ID: 1170807712

View in Genome Browser
Species Human (GRCh38)
Location 20:19647445-19647467
Sequence GGCATTGATGTGCCAGCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170807712_1170807715 8 Left 1170807712 20:19647445-19647467 CCGGGTGCTGGCACATCAATGCC 0: 1
1: 0
2: 1
3: 10
4: 117
Right 1170807715 20:19647476-19647498 AATGCAGATATCCTTACACCTGG 0: 1
1: 0
2: 0
3: 7
4: 122
1170807712_1170807718 21 Left 1170807712 20:19647445-19647467 CCGGGTGCTGGCACATCAATGCC 0: 1
1: 0
2: 1
3: 10
4: 117
Right 1170807718 20:19647489-19647511 TTACACCTGGTACCCAGAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 105
1170807712_1170807717 20 Left 1170807712 20:19647445-19647467 CCGGGTGCTGGCACATCAATGCC 0: 1
1: 0
2: 1
3: 10
4: 117
Right 1170807717 20:19647488-19647510 CTTACACCTGGTACCCAGAGTGG 0: 1
1: 0
2: 0
3: 11
4: 149
1170807712_1170807721 28 Left 1170807712 20:19647445-19647467 CCGGGTGCTGGCACATCAATGCC 0: 1
1: 0
2: 1
3: 10
4: 117
Right 1170807721 20:19647496-19647518 TGGTACCCAGAGTGGGCGAAGGG No data
1170807712_1170807720 27 Left 1170807712 20:19647445-19647467 CCGGGTGCTGGCACATCAATGCC 0: 1
1: 0
2: 1
3: 10
4: 117
Right 1170807720 20:19647495-19647517 CTGGTACCCAGAGTGGGCGAAGG 0: 1
1: 0
2: 0
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170807712 Original CRISPR GGCATTGATGTGCCAGCACC CGG (reversed) Intronic
900784812 1:4642391-4642413 GCCATTGGTGTGGCAGTACCTGG + Intergenic
901078948 1:6572805-6572827 GGCAATGTTGGGCCAGCATCAGG - Intronic
901142234 1:7042587-7042609 GGCATTGAGATGCCACCAGCTGG + Intronic
901528506 1:9839186-9839208 GGCATTGATGGGCAAACCCCGGG - Intergenic
903176272 1:21583313-21583335 GCAGTTGATGTTCCAGCACCAGG - Intergenic
904815177 1:33190813-33190835 GGAATTGATGTCGCAGCATCAGG + Intergenic
905137356 1:35809281-35809303 GGCTTTGAGGTGGAAGCACCAGG - Intronic
905581031 1:39082517-39082539 GGCAAAGCTGTGCCAGGACCTGG + Intronic
911024950 1:93426656-93426678 GGCCATGCTGTGACAGCACCTGG - Intergenic
911182915 1:94876989-94877011 TGCCTTGATGTGCTAGCACTAGG + Intronic
912860191 1:113207271-113207293 GGCATTGATGTGGCAGCCACAGG + Intergenic
914983606 1:152438214-152438236 AGCAAAGATGTTCCAGCACCTGG + Intergenic
915166032 1:153948251-153948273 GGCTTTGAGGTGTCAGCAGCTGG - Exonic
917381746 1:174418438-174418460 AGCATTAATGTGCCATCACAGGG - Intronic
922560059 1:226563344-226563366 GGCATTGATTTGCAAGGCCCAGG + Intronic
924757152 1:246951760-246951782 GGCCCAGCTGTGCCAGCACCTGG - Intronic
1064676115 10:17762016-17762038 GGCAGTAATGTGACAGCTCCTGG - Intronic
1065185646 10:23168534-23168556 GGAATTGCTGTGCCAGCATTAGG - Intergenic
1067061623 10:43080784-43080806 GGCATGGCTGTGCCAGCAGAAGG + Intronic
1069890425 10:71648968-71648990 GGCATGGATAGGCCAGCACGCGG - Intronic
1070139401 10:73726973-73726995 GGCAAGGATGTGCATGCACCTGG + Intergenic
1070835950 10:79446750-79446772 GTCTTTGCTGCGCCAGCACCGGG + Intergenic
1075070443 10:119316709-119316731 GCCATGGATGTGCCACCTCCTGG + Intronic
1077134073 11:990078-990100 AGCATTGAAGCCCCAGCACCTGG - Intronic
1080553085 11:33390905-33390927 AGCATTGGTGTGCCAGGGCCAGG - Intergenic
1082287150 11:50329992-50330014 AGCAAAGATGTGACAGCACCTGG - Intergenic
1083994185 11:66264093-66264115 GGCCCTGCTGTGCCAGAACCAGG + Exonic
1084068284 11:66718122-66718144 GGCGTGGGGGTGCCAGCACCTGG - Intronic
1084218779 11:67665514-67665536 GGCATTGAAGTAGCAGAACCAGG + Exonic
1098849263 12:75575525-75575547 GGACTTCAGGTGCCAGCACCAGG + Intergenic
1104273734 12:127305776-127305798 GGCTGTCATGTGGCAGCACCAGG - Intergenic
1105604238 13:21913465-21913487 GGCTGTGATGTGCTAGCACCCGG + Intergenic
1106281075 13:28272050-28272072 GGCATTAATGGCCCAGTACCAGG + Exonic
1112601418 13:100859113-100859135 GGCATTGCCGTGCCGACACCTGG + Intergenic
1114061089 14:19016270-19016292 TGCACGGATGTGCCAGCAGCAGG - Intergenic
1114101167 14:19383709-19383731 TGCACGGATGTGCCAGCAGCAGG + Intergenic
1119867708 14:77987932-77987954 GGAATTGATGGGCCTACACCTGG - Intergenic
1122712879 14:103673061-103673083 GGCCTTACTGTGCCAGAACCAGG + Exonic
1124715631 15:32058455-32058477 GTCATTGATGTGTCGGCACAAGG + Intronic
1126158715 15:45588615-45588637 GACAGTGATGTGACAGCAGCGGG - Intronic
1128886197 15:71290214-71290236 GGACCTGCTGTGCCAGCACCAGG - Intronic
1130447361 15:84015641-84015663 GGCAGTGGTGTGCCACCACGTGG + Intronic
1131876461 15:96811975-96811997 GGCATGGAATTGCCAGCACATGG + Intergenic
1134341509 16:13351018-13351040 GGCACTGATGTGCAGGCACTGGG + Intergenic
1135020869 16:18961918-18961940 GGCATGGATTTGCCAGAACATGG - Intergenic
1136556330 16:31009907-31009929 GGGACTGAGATGCCAGCACCTGG - Intronic
1138087457 16:54145734-54145756 GGCATTTTTGTGACAGCAACCGG + Intergenic
1139301038 16:65945577-65945599 GGAAGAGATGTGCCAGCCCCAGG + Intergenic
1141566613 16:84906635-84906657 GGCAGTGAATTTCCAGCACCAGG + Exonic
1142962885 17:3562192-3562214 GGCATTGCGGTGCCAGCCACAGG - Intergenic
1144349362 17:14379860-14379882 TGCTTTTATGAGCCAGCACCAGG + Intergenic
1144793971 17:17878580-17878602 GGCAAGCATGTGCCAGCAGCAGG + Intronic
1147306455 17:39567707-39567729 GCCATTGCTGTGCCAGAGCCTGG + Intergenic
1150410809 17:64939210-64939232 GGCATTGCTGAGCCAGCAGCAGG + Intergenic
1158045064 18:53145856-53145878 GGGACTGATGTACCTGCACCTGG + Intronic
1162015741 19:7845685-7845707 GGCATTGATCTGCCTCCACCAGG + Intronic
1162192937 19:8961261-8961283 GGCATTGATGTGGAAGGAGCTGG + Exonic
1163433027 19:17279598-17279620 GGCAATGTTGTCCTAGCACCTGG - Intronic
1163737068 19:18988111-18988133 GCCAGAGATGTGCCAGCAACAGG - Intergenic
1164478296 19:28592011-28592033 GACATTGATGAGCCATCACTGGG - Intergenic
1165012355 19:32858234-32858256 GGCATGGATGGGCCTGCACACGG - Intronic
1166364189 19:42270212-42270234 GGCATTTGGGTGCCAGCCCCGGG + Intronic
1166782412 19:45349476-45349498 GGCCCTGCTGTGCCAGAACCAGG + Exonic
925186360 2:1849449-1849471 GACATTGATGTGGCTTCACCAGG - Intronic
927204691 2:20599780-20599802 GCCCTTGATATGCCAGCATCAGG + Intronic
927551961 2:24009215-24009237 GGCAGTGGTCTGCCAGCACTTGG + Intergenic
930721098 2:54639167-54639189 GGCATTCATGTGCCAAGACAGGG + Intronic
937151892 2:119691850-119691872 GACATTGCTGTGGCAGCAGCTGG + Intergenic
938478463 2:131636634-131636656 TGCACGGATGTGCCAGCAGCAGG - Intergenic
940187663 2:151004693-151004715 GCCATTTCTGTGGCAGCACCTGG + Intronic
941421465 2:165287293-165287315 TGCAGTGATCTGCCAGCACTTGG + Intronic
942260631 2:174158183-174158205 GGCTTTGATTTGGCACCACCTGG - Intronic
946178689 2:217937388-217937410 GGCAGAGATGGGCCAGCCCCAGG - Intronic
946487388 2:220113990-220114012 GGCTTTGAAGTGCCAGCAACAGG - Intergenic
947727160 2:232408009-232408031 GACATTGATGTGCGACCCCCGGG + Exonic
947773316 2:232687996-232688018 GGCAGTGATGTGCCAGCATCTGG - Intergenic
948264485 2:236627041-236627063 GGCACTTATGTGGCAGCAGCAGG - Intergenic
1170598442 20:17822768-17822790 AGCACTGATCTGCCAGCCCCAGG - Intergenic
1170807712 20:19647445-19647467 GGCATTGATGTGCCAGCACCCGG - Intronic
1172107427 20:32525041-32525063 GCCAGTCATGTGCCAGCTCCAGG + Intronic
1172632104 20:36385548-36385570 GGCATGGCTGGGGCAGCACCTGG + Intronic
1175104729 20:56606665-56606687 GGCAAGGGTGTGGCAGCACCAGG - Intergenic
1175357463 20:58380255-58380277 TGCATTGATGAGCCAGCACAAGG + Intergenic
1175714309 20:61245487-61245509 GGCATTCATGTGCCAACCCAAGG + Intergenic
1178216623 21:30606029-30606051 GGCATTGCTGGGCCTGCCCCGGG + Intergenic
1179400186 21:41076209-41076231 GCCAGCGCTGTGCCAGCACCTGG + Intergenic
1179835021 21:44025349-44025371 GGCATTGGGGTGCCAGGAACAGG + Intronic
1180479572 22:15738882-15738904 TGCACGGATGTGCCAGCAGCAGG - Intergenic
1183598900 22:38828698-38828720 CGCCGTCATGTGCCAGCACCAGG - Intronic
1184335126 22:43848457-43848479 GGCATTGCTTTGCCTGCTCCAGG - Intronic
951348793 3:21579716-21579738 AGCATGGATTTGACAGCACCTGG - Intronic
954706952 3:52486046-52486068 GGCCTTGATTTGCCAACCCCTGG - Intronic
959418817 3:106109454-106109476 GACATTGATATTCAAGCACCAGG + Intergenic
959782365 3:110250271-110250293 GGCATATATGTGCCTGCAGCTGG + Intergenic
968688204 4:1975600-1975622 GGCATTGTTCTGGCAGCCCCAGG - Intronic
969247205 4:5943402-5943424 TGCACTGATGTCCAAGCACCAGG + Intronic
972767734 4:42167068-42167090 GGCATTGATGGGGAAGCACAGGG + Intergenic
982400265 4:154959034-154959056 GGCATTGCTGTGACAGCAACAGG - Intergenic
983646979 4:170001845-170001867 GGAATTGAAGTGACAGCACCAGG + Intronic
996622146 5:125519611-125519633 GGTATCAATGTGCCAGCATCTGG - Intergenic
997675281 5:135708039-135708061 GGAAATGATGTCCCAGCCCCAGG - Intergenic
1005767486 6:29027349-29027371 CCCATTGATTTGCCAGCATCTGG + Intergenic
1007801541 6:44398061-44398083 GGCTTTGAAGTGCCAGATCCTGG + Intronic
1009928098 6:70144427-70144449 GGCATTCCTGTGCCAGAACCAGG - Intronic
1012672255 6:102068841-102068863 GGCATTGATATTCCATCTCCTGG - Exonic
1013171631 6:107641530-107641552 GGCATTGATGTGGCAGTGTCTGG + Intronic
1013598865 6:111685481-111685503 GGCATTGCTCTGCCATCCCCAGG - Intronic
1016820677 6:148343164-148343186 GCCTCGGATGTGCCAGCACCCGG - Exonic
1018455885 6:163951830-163951852 TGCAGTGACCTGCCAGCACCTGG + Intergenic
1018626936 6:165788973-165788995 GGCAATGATGGGACAGCTCCTGG + Intronic
1024114392 7:46178659-46178681 GGCATTGCTGTGTCTGCACTGGG + Intergenic
1030243735 7:107359272-107359294 GGCTGAGATGTGACAGCACCTGG - Intronic
1034882580 7:154773849-154773871 GGGATGGATGCTCCAGCACCTGG + Intronic
1035371525 7:158382157-158382179 GGCATACATGTGCAGGCACCTGG + Intronic
1036069490 8:5424894-5424916 GGCATTGCTGTGACCACACCGGG + Intergenic
1039611748 8:38924566-38924588 GGCTTTCGTGTGCCTGCACCGGG + Intronic
1040486979 8:47882995-47883017 GGCGTGGATGGCCCAGCACCAGG - Intronic
1047415263 8:124659738-124659760 TGCATTGATGGGACAACACCTGG + Intronic
1049399625 8:142419097-142419119 GGCAGAGATGTGGCCGCACCTGG + Intergenic
1050465347 9:5917115-5917137 ATCATTATTGTGCCAGCACCTGG - Intronic
1051185008 9:14451044-14451066 GGTAATGTGGTGCCAGCACCTGG - Intergenic
1054155019 9:61634128-61634150 TGGTTTGATGTACCAGCACCAGG - Intergenic
1060492019 9:124092061-124092083 ACCATTGATGCCCCAGCACCTGG + Intergenic
1062397319 9:136357724-136357746 GGCATGGGTGTGCCAGGCCCAGG - Intronic
1062677966 9:137759438-137759460 GGCCTTCATGTGCCAGCTCCCGG - Intronic
1188488506 X:30710201-30710223 GGCTTTGATGTCCAAGCATCTGG - Intronic
1193286522 X:79721422-79721444 TGCATTGGTCTGCCAGCACTCGG - Intergenic
1200697157 Y:6371123-6371145 TGCATTCATGAGCCAGGACCAGG + Intergenic
1201036956 Y:9793576-9793598 TGCATTCATGAGCCAGGACCAGG - Intergenic