ID: 1170798978

View in Genome Browser
Species Human (GRCh38)
Location 20:19574855-19574877
Sequence GAGATCCCATACCATGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170798978 Original CRISPR GAGATCCCATACCATGCCCT GGG Intronic
900677810 1:3899822-3899844 GAGCTCCCAGGCCATGCCCGCGG - Intronic
904672098 1:32173718-32173740 TAGATTCCATACCCTGGCCTAGG + Exonic
906492372 1:46278569-46278591 GAGATCCCCTCCCCTGCCCCTGG - Exonic
912438863 1:109683008-109683030 GAGGTCCCATTACAGGCCCTTGG + Intronic
912441385 1:109701453-109701475 GAGGTCCCATTACAGGCCCTTGG + Intronic
915612047 1:157001675-157001697 GAGATCCCAGACCATTCTGTGGG + Intronic
922727073 1:227927550-227927572 GACATCCCATCCCTAGCCCTGGG - Intronic
923396405 1:233569205-233569227 GAGTCCCCATGCCCTGCCCTGGG + Intergenic
1063038609 10:2314740-2314762 GAGTTCCCCCTCCATGCCCTTGG - Intergenic
1063713934 10:8508869-8508891 GAGATTTCATACCATGCCCAGGG + Intergenic
1063753437 10:8978320-8978342 GAGATGCCATACAATGCTCCAGG + Intergenic
1069345320 10:67462800-67462822 GAGATTCCATAACAATCCCTAGG - Intronic
1069760216 10:70805253-70805275 GAGTTTCCATAACATGCCCTGGG - Intergenic
1072158819 10:92747784-92747806 TAGAACCCAGACCCTGCCCTTGG + Intergenic
1074970308 10:118531170-118531192 GAGTTTCCACTCCATGCCCTAGG + Intergenic
1075395301 10:122122659-122122681 GAAATCCCACAGCATGCTCTGGG - Intronic
1079761842 11:24338825-24338847 GAGCTCTCATACCATGCAATGGG - Intergenic
1080404173 11:31964303-31964325 GATATGCCAAGCCATGCCCTGGG + Intronic
1081142944 11:39525741-39525763 GAAATCCCAAACCATACCCAGGG - Intergenic
1081633127 11:44702831-44702853 GAGACCCCATCGCATGCCCAGGG + Intergenic
1088195507 11:107269389-107269411 GTGATCCTATACCCTGCACTAGG + Intergenic
1088569903 11:111213058-111213080 TAGCTCCCACACCATACCCTGGG + Intergenic
1091118428 11:133036956-133036978 GAGCTCCAAGACCATGACCTTGG + Intronic
1095965642 12:47865185-47865207 GAGAGCACACACCCTGCCCTGGG + Intronic
1098247720 12:68537571-68537593 GAGGCCACAGACCATGCCCTGGG + Intergenic
1104167795 12:126250791-126250813 GTGAGGCCACACCATGCCCTAGG + Intergenic
1106782156 13:33070045-33070067 GTGATCCCTTACCAAGCCATGGG - Intergenic
1107016864 13:35714559-35714581 GGGAACCCATACCATGGCCCCGG + Intergenic
1107438043 13:40399262-40399284 TAGATCCTAGTCCATGCCCTGGG + Intergenic
1111348335 13:86994087-86994109 GAGATCCCATGCATTCCCCTAGG + Intergenic
1121790953 14:96699271-96699293 GACTTTCCAAACCATGCCCTGGG - Intergenic
1122038231 14:98963928-98963950 CATATCCCAACCCATGCCCTTGG - Intergenic
1128672440 15:69584389-69584411 GAGGTTCAATACCATGCACTGGG + Intergenic
1129254628 15:74327106-74327128 GAGATCCCTCTCCATGCCCTGGG + Intronic
1129913314 15:79245893-79245915 GAGACCCCATTCCCTCCCCTTGG - Intergenic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1138141737 16:54574426-54574448 GAGATGCCTTACCATGCCCCAGG - Intergenic
1145047646 17:19630805-19630827 GAGGTTCCTTACCATGCCATGGG - Intergenic
1150666843 17:67147931-67147953 TTTCTCCCATACCATGCCCTAGG + Intronic
1150712428 17:67543338-67543360 GGGTTCCCAGACCAAGCCCTGGG + Intronic
1152567683 17:81107442-81107464 GAGAACCCACACCAGGGCCTAGG - Intronic
1158219310 18:55133788-55133810 AAGAACCCGTATCATGCCCTTGG - Intergenic
1158943564 18:62428526-62428548 GAGATGCCATGCAATGCTCTTGG + Intergenic
1162656869 19:12137977-12137999 GAGATCCCACACCCTGCCTCAGG + Intronic
1167786039 19:51637023-51637045 GAGATCCCAGATCTTGCCCTGGG + Intronic
1168696428 19:58406419-58406441 GTCATCCCATAACATGTCCTGGG - Intronic
925595759 2:5553926-5553948 GAGTTCTCTTGCCATGCCCTGGG - Intergenic
926081312 2:9988657-9988679 GAATTCCCATGCCATGGCCTGGG + Intronic
926701358 2:15806178-15806200 CAGATACCGTACCAGGCCCTGGG - Intergenic
927156936 2:20225908-20225930 GAGATCCCCTGCGAGGCCCTGGG + Intergenic
927253515 2:21019518-21019540 GTGATCCCATCCCATGCACAAGG + Intronic
930680084 2:54248433-54248455 TAGATATAATACCATGCCCTAGG + Intronic
932416248 2:71575394-71575416 GAGAGCCCCTCCCTTGCCCTGGG + Intronic
944315387 2:198279804-198279826 CAGCTTCCATACCAAGCCCTAGG - Intronic
945504456 2:210621125-210621147 CAGCTTCCCTACCATGCCCTTGG - Intronic
947520127 2:230839066-230839088 GAGATCCCACACCAGGCAGTGGG + Intergenic
948013985 2:234672801-234672823 CAGACCCCATACCCTTCCCTAGG - Intergenic
948327092 2:237133081-237133103 GAAATCCCATTCCATGTCCTTGG - Intergenic
948722740 2:239911798-239911820 GAAATCCCAGTCCACGCCCTCGG + Intronic
1168786803 20:546416-546438 GAGATCACAGGCCATGCCCAAGG + Intergenic
1170798978 20:19574855-19574877 GAGATCCCATACCATGCCCTGGG + Intronic
1174902069 20:54510694-54510716 GAGTTCCCTTACATTGCCCTGGG + Intronic
1177191976 21:17862084-17862106 GTAATACAATACCATGCCCTAGG + Intergenic
1179376838 21:40857281-40857303 GAAGTCCCATACCTTGCCATCGG + Intergenic
955920159 3:63946943-63946965 GAGGCCCCATACCTTGACCTTGG + Intronic
960956666 3:123036914-123036936 GTGAGCTCATACAATGCCCTAGG - Intergenic
962958207 3:140285915-140285937 GTCATCCAATACCATGACCTGGG + Intronic
963606443 3:147415544-147415566 GAGATCACAAATCAGGCCCTTGG + Exonic
966245874 3:177807796-177807818 TAGACCCCATACCAGGCCCCGGG - Intergenic
968575684 4:1364978-1365000 GAGCTCCCACACCCTGTCCTGGG + Intronic
974624417 4:64403635-64403657 GAGATACCAGACCATGCCTAAGG + Intronic
975371902 4:73599109-73599131 GGTGTCCCATCCCATGCCCTGGG - Intronic
978415907 4:108475710-108475732 GAGTGCCCAAACCATGCCATGGG - Intergenic
979703295 4:123691572-123691594 GAGACACCATATGATGCCCTAGG + Intergenic
986273451 5:6253723-6253745 CAGATTCCAGACCCTGCCCTGGG - Intergenic
987122877 5:14784279-14784301 AAGATTCCATGCCCTGCCCTAGG + Intronic
989575580 5:42985062-42985084 GAGATACCATACCCTGCCCATGG - Intergenic
997233327 5:132258724-132258746 GAGAACCCAGGCCCTGCCCTTGG + Intronic
997415968 5:133728974-133728996 GAGCTCCCAGGCCATGACCTTGG + Intergenic
998154748 5:139778345-139778367 GAGACCCCATCCCATGACATGGG - Intergenic
999553893 5:152720450-152720472 GGGATCCCAGACGAAGCCCTAGG - Intergenic
1001226545 5:169949368-169949390 GAGATCCCATTCCATGTTCCTGG + Intronic
1002090507 5:176802823-176802845 GAGCTCCCATACCAATCCCAGGG + Intergenic
1002090532 5:176802943-176802965 GAGCTCCCATACCAATCCCAGGG - Intergenic
1004063719 6:12222794-12222816 GACATCCCGTTCCATGCCTTAGG + Intergenic
1008927511 6:56902607-56902629 GAGAGCCCAAACAATGACCTCGG - Intronic
1011551361 6:88533763-88533785 GAGATGGCAAAGCATGCCCTTGG - Intergenic
1014191777 6:118504500-118504522 GAGATCCCATGCCATCTCCAGGG - Intronic
1015413785 6:132925036-132925058 CAGATCCCAAACCAGGGCCTCGG - Intergenic
1017464626 6:154682964-154682986 GAGATACCACAACATGCCCAAGG - Intergenic
1019132696 6:169888971-169888993 GAGTTCCCAGCCCATGCCTTGGG - Intergenic
1019132722 6:169889131-169889153 GAGTTCCCAGCCCATGCCTTGGG - Intergenic
1027334476 7:77133695-77133717 GAGGTCCCATACAATGCAATTGG + Intronic
1029304148 7:99606620-99606642 TAGATCCCAAAGCATGGCCTTGG - Intronic
1029781372 7:102737903-102737925 GAGGTCCCATACAATGCAATTGG - Intergenic
1034233239 7:149548843-149548865 GAGGCCCCACACTATGCCCTGGG + Intergenic
1038385089 8:27136538-27136560 GATATTCTAAACCATGCCCTTGG + Intergenic
1045720099 8:105099027-105099049 GAAATCCCATAACATGGCTTAGG - Intronic
1048257083 8:132913187-132913209 GAGCACCCAAACCATGTCCTGGG - Exonic
1052594350 9:30539363-30539385 GACATCCCATATCATGAACTTGG - Intergenic
1056480766 9:87003257-87003279 GAGATTCCAGGCCATGACCTGGG - Intergenic
1060079914 9:120633769-120633791 AACATCCCATACCATGCTATGGG - Intronic
1061222274 9:129259049-129259071 GAGGTCCCCTACGATGCCTTGGG - Intergenic
1061448950 9:130658586-130658608 CAGGTCCCATACAAGGCCCTGGG - Intergenic
1061486324 9:130922274-130922296 GAGACCCCAGACCAGGCCCGGGG - Intronic
1061610261 9:131740921-131740943 GAGACCCCACACCAGGGCCTGGG + Intergenic
1061991605 9:134162411-134162433 GAGATGGCATTTCATGCCCTTGG + Intergenic
1191250503 X:58257918-58257940 GAGAACCCAGGCCAAGCCCTGGG - Intergenic
1198641315 X:138759176-138759198 GTGATGCCATCCCAAGCCCTTGG - Intronic
1200259726 X:154607058-154607080 CAGATGCCACACAATGCCCTTGG - Intergenic
1201386700 Y:13447949-13447971 CAGATGCCACACCATGCCTTGGG + Intronic
1202250485 Y:22865823-22865845 GGGATCCCATACCATAGCATCGG + Intergenic
1202403474 Y:24499571-24499593 GGGATCCCATACCATAGCATCGG + Intergenic
1202467305 Y:25170510-25170532 GGGATCCCATACCATAGCATCGG - Intergenic