ID: 1170798491

View in Genome Browser
Species Human (GRCh38)
Location 20:19570620-19570642
Sequence TGGATAGAAGGTCTAGCGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170798491 Original CRISPR TGGATAGAAGGTCTAGCGTT AGG Intronic
900589391 1:3453054-3453076 TGGACAGAAGGTGTGGGGTTGGG + Intergenic
902757448 1:18558309-18558331 TGCCTAGAAGGTCTAGGGTGGGG + Intergenic
902931360 1:19733793-19733815 TGGAGAGACAGTCTAGCGTAGGG + Intronic
905662893 1:39741250-39741272 TGGATAGAACTTCTGGTGTTTGG + Intronic
915903398 1:159862031-159862053 GGGAGAGAAGGAGTAGCGTTGGG + Intronic
918784095 1:188742429-188742451 TAGATAGAATGACTAGTGTTAGG + Intergenic
920705121 1:208244696-208244718 GGAATAGAAGGTCTAGCGTTGGG + Intergenic
921648086 1:217643438-217643460 TGGACAGAAGGCCTGGCTTTGGG - Intronic
923443153 1:234040399-234040421 GGGATAGAAGTTCTCGCTTTGGG + Intronic
1074191495 10:111141880-111141902 TTGATAGAAGGTCAAGCAATGGG - Intergenic
1074612037 10:115031015-115031037 TGGATAGCAGGTGTAGGGCTTGG - Intergenic
1074664455 10:115703859-115703881 TGAATAGAAAGTCTAGATTTAGG + Intronic
1081331896 11:41811660-41811682 TGCATAGAATGTCCAGCTTTAGG - Intergenic
1083169313 11:60913489-60913511 TGGATAGAAGTTCTCACTTTGGG + Intergenic
1091020133 11:132092044-132092066 TTGCTAGAAGATCTAGCTTTGGG - Intronic
1099495001 12:83335855-83335877 TGGATAGAAGTTCTCACTTTGGG + Intergenic
1105623500 13:22091086-22091108 TGGAGAGAGGGTGTGGCGTTGGG + Intergenic
1114908602 14:27163703-27163725 GGGATAGAAGTTCTCACGTTGGG - Intergenic
1117968825 14:61232589-61232611 GGGACAGAAGCTCTAGCATTAGG - Intronic
1128040314 15:64566546-64566568 TGGCTAGAATGTCTAGCTCTTGG - Intronic
1128672064 15:69581164-69581186 GGGACAGAGGGGCTAGCGTTGGG - Intergenic
1129976786 15:79829463-79829485 TGGATAAATGGTATAGAGTTGGG - Intergenic
1132140613 15:99390353-99390375 TGGGCAGAAGGTGTAGCATTCGG + Exonic
1140447010 16:75037665-75037687 TGGAGAGAAGGTCTGGGGTGGGG - Intronic
1143845599 17:9770903-9770925 TGGCTAGCAGCTCTAGAGTTGGG - Intergenic
1153337841 18:3942851-3942873 TGGATATACCGTCTAGGGTTTGG + Intronic
1163256327 19:16158031-16158053 TGAATAGAAGGTCTGGCACTGGG - Exonic
1163449016 19:17364722-17364744 TGGATATCGGGTCTAGGGTTGGG - Intronic
932028842 2:68162553-68162575 TGGATAGATGGTCTCCCTTTAGG - Exonic
934688797 2:96341487-96341509 TGGCTAGAACCTCTAGAGTTTGG - Intronic
941330000 2:164168428-164168450 TGGGTAGAAGCTCTTGAGTTTGG - Intergenic
947153234 2:227135498-227135520 TGGGGAGAAAGTCTAGGGTTGGG + Intronic
948897744 2:240935125-240935147 TGGAAAGAAGGCCTAGGGCTGGG - Intronic
1170798491 20:19570620-19570642 TGGATAGAAGGTCTAGCGTTAGG + Intronic
1172329935 20:34068460-34068482 TGGTCAGAAGGTCTAGCTGTGGG - Intronic
1177801543 21:25833481-25833503 TGGATAGAAGTTCTCACTTTGGG - Intergenic
1177962126 21:27680225-27680247 GGGATAGAAGTTCTAACTTTGGG + Intergenic
1184998241 22:48226210-48226232 TGGACAGGATGTCTAGGGTTGGG - Intergenic
1185323485 22:50213941-50213963 TGGATAGACCATCTAGGGTTGGG - Intronic
950997422 3:17518226-17518248 GGGATAGAAGTTCTAACTTTGGG - Intronic
952913632 3:38212772-38212794 TGGATAGAGGATTTAGCTTTTGG + Intronic
956050646 3:65244549-65244571 GGGATAGAAGCTCTATCCTTAGG - Intergenic
961553300 3:127680994-127681016 AGGAAAGAAGCTCTAGAGTTGGG + Intergenic
974697227 4:65391544-65391566 TGAATAGATGTTCTAGCCTTTGG + Intronic
975320152 4:73000938-73000960 GTGAGAGAAGGTCTAGCGTGGGG + Intergenic
984983899 4:185308859-185308881 GAGAGAGAAGGTCTAGAGTTCGG - Intronic
989772543 5:45161925-45161947 TGGAGAGAAGGTCTAGAATAAGG + Intergenic
995845643 5:116490997-116491019 TGGAAAGAAGGAGTAGTGTTGGG + Intronic
1007005665 6:38359805-38359827 GGGATAGAAGGTTAAGCTTTGGG + Intronic
1009898692 6:69784720-69784742 AGGAAAGAAGGTCTAGAATTTGG - Intronic
1011902274 6:92313561-92313583 TGGAGAGAAGGTCATGCATTAGG - Intergenic
1021225317 7:18019725-18019747 TGGATAGAAGGCCAAGGGTGTGG - Intergenic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1022548014 7:31207321-31207343 TGGTTAGAAGGTCAAGTGTTTGG - Intergenic
1026616315 7:71908025-71908047 TGGATTTTAGGTCTAGCTTTCGG + Intronic
1028428717 7:90721711-90721733 TGGATAAAAGGGCTACTGTTTGG + Intronic
1029346122 7:99980107-99980129 TGGATATCAGGTCAAGTGTTAGG - Intergenic
1032797604 7:135290276-135290298 GGGATAGAAGTTCTCACGTTGGG - Intergenic
1038473386 8:27844136-27844158 AGGAGAGAGGGTCTAGCGATTGG - Intergenic
1043682888 8:83052894-83052916 TGGATAGAAGGGCCAACGATTGG - Intergenic
1060387955 9:123250574-123250596 TGGATAGAAAACCTAGCATTGGG - Intronic
1061842356 9:133366677-133366699 TGGAGAGAAGGACAAGGGTTAGG + Intronic
1186567661 X:10681227-10681249 TAGATAAAAGGACTAGCGATAGG - Intronic
1192070875 X:67940170-67940192 TGGATAGAAGGGCTAGAGAAAGG - Intergenic
1194794936 X:98199748-98199770 TGGATTGAAGGTAGAGCGTAGGG - Intergenic
1199846572 X:151695892-151695914 TGGAAATAAAGTCTAGGGTTTGG + Intronic