ID: 1170804079

View in Genome Browser
Species Human (GRCh38)
Location 20:19614658-19614680
Sequence CTCTCCCAACGCTACAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170804079_1170804083 17 Left 1170804079 20:19614658-19614680 CCCAAATTGTAGCGTTGGGAGAG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1170804083 20:19614698-19614720 AGGCCTCTGTTGTTGCCATGTGG 0: 1
1: 0
2: 0
3: 26
4: 207
1170804079_1170804082 -3 Left 1170804079 20:19614658-19614680 CCCAAATTGTAGCGTTGGGAGAG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1170804082 20:19614678-19614700 GAGTGCACTCGGTGACACTGAGG 0: 1
1: 0
2: 2
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170804079 Original CRISPR CTCTCCCAACGCTACAATTT GGG (reversed) Intronic
902417273 1:16247732-16247754 CTCACCCTACCCTACACTTTGGG - Exonic
907427302 1:54388503-54388525 CTGTCCCCATGCTACAAATTAGG + Intronic
909316948 1:74233808-74233830 ATCTCCCAGGGCTACACTTTAGG - Intronic
912959409 1:114181787-114181809 ATCTCCCAACACCTCAATTTCGG - Intergenic
918278222 1:182975303-182975325 TTCTCCCAAAGATACAAATTTGG - Intergenic
920973989 1:210768560-210768582 CTTTCCCATCACTACCATTTGGG + Intronic
922264526 1:223971465-223971487 CTCTCCAAACCCTGCAGTTTGGG - Intergenic
1065092668 10:22251412-22251434 CTATCCCAGCACCACAATTTGGG + Intergenic
1065201178 10:23314586-23314608 GTCTCCCAAGGCTGCAATTAAGG + Intronic
1067707760 10:48623553-48623575 CTCTCCAAATGCAACAATGTGGG + Intronic
1069556662 10:69402741-69402763 CTATCCCCAGGCTACCATTTTGG + Intergenic
1070673469 10:78394709-78394731 CTCTCCCAACCCTGCAAATCGGG + Intergenic
1070766332 10:79058537-79058559 CTCTCCCATGTCTACAATTTTGG + Intergenic
1071730813 10:88246660-88246682 CTCTCTCACGGCTAGAATTTTGG + Intergenic
1072576630 10:96706430-96706452 CTCTCCCTACACTACATTTCTGG - Intronic
1076676943 10:132152021-132152043 CTCTCCCAACACTTTAAGTTGGG - Intronic
1079545739 11:21629952-21629974 CTCTCCAAACCCTGCCATTTGGG + Intergenic
1084894547 11:72256265-72256287 CTCTTCCAAGGCTACAATCAAGG + Intergenic
1088731548 11:112688320-112688342 TTCTCCAAACTCTACAACTTAGG + Intergenic
1092803566 12:12197365-12197387 TTTTCCCAACACCACAATTTGGG + Intronic
1098424349 12:70342864-70342886 GTTTCCCAAGGCTAAAATTTAGG - Intronic
1099812325 12:87599291-87599313 CTCACCCACCCCTCCAATTTTGG - Intergenic
1100108780 12:91211059-91211081 CTCTCCCAAAGATATATTTTTGG + Intergenic
1106375653 13:29184492-29184514 CTTTCCCAATGCTTCAAGTTTGG - Intronic
1112810730 13:103215643-103215665 CTCTCCAAACGTCTCAATTTAGG + Intergenic
1112846640 13:103651354-103651376 CTTTCCCTACTCTACAATTTTGG + Intergenic
1115920713 14:38370097-38370119 CACTTCCAACACTACAGTTTGGG - Intergenic
1117519405 14:56535366-56535388 CTCTCTCAATGCTACAACATGGG - Intronic
1118505967 14:66412112-66412134 ACCTCCCAACGCTACAATATTGG - Intergenic
1119842441 14:77803365-77803387 CTCTCCCTATGCTACATTTCAGG - Intronic
1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG + Intronic
1122196519 14:100091485-100091507 CTCTCCCAACTCTGCCTTTTTGG - Intronic
1123482081 15:20641368-20641390 CTGTCCAAACACTACAACTTAGG - Intergenic
1123635934 15:22359000-22359022 CTGTCCAAACACTACAACTTAGG + Intergenic
1127906516 15:63380225-63380247 CTCTCCCAATTCTCCAAGTTGGG - Intronic
1140184343 16:72753973-72753995 CTCTCACAAGGCTGCAATTAAGG + Intergenic
1144426983 17:15152274-15152296 CTCTCCAAACCCCACCATTTAGG - Intergenic
1156509116 18:37620770-37620792 CTCCCCCTACCCTCCAATTTAGG + Intergenic
1157179363 18:45482452-45482474 CTCTCACAAGGCTACAATGAAGG + Intronic
1157508890 18:48253490-48253512 CTCTCTCAAGGCTACAGTTTGGG - Intronic
1158018528 18:52812953-52812975 CCCTCCCCACTCTACAATTTTGG - Intronic
1158471548 18:57741547-57741569 TTCTCACAAGGCTACAATTAAGG - Intronic
1159306550 18:66650654-66650676 CTCTCACAAAGCTACAGTTGAGG - Intergenic
928146189 2:28778390-28778412 CTCTCACAAGGCTCCAATTAAGG + Intronic
931582769 2:63795208-63795230 CTCATCCAACTCCACAATTTTGG - Intronic
935541671 2:104355671-104355693 CTCTTCCAAGTATACAATTTTGG + Intergenic
938298980 2:130197036-130197058 CCCTCTCAAGGCTACACTTTTGG + Intronic
940035598 2:149309579-149309601 CTCTCTCAACGCCATACTTTAGG + Intergenic
942403166 2:175624804-175624826 TTTTCTCAACCCTACAATTTGGG + Intergenic
944259196 2:197657642-197657664 CTCTCCCATCCCTACAAATGAGG - Intronic
945968952 2:216217784-216217806 CTCTCCCTACACCAGAATTTAGG + Intergenic
946544193 2:220718507-220718529 CTCTCCTAAAGATACAGTTTGGG + Intergenic
1170804079 20:19614658-19614680 CTCTCCCAACGCTACAATTTGGG - Intronic
1170810380 20:19669678-19669700 CTCTCCCAAAGTCACAACTTCGG - Intronic
1172054666 20:32145771-32145793 CTCTCCCACCACTAGAATATAGG - Intronic
1177932189 21:27298738-27298760 CTCTCCCCACCCTACAGTTTCGG - Intergenic
1183724732 22:39582179-39582201 CTCTCCCCAAGGTACAGTTTGGG + Intronic
1184963981 22:47953478-47953500 CTCACTCAACTCTACCATTTGGG + Intergenic
949321873 3:2820443-2820465 CTCTCCAAACGCTGTCATTTAGG + Intronic
949731142 3:7114691-7114713 CTATCCAAACGCTGCACTTTTGG + Intronic
955471428 3:59290474-59290496 TTCTCACAAGGATACAATTTAGG + Intergenic
956593370 3:70940422-70940444 CTCTCTCAACGCAACAGTCTGGG + Intergenic
957712978 3:83888319-83888341 TTGTCCCAAAGCTACAATTAAGG - Intergenic
963578488 3:147094651-147094673 CTCTCCCAACTCAACAATACTGG - Intergenic
964700830 3:159564318-159564340 CTCTCCCCATGCTCCATTTTGGG + Intronic
964779529 3:160320990-160321012 CTCTCCCCACCCTCCAACTTTGG + Intronic
965185724 3:165460301-165460323 CTCTCCCGACCCAACAATGTGGG + Intergenic
973860209 4:55056700-55056722 CTCTCACAAGTCTACAATTAAGG + Intergenic
977554199 4:98472163-98472185 CTCTCCCAGCCCTCCAATTACGG + Exonic
983927217 4:173415100-173415122 TTCTGCCAACTCTCCAATTTGGG - Intergenic
987450568 5:18078595-18078617 ATCTCCAAGCGCCACAATTTTGG + Intergenic
990866849 5:60389557-60389579 TTCTCACAAATCTACAATTTGGG + Intronic
990925241 5:61014257-61014279 CTCTCCAAACTCTGCCATTTAGG - Intronic
992034105 5:72754368-72754390 CTTTCTAAAAGCTACAATTTAGG - Intergenic
992168707 5:74080650-74080672 CTTTCCAAAGGCTACAATTTAGG - Intergenic
995979752 5:118087343-118087365 CTCTCACAAGGCTACAATCAAGG + Intergenic
998101655 5:139439701-139439723 CTATCCCAACTCTACAAATGAGG - Intronic
1000832712 5:166123792-166123814 CTTTCACAAGGCTGCAATTTAGG + Intergenic
1001695865 5:173669346-173669368 CTCTCCCAACACTGCCATATTGG + Intergenic
1005266851 6:24121174-24121196 CTCTCCCAACCCAACAAAGTGGG + Intergenic
1005737720 6:28764388-28764410 CTCTCCCAACTGAGCAATTTTGG - Intergenic
1006640227 6:35485870-35485892 CTCTCCCAGAGCTGCATTTTTGG - Intronic
1013752947 6:113428006-113428028 CTCTCCCACCCCCACAGTTTTGG - Intergenic
1020143002 7:5622645-5622667 CTCTCCGAACTCCACCATTTGGG + Exonic
1023321295 7:39000638-39000660 TTCTCCCAATGCTATAAATTGGG + Intronic
1031308285 7:120161647-120161669 CTCTCCAAACTCTACCCTTTGGG + Intergenic
1039088826 8:33806440-33806462 CTCTTCCCACGCTCCCATTTCGG - Intergenic
1039247994 8:35630851-35630873 TTCTCCCAAGGGCACAATTTTGG + Intronic
1042034903 8:64522186-64522208 CTCTCCCTTCACTACAAATTTGG + Intergenic
1045215363 8:100144128-100144150 GTCTCACAATGCTAGAATTTGGG + Intronic
1048791565 8:138109007-138109029 CCCTCCCAAGGCTACAATCATGG + Intergenic
1049116035 8:140688420-140688442 CACACCCAACGCTACATTTGAGG - Intronic
1052432265 9:28381797-28381819 CTAACCCGACACTACAATTTGGG + Intronic
1053233458 9:36431668-36431690 CTCTCCAAACTCTATTATTTAGG + Intronic
1055280017 9:74663602-74663624 CGCTCTCAAAGCTACAATTTGGG + Intronic
1060116376 9:120944585-120944607 CTCTCCCAAGGCCACAAGTCAGG + Intergenic
1186392233 X:9172656-9172678 CTCTCCCAACCCTTTAGTTTAGG - Intergenic
1186963660 X:14764149-14764171 GTCTCCCAAGGCTGCAATTAAGG + Intergenic
1188974587 X:36657860-36657882 TTCTCCCAATTCCACAATTTTGG + Intergenic
1194846930 X:98820704-98820726 CTCTCCCAAGACTATAATTTTGG + Intergenic
1199862936 X:151818293-151818315 CTCTCCCTACTCTCCAACTTTGG + Intergenic