAGG + Intergenic
1059560388 9:115328926-115328948 GTGAGGAGAGGGGGAGGAGAAGG + Intronic
1059643366 9:116238999-116239021 TTTTGGAGAAAAAGAGGAGAGGG + Intronic
1059760078 9:117329442-117329464 GAGAGGAGAGGGAGAGGAGAGGG + Intronic
1059819925 9:117960971-117960993 TTGAGGAAATGGAGAGAAAATGG - Intergenic
1059820652 9:117968659-117968681 TGGGGGAGATGGAGAGAACAAGG + Intergenic
1059900076 9:118914522-118914544 TTATGGAGATAGAGAGTAGAAGG - Intergenic
1060050857 9:120377134-120377156 GAGTGGAGAAGGAGGGGAGAAGG + Intergenic
1060122887 9:121011937-121011959 TTATGGAGATATAGAGTAGAAGG + Intronic
1060353553 9:122881668-122881690 GGGTGGGGATGGAGAGGACAGGG + Intronic
1060383050 9:123194866-123194888 TTGTGGAGATAAAGAAGAAAAGG - Intronic
1060405237 9:123369760-123369782 TGGTGGAGATGGATGGGAAAGGG + Intronic
1060994533 9:127868561-127868583 ATGGGAAGATGGGGAGGAGATGG - Intronic
1061467503 9:130793339-130793361 TGGAGGAGTTGGAGAGGTGATGG - Intronic
1061623637 9:131827583-131827605 TTCTGGAGATGGATGGGTGATGG + Intergenic
1061774045 9:132948794-132948816 TGGTGCGGAGGGAGAGGAGACGG - Intronic
1061926352 9:133807908-133807930 TCGGGGAGCAGGAGAGGAGAGGG - Intronic
1062016907 9:134295672-134295694 TGGTGGAGATAGAGGGGAGCTGG - Intergenic
1203438339 Un_GL000195v1:164643-164665 TTGGGTAGATGAAGATGAGACGG + Intergenic
1203601741 Un_KI270748v1:16200-16222 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1185769787 X:2757073-2757095 TTGGGGAGTTGGAAAGGGGATGG + Intronic
1185951316 X:4437612-4437634 TTTTAGAAATGGATAGGAGATGG + Intergenic
1186056473 X:5654707-5654729 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
1186219526 X:7334590-7334612 TTGAGGACATGCAGAGGAGGTGG - Intronic
1186276521 X:7944875-7944897 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1186301336 X:8202935-8202957 TAGTGGGGATGGAGAGTATATGG - Intergenic
1186329375 X:8515881-8515903 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1186692136 X:11989443-11989465 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1186710068 X:12184787-12184809 TCGTGGAGATAGAGAGTAGAAGG + Intronic
1186761797 X:12730904-12730926 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1186943779 X:14541996-14542018 TTCTGTAGATGGAGAGGTGTGGG - Intronic
1187095673 X:16145456-16145478 TCATGGACATGGAGAGTAGAAGG + Intronic
1187410905 X:19049792-19049814 TAGTGGAGTTGGGGAGGAGAGGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187578893 X:20587492-20587514 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1187724551 X:22188940-22188962 TCGTGGAGATAGAGAGTAGAAGG - Intronic
1187846800 X:23547115-23547137 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1187849420 X:23576828-23576850 TCATGGAGATAGAGAGTAGATGG - Intergenic
1188151803 X:26685929-26685951 TTGTGGAGATTGTGAGGTAACGG - Intergenic
1188323267 X:28766719-28766741 TCATGGACATGGAGAGTAGAAGG - Intronic
1188465349 X:30473331-30473353 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1188526567 X:31094106-31094128 ATGGGGAGCTGGAAAGGAGATGG + Intergenic
1188633726 X:32401525-32401547 CTATGGAGATAGAGAGTAGAAGG + Intronic
1188741553 X:33789454-33789476 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1188998646 X:36917899-36917921 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1189012936 X:37064572-37064594 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1189286105 X:39853600-39853622 GGGTGGGGAAGGAGAGGAGAAGG + Intergenic
1189450303 X:41122804-41122826 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1189690002 X:43606720-43606742 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1189809954 X:44772713-44772735 TAGTGGTGATGGAGAGAAAAAGG - Intergenic
1189845594 X:45133495-45133517 TCGTGGAGACAGAGAGTAGAAGG - Intergenic
1189854041 X:45205209-45205231 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1190139556 X:47830773-47830795 TTACGGAGATAGAGAGTAGAAGG + Intergenic
1190898402 X:54643806-54643828 TTGTGGAGGTAGAGAGTAGTAGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191150481 X:57216271-57216293 TTGTGGAGAAGCATGGGAGAGGG - Intergenic
1191189025 X:57646153-57646175 TCATGGAGATAGAGAGCAGAGGG + Intergenic
1191676394 X:63796174-63796196 TTATGGGTATGGAGAGGAGGGGG - Intergenic
1191704199 X:64076484-64076506 TCATGGAGATGGAGGGTAGAAGG + Intergenic
1191716825 X:64199610-64199632 TTGGGGAGCTGGAGAGGAAAAGG - Intronic
1191724328 X:64263183-64263205 TTGTGGAGAAGGAGGTGGGAAGG - Intergenic
1191781916 X:64878396-64878418 TCATGGAGATAGAGAGTAGAGGG + Intergenic
1191800975 X:65079051-65079073 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1192068091 X:67907934-67907956 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1192852630 X:74973627-74973649 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1193055120 X:77141844-77141866 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1193198761 X:78663285-78663307 TAGGGGAGAAGGCGAGGAGAAGG + Intergenic
1193245699 X:79226172-79226194 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1193312776 X:80026623-80026645 TGGTGGAGGTGGTCAGGAGAGGG + Intronic
1193439265 X:81518452-81518474 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1193655627 X:84193676-84193698 TGGTGAGGATGGAGAGAAGAGGG - Intergenic
1193659977 X:84245585-84245607 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1193842392 X:86422848-86422870 TCATGGAGATGGAGAGTAGAAGG - Intronic
1193908442 X:87271651-87271673 TCCTGGAGATAGAGAGTAGAAGG + Intergenic
1194992376 X:100558454-100558476 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1195003091 X:100661126-100661148 TTGTGAAGATGGAGAGAAACTGG - Intronic
1195168266 X:102241229-102241251 TCGTGGACATAGAGAGTAGAAGG - Intergenic
1195190591 X:102445858-102445880 TCGTGGACATAGAGAGTAGAAGG + Intronic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195285403 X:103377671-103377693 GGGTGGAGATGGAGATGATATGG + Exonic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195678449 X:107525264-107525286 AGGTGGAGATGGAGGAGAGAGGG - Intronic
1195781937 X:108476611-108476633 TCATGGAGATAGAGAGTAGAAGG - Intronic
1195824476 X:108983011-108983033 TCATGGAGATAGAGAGTAGATGG - Intergenic
1195911611 X:109893821-109893843 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196056369 X:111360405-111360427 TCATGGAGATAGAGAGTAGAAGG + Intronic
1196125546 X:112095042-112095064 TAGTAGAAAAGGAGAGGAGAAGG + Intergenic
1196135621 X:112206624-112206646 GAGTGTAGATGGAGAAGAGAAGG - Intergenic
1196254546 X:113500870-113500892 TTATGGATATAGAGAGTAGAAGG - Intergenic
1196316108 X:114226021-114226043 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1196493864 X:116300599-116300621 TCTTGGAGATAGAGAGTAGAAGG - Intergenic
1196605249 X:117650278-117650300 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1196626605 X:117884412-117884434 CTGTGGAGATAGAGAATAGAAGG + Intergenic
1196729198 X:118924072-118924094 TTATGGAGATAGAGAGTAGAAGG - Intergenic
1196771181 X:119295503-119295525 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1196886743 X:120252716-120252738 TTGTAAAGATGGAGAGATGAGGG + Intronic
1197019422 X:121668822-121668844 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1197309825 X:124891107-124891129 TTACGGAGATAGAGAGTAGAAGG + Intronic
1197408916 X:126091921-126091943 TCATGGAAATGGAGAGTAGAAGG + Intergenic
1197435109 X:126418269-126418291 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1197452163 X:126632785-126632807 TCATGGAGATGGAGAGAAGAAGG - Intergenic
1197468924 X:126842383-126842405 TGATGGATATGGAGAGTAGAAGG + Intergenic
1197487285 X:127068748-127068770 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1197600743 X:128525514-128525536 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1197718952 X:129731676-129731698 GAGTGGAGATGGCAAGGAGAGGG + Intergenic
1197915881 X:131534570-131534592 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1197917333 X:131550487-131550509 TAGTGGAGAAAAAGAGGAGAGGG - Intergenic
1198111811 X:133508886-133508908 TTATGCAGAAGGAAAGGAGATGG - Intergenic
1198171550 X:134110800-134110822 TTGTGGAGATGAAGAGAGGTTGG - Intergenic
1198249976 X:134870459-134870481 ATGAGGAGAGGGAGAGGAGTTGG + Intergenic
1198305909 X:135382943-135382965 TTGTAGTGATGGAGTGGAGTGGG - Intergenic
1198311640 X:135430529-135430551 TTGTGGAGATAGAGTGCTGAGGG + Intergenic
1198316013 X:135467201-135467223 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1198342784 X:135731467-135731489 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1198345205 X:135751828-135751850 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198454260 X:136800374-136800396 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1198538327 X:137608962-137608984 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1198621095 X:138510889-138510911 TTGTGAAGATGTAGAGTAAAGGG + Intergenic
1198784928 X:140276798-140276820 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1199047825 X:143197679-143197701 TTATGGACATAGAGAGTAGAAGG - Intergenic
1199099230 X:143779471-143779493 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1199136079 X:144254775-144254797 TTGTGGAGGTGGGGAGTACAAGG - Intergenic
1199140982 X:144312043-144312065 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1199194445 X:145010841-145010863 TTATGAAGATAGAGAGTAGAAGG + Intergenic
1199195421 X:145023807-145023829 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1199219316 X:145298833-145298855 TCATGGAGATAGAGAGGAGAAGG + Intergenic
1199248578 X:145633988-145634010 TCATGGAGATAGAGAGTAGAAGG + Intergenic
1199276794 X:145953624-145953646 TCATGGAGATAGAGAGTAGAAGG - Intergenic
1199370031 X:147036433-147036455 TCATGGAGATAGAGAGCAGAAGG - Intergenic
1199380654 X:147168475-147168497 ATGGGGAGCTGGAAAGGAGATGG - Intergenic
1199442692 X:147886356-147886378 TTATGGACATAGAGAGTAGAAGG - Intergenic
1199599776 X:149535056-149535078 ATGAGGAGGAGGAGAGGAGAAGG - Intergenic
1199650863 X:149945191-149945213 ATGAGGAGGAGGAGAGGAGAAGG + Intergenic
1199855178 X:151753803-151753825 ATGTGGCCATTGAGAGGAGAGGG - Intergenic
1200302793 X:154995299-154995321 TTGGGGAGAGGGAGAGTAAATGG + Intronic
1200364963 X:155652430-155652452 TCATGGAGATAGAGAGTAGAAGG - Intronic
1201300732 Y:12502559-12502581 TTGGGGAGCTGGAAAGGGGATGG - Intergenic
1201512894 Y:14784994-14785016 GTGGGGAGAGGGAGAGGATAAGG + Intronic
1201690482 Y:16759320-16759342 TTCTGTAGGTGGAGAGGAGAAGG - Intergenic
1201720473 Y:17090723-17090745 ATGTAGAGATGGAGAGCTGATGG - Intergenic
1201751498 Y:17436650-17436672 ATGGGGAGATGGAAAGGGGATGG + Intergenic