ID: 1170804219

View in Genome Browser
Species Human (GRCh38)
Location 20:19616004-19616026
Sequence AGGATCTATGTACCTATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170804219_1170804227 27 Left 1170804219 20:19616004-19616026 CCTTCTATAGGTACATAGATCCT 0: 1
1: 0
2: 1
3: 11
4: 166
Right 1170804227 20:19616054-19616076 ACTAATACAATGCCTGTGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170804219 Original CRISPR AGGATCTATGTACCTATAGA AGG (reversed) Intronic
911863372 1:102984433-102984455 AGGGTTCATGTACCTAAAGAAGG - Intronic
912248535 1:107987393-107987415 AGGATATATGTACATATGAAAGG + Intergenic
913708633 1:121455539-121455561 AGGATATATGTATATATAAAAGG - Intergenic
913790544 1:122518183-122518205 AGGAAATATCTTCCTATAGAAGG + Intergenic
915373163 1:155369145-155369167 AAGATCTATGTATTTCTAGACGG + Intronic
915881223 1:159673784-159673806 AGAAACTATGTGCCTAGAGAAGG + Intergenic
917762971 1:178183691-178183713 AGTATTTATGTACCTATTGAGGG + Intronic
922636942 1:227183127-227183149 AGGATATATGTATATATAAAAGG - Intronic
1065918083 10:30368723-30368745 AGGATCTGTGCACCAAGAGAAGG - Intronic
1066612187 10:37260849-37260871 AGTATGCATGTACATATAGATGG + Intronic
1068543419 10:58321221-58321243 AGGATATATGTATATATAAAAGG - Intergenic
1069344392 10:67450900-67450922 AATATCTATATATCTATAGATGG + Intronic
1069817327 10:71206737-71206759 AGGATATATGTATGTATATAGGG - Intergenic
1072137651 10:92562320-92562342 AAGAACTATGCACCTGTAGAAGG + Intronic
1072740921 10:97908608-97908630 AGCATCTGCGTACCTATAGCTGG - Intronic
1073735154 10:106336711-106336733 AGGATATATGTATCTATGAAAGG + Intergenic
1073909840 10:108328918-108328940 AGGATATATGTATATATAAAAGG - Intergenic
1076068761 10:127469399-127469421 AGGATCTATGTACCTGTGGAAGG - Intergenic
1076940434 10:133603127-133603149 AGGATCTATGTATATATGAAAGG - Intergenic
1077778343 11:5295738-5295760 GGGAACTATGTACCAATTGATGG + Intronic
1079986462 11:27205376-27205398 AGGGACTATTTACCTTTAGAAGG + Intergenic
1081116479 11:39208210-39208232 AGGATCTTGGTCCCTATAGCTGG + Intergenic
1085247652 11:75116581-75116603 AGGATATATGTACATATGAAGGG - Intronic
1086763248 11:90660597-90660619 AGGATAGATGTATATATAGAGGG + Intergenic
1089913392 11:122126802-122126824 AGGGTCTATGTGCCCAGAGAGGG + Intergenic
1093037505 12:14346706-14346728 AGGATATATGTACATATGAAAGG - Intergenic
1097524873 12:60719813-60719835 AGGATCTGTGTAATTATATAGGG + Intergenic
1097734239 12:63164589-63164611 AGTAGCTATGTATTTATAGAAGG - Intergenic
1097907007 12:64931043-64931065 GGCATGTATGCACCTATAGATGG - Intergenic
1101925046 12:108964772-108964794 AGGAGCTATCAATCTATAGAGGG - Intronic
1102488467 12:113274005-113274027 TGGATCTTTGTACCTACAGGGGG - Intronic
1102669926 12:114609503-114609525 AGGATAGATGTATATATAGAGGG - Intergenic
1102917456 12:116764996-116765018 AGGATCTCTGTATCCATGGACGG + Intronic
1104133510 12:125916723-125916745 AGGATATATGTACATATGCAAGG - Intergenic
1106852207 13:33806081-33806103 AGGAACCACTTACCTATAGAGGG - Intergenic
1107236513 13:38177007-38177029 AGGATATATGTATATATAGAAGG - Intergenic
1108937963 13:55909755-55909777 GTGATCTATGCACCTATAAAGGG + Intergenic
1110128806 13:71980829-71980851 AGGATCATATTACCTATAGAGGG + Intergenic
1110377633 13:74812282-74812304 AGCAACTATGTGCCAATAGATGG + Intergenic
1110882423 13:80588358-80588380 AGGATATATGTACATATGAAAGG - Intergenic
1111285474 13:86085911-86085933 CAGATCTATGTAGATATAGATGG + Intergenic
1111811690 13:93099367-93099389 AGGATGTATGTATCTATGAAGGG - Intergenic
1112286923 13:98112546-98112568 AGGATGTATGTATATATAAAGGG + Intergenic
1113519189 13:110926659-110926681 AGGATAGATGTACATATAAAAGG - Intergenic
1114923377 14:27362560-27362582 AGGATCTGTGTTCCTTTGGAGGG + Intergenic
1116266099 14:42692483-42692505 AGGATATATGTATGTATAAAGGG + Intergenic
1116551757 14:46249064-46249086 AGGATATCTGTGCATATAGAAGG + Intergenic
1118972514 14:70649056-70649078 TGAATCCATGTACCTATATAGGG - Intronic
1126015400 15:44345741-44345763 AATATCTTTATACCTATAGAGGG - Intronic
1127793813 15:62421626-62421648 AGGACATATGGACATATAGAGGG + Intronic
1137816372 16:51401648-51401670 AGGATCTATGTATATATAAAAGG + Intergenic
1139003851 16:62547208-62547230 AGAATCTATCTAACTATAAAAGG + Intergenic
1143050373 17:4120443-4120465 AGGATATATGTATATATAAAAGG + Intronic
1143257686 17:5573906-5573928 AGGAGCTATGTTCCTTTGGAGGG - Intronic
1146515770 17:33488024-33488046 AGGATCTATGTATATATGAAAGG - Intronic
1148377032 17:47157755-47157777 TGCATCTATGTATATATAGAAGG - Intronic
1151039228 17:70839420-70839442 AGGATCTATGTATATATGGAAGG - Intergenic
1151174407 17:72275331-72275353 AGGATCTATGTCTATATAAAAGG + Intergenic
1155050742 18:22145807-22145829 AGGAGCCATGAAGCTATAGAAGG - Intergenic
1158199699 18:54926124-54926146 AGCATCTATGTAAATACAGAGGG + Intronic
1158330550 18:56357573-56357595 TCCATCTATGTATCTATAGATGG - Intergenic
1158723857 18:59950281-59950303 AGGATATATGTATATATGGAAGG - Intergenic
1163219441 19:15904386-15904408 AGGATAGATGTACATATAAAGGG - Intergenic
1167882456 19:52471395-52471417 AGGATCTGTGTATATATAAAAGG - Intronic
925755223 2:7127298-7127320 AGGATATATGTACATATGAAAGG + Intergenic
929333971 2:40717446-40717468 AGGATCTATGTATATATGAAAGG - Intergenic
930458384 2:51636475-51636497 AGGACTTATATACCTAAAGAAGG + Intergenic
935102051 2:100006229-100006251 AGTATCTATTTACCTATTTAAGG - Intronic
937189888 2:120085165-120085187 AGGAGCTATGTTCCTTTGGAGGG + Intronic
937796492 2:126028755-126028777 AGCAACTATGTACATATAGTAGG + Intergenic
939832443 2:147089026-147089048 AGGATATATGTACATATGAAAGG + Intergenic
943308602 2:186298754-186298776 AAGCTCTATGTACCCATATAGGG + Intergenic
944422267 2:199544130-199544152 AGGATAGATGTACATATAAAGGG + Intergenic
944619341 2:201498113-201498135 AGGATATATGTATATATAAAAGG + Intronic
948344751 2:237286327-237286349 AGGATATATGTATATATAAAAGG - Intergenic
1169003092 20:2182459-2182481 AGGATGTATATACATAAAGAAGG + Intergenic
1170804219 20:19616004-19616026 AGGATCTATGTACCTATAGAAGG - Intronic
1173469427 20:43311256-43311278 AGGATGTCTGTACCTTTCGAAGG + Intergenic
1175313351 20:58027036-58027058 TGGATGTATGTATGTATAGATGG - Intergenic
1181576118 22:23796213-23796235 AGAATCTCTGTACATATAGTGGG - Intronic
950831987 3:15883970-15883992 AGAAGCTATGTAGCTATTGAGGG + Intergenic
955488070 3:59454776-59454798 AGGATGTATGTGCATACAGAGGG - Intergenic
956581965 3:70824006-70824028 AGGATCTATTTCCCTCTGGAGGG + Intergenic
956692312 3:71889672-71889694 AGGCTTTATGTATCTATATAGGG - Intergenic
956940336 3:74153363-74153385 AGGATAGATGTATCTATAAAGGG + Intergenic
957634563 3:82763273-82763295 AGGATATATGTATATATAAAGGG - Intergenic
958888731 3:99759055-99759077 AGGATCGATGCAACTTTAGATGG - Intronic
959561040 3:107781756-107781778 AGGAACTATGTAAAGATAGAAGG - Intronic
965402685 3:168231777-168231799 AGCATCCATGGAACTATAGAAGG + Intergenic
967760301 3:193216707-193216729 AGGATATATGTACATATGAAAGG + Intergenic
967769403 3:193317884-193317906 AAGATCTATGTAGCTAGTGATGG - Intronic
969303358 4:6310325-6310347 AGGATCTATGTGTCTATGAAAGG - Intergenic
971078835 4:23183559-23183581 AGGATCTATGTATATATGAAAGG + Intergenic
972676894 4:41268781-41268803 AGGATATATGTATGTATAAAGGG + Intergenic
974539317 4:63213329-63213351 AATATATATGTAACTATAGAAGG + Intergenic
974727603 4:65815624-65815646 AGGATATATGTATATATAAAGGG - Intergenic
975427105 4:74243065-74243087 ATGCTATAGGTACCTATAGAAGG + Intronic
976080839 4:81353086-81353108 AAGATCCCTGAACCTATAGATGG + Intergenic
977551900 4:98451341-98451363 AGCATCTATGTACCTGTGGCAGG + Intergenic
978639308 4:110850880-110850902 AGAATCTTTGTAGCTATAAAGGG + Intergenic
978773217 4:112479614-112479636 AGGATCTGTGTTCCTTTGGAGGG + Intergenic
980611027 4:135164022-135164044 AGGATCTACATAAATATAGAAGG - Intergenic
983306613 4:165998283-165998305 AGAATCTATTTAGCTATAAAAGG - Intronic
983459015 4:168003940-168003962 AGGATATATGTACATATGAAGGG + Intergenic
983785158 4:171720879-171720901 AGGATATATGTATATATAAAAGG - Intergenic
985076293 4:186218780-186218802 AGGATAGATGTACATATAAAGGG + Intronic
985869145 5:2540038-2540060 AGGATGTATGTATGTATGGATGG - Intergenic
986191778 5:5503104-5503126 AGGATATATGTACATATAAAAGG - Intergenic
987000844 5:13657987-13658009 AGGATCTATGTGCCGGTACAGGG - Intergenic
988195371 5:27997990-27998012 AGGATAGATGTACATATAAAGGG - Intergenic
989529905 5:42495907-42495929 TGGATCTATGTATCCAAAGAAGG - Intronic
990198463 5:53344600-53344622 AGGATCGATGTATATATAAAGGG - Intergenic
991167043 5:63575448-63575470 AGTATATATGTACATATAAAAGG - Intergenic
994051914 5:95371484-95371506 AGGATATATGTATATATAAAGGG - Intergenic
994119461 5:96097520-96097542 AGGATACATGGACATATAGAGGG - Intergenic
994328595 5:98479276-98479298 ATGATCTATCTACCTAAAGCAGG - Intergenic
994719168 5:103361200-103361222 AGGATCTATCTATCTATCTATGG + Intergenic
994786682 5:104173646-104173668 AGGATATATGTATGTATAAAAGG - Intergenic
995187122 5:109283223-109283245 AGGATATATGTACATATGAAAGG + Intergenic
995329647 5:110933184-110933206 AGCCTGTATGCACCTATAGAAGG + Intergenic
995979665 5:118086458-118086480 AGGATATATGTACGTATATATGG + Intergenic
996460449 5:123734501-123734523 AGGATATATGTATGTATGGAAGG - Intergenic
997807586 5:136934384-136934406 AAGATATATGTACATATAAAAGG - Intergenic
997944107 5:138183848-138183870 AGAATCTCTGTACCCAAAGAAGG - Intronic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998977433 5:147663567-147663589 AGGATAGATGTATCTATAAAAGG - Intronic
999424128 5:151472095-151472117 AGGATAGATGTACATATATAGGG + Intronic
1001375220 5:171250016-171250038 AGCATCTAGTTACCTATAAAAGG + Intronic
1006067748 6:31474592-31474614 AGGATGTATGTACATATGTAAGG + Intergenic
1008168107 6:48166176-48166198 AGGATATATGTACATATGAAGGG + Intergenic
1008464982 6:51820358-51820380 AAGCTCTATGTCCCTATAGAAGG + Intronic
1009907298 6:69885564-69885586 AGGATAAATGTATCTAGAGATGG - Intronic
1010572939 6:77499734-77499756 AGGATCTAGGAACCTGCAGATGG + Intergenic
1011380781 6:86740181-86740203 AAGATATATGTACATATAAAAGG + Intergenic
1012724017 6:102784936-102784958 ATGATCTTTGTAGTTATAGATGG - Intergenic
1013416682 6:109931891-109931913 AGGATATATGTATATATAAAAGG + Intergenic
1013444444 6:110208340-110208362 AGAATCTAGCTACCTTTAGATGG - Intronic
1014557668 6:122853562-122853584 AGGATATATGTATATATAAAAGG + Intergenic
1015218181 6:130773969-130773991 AGGATAGATGTATATATAGAGGG - Intergenic
1016151134 6:140744610-140744632 AGGATATATGTACATACAAAAGG + Intergenic
1018011246 6:159671691-159671713 AGGAGCTATGTTCCTTTGGAGGG - Exonic
1021301023 7:18973411-18973433 ACAATATATGTACTTATAGATGG + Intronic
1021715550 7:23458824-23458846 AGGATTTCTGTACTTAGAGAAGG + Intronic
1022951481 7:35342787-35342809 AGGATATATGTATATATAAAAGG + Intergenic
1024492792 7:50004529-50004551 AGGATATATGTATCTATAATAGG - Intronic
1026181378 7:68044059-68044081 AGGATACATGTATCTATAAAGGG - Intergenic
1032789442 7:135231788-135231810 AGGATCTATGTTCCTGTGGTGGG + Intergenic
1039101276 8:33944671-33944693 AGGAACTATTGCCCTATAGAGGG - Intergenic
1040394935 8:46988741-46988763 AGGATCTATATAGATATATATGG - Intergenic
1040789473 8:51209169-51209191 AGGAGCAATGTACCTATCCAGGG - Intergenic
1047155236 8:122309782-122309804 AACAGCTATGTACATATAGAGGG - Intergenic
1048601457 8:135923028-135923050 AGGATATATGTACATATGGAAGG - Intergenic
1051296305 9:15600179-15600201 AGGAGCTGTGTTCCTTTAGAGGG + Intronic
1051857384 9:21584504-21584526 AGGATCTATGGACCTAAATTGGG - Intergenic
1052602758 9:30658583-30658605 AGAAACTATATTCCTATAGATGG + Intergenic
1053095788 9:35327233-35327255 AGGATATATGTATATATAAAAGG + Intronic
1056141638 9:83686510-83686532 AGGATATGTGCACCTATAGTAGG - Intronic
1056452883 9:86733894-86733916 AGGATATATGTATATATAAAAGG + Intergenic
1057107685 9:92435544-92435566 GAGATTTATGTACCTATAAAAGG - Intronic
1058691411 9:107523623-107523645 AGGATTAATGTATCTAAAGAAGG - Intergenic
1062179285 9:135182211-135182233 AGGATAGATGTACATATAAAAGG - Intergenic
1187571689 X:20510228-20510250 AGGAACTATGTAACAATAAAAGG - Intergenic
1187801577 X:23069544-23069566 AGGATATATGTATATATAAAAGG + Intergenic
1187987145 X:24826547-24826569 CGGATCTGTGAACCAATAGACGG + Exonic
1188018271 X:25128608-25128630 AGGATTCATCTACATATAGAGGG + Intergenic
1188163708 X:26834692-26834714 AGGATATATGTATATATAGAAGG - Intergenic
1188775758 X:34216321-34216343 AGGATATATGTATATATAAAAGG - Intergenic
1192696205 X:73418647-73418669 AGGATCTATGTACTTTAATATGG - Intergenic
1192771767 X:74200284-74200306 TTTATCTATGCACCTATAGAGGG - Intergenic
1194474916 X:94346706-94346728 AGGATATATGTACATATAAAAGG - Intergenic
1194511886 X:94806745-94806767 TGGATCTATGAACACATAGAAGG - Intergenic
1194521445 X:94922993-94923015 AGGATATACGTACATATAGAAGG - Intergenic
1194891323 X:99383702-99383724 AGAATATATGGACATATAGAGGG + Intergenic
1195871942 X:109495389-109495411 AGGATATGTATACCTAGAGAAGG + Intergenic
1196933948 X:120710518-120710540 AGGATATATGTATATATAAAGGG - Intergenic
1199197689 X:145050670-145050692 AGATTCTATGAACCTACAGAGGG + Intergenic
1201591225 Y:15616970-15616992 AGGATTTTTGTACATATACACGG - Intergenic
1201711606 Y:16998908-16998930 AGGACATATGGACATATAGAAGG + Intergenic
1201984182 Y:19946366-19946388 AGCATCTAATTACCTATAAAGGG - Intergenic