ID: 1170809721

View in Genome Browser
Species Human (GRCh38)
Location 20:19664484-19664506
Sequence CAAAATGAGGATGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1457
Summary {0: 1, 1: 0, 2: 8, 3: 177, 4: 1271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170809721_1170809727 24 Left 1170809721 20:19664484-19664506 CCTTCCTCCTCATCCTCATTTTG 0: 1
1: 0
2: 8
3: 177
4: 1271
Right 1170809727 20:19664531-19664553 TGCTTTATGCGCTTTGTGACTGG 0: 1
1: 0
2: 0
3: 4
4: 64
1170809721_1170809725 -6 Left 1170809721 20:19664484-19664506 CCTTCCTCCTCATCCTCATTTTG 0: 1
1: 0
2: 8
3: 177
4: 1271
Right 1170809725 20:19664501-19664523 ATTTTGACCTTCAAGATAATTGG 0: 1
1: 0
2: 0
3: 17
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170809721 Original CRISPR CAAAATGAGGATGAGGAGGA AGG (reversed) Intronic
900086073 1:897981-898003 CACACTGATGAGGAGGAGGAAGG - Intergenic
900753019 1:4411569-4411591 CAAAAGGAAGAGGAGGAGGAAGG - Intergenic
901017263 1:6239041-6239063 CAAAATGGGGCTGATGAAGAGGG - Intergenic
901330990 1:8408361-8408383 CAAAGAGAGCAAGAGGAGGAGGG + Intronic
901385819 1:8908447-8908469 CACACTGATGATGACGAGGAAGG - Intergenic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901864858 1:12098851-12098873 CAGGAAGAGGATGAGGAGGTGGG - Intronic
901927668 1:12577094-12577116 AAAAATGAGGATGACACGGAAGG - Intronic
902178254 1:14667941-14667963 CAAAAGGAAGATGAAGAAGATGG - Intronic
902267008 1:15274690-15274712 AATAATGAGGAGGAGCAGGAGGG + Intronic
902275023 1:15333311-15333333 GAAGAGGAAGATGAGGAGGAAGG + Intronic
902361596 1:15945133-15945155 CAAGAGGAGCAAGAGGAGGAGGG - Exonic
902391213 1:16108085-16108107 CACACTGATGATGAGGAGGAAGG - Intergenic
902596287 1:17511751-17511773 CAAAAGTGGGATGAGGATGAGGG + Intergenic
902821293 1:18944917-18944939 CAAGAAGAGCATGAGGAGGGAGG + Intronic
902904147 1:19542096-19542118 CACACTAACGATGAGGAGGAAGG + Intergenic
902965496 1:19998119-19998141 CACACTGATGATGCGGAGGAAGG + Intergenic
902980885 1:20122105-20122127 GATGATGAGGAGGAGGAGGACGG - Intergenic
902981325 1:20125544-20125566 AATAATGAGGATGAGGATGATGG + Intergenic
903131814 1:21284442-21284464 CAGAAAGAGAATGAGAAGGAGGG + Intronic
903389922 1:22956389-22956411 GAGAAAGAGGAGGAGGAGGAAGG + Intronic
903557524 1:24204409-24204431 CAGACTCAGAATGAGGAGGAAGG - Intergenic
903958953 1:27044597-27044619 GAAGATGGAGATGAGGAGGATGG + Intergenic
904324190 1:29717147-29717169 CACACTGATGTTGAGGAGGAAGG - Intergenic
904434951 1:30488679-30488701 GATAATGAGGATGATGATGATGG + Intergenic
904565471 1:31425803-31425825 CTGGATGAGGATGAAGAGGAAGG - Exonic
905018839 1:34794833-34794855 CAACATGAAGATGATGAAGATGG - Exonic
905300959 1:36985926-36985948 CACAGTGAGGAGGAGGGGGAGGG - Intronic
905393765 1:37654265-37654287 CCAGGTGAGGATGGGGAGGAAGG - Intergenic
905696095 1:39974734-39974756 CAAGATGAGGCTGAGGATGAAGG + Intergenic
905956363 1:42000502-42000524 CCAAAGGAGAAAGAGGAGGATGG + Intronic
906414934 1:45614105-45614127 GAAAATGAGGAGGAGGAGATTGG + Exonic
906471538 1:46134702-46134724 CAAAATGAGGGTGAAGAGAGAGG + Intronic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
907016017 1:51013849-51013871 CAAGAAGATGAGGAGGAGGAAGG + Intergenic
907488078 1:54790841-54790863 AAGAAGGAGGAGGAGGAGGACGG - Intronic
907700271 1:56779645-56779667 CAAAATGATGGGGAGAAGGATGG - Intronic
907758853 1:57337968-57337990 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
908061495 1:60354956-60354978 CAAAATGGGGTGGAGGGGGAGGG + Intergenic
908115502 1:60936112-60936134 AAAATGGAGGATGAGGAGGTGGG + Intronic
908331076 1:63071863-63071885 TAAAAAGGGGATGAGGATGACGG + Intergenic
908634870 1:66152391-66152413 CAAGATGAAGATGAGCAGGCAGG + Intronic
909334487 1:74455762-74455784 CAGAATGAGGAGGCAGAGGAAGG - Intronic
909536997 1:76748111-76748133 AAAAATGAGGGTGAGCTGGAGGG + Intergenic
909686550 1:78355217-78355239 CAAAAAAAGGAGGAGGAGAAAGG - Intronic
909779093 1:79520229-79520251 GAAGAAGAGGAAGAGGAGGAAGG + Intergenic
909940738 1:81608832-81608854 TAAAAGGAGGAAGAGAAGGAAGG - Intronic
909996152 1:82282116-82282138 AAAAAAAAGGGTGAGGAGGAGGG + Intergenic
910730399 1:90389424-90389446 TAAAATGAAGATGAAGATGATGG - Intergenic
910784154 1:90975899-90975921 CAAAATAATGATGAGTATGAAGG + Intronic
911122093 1:94306562-94306584 CAAAATGAGGATCAAGACTATGG + Intergenic
911251907 1:95585897-95585919 GAAAATGAAGATGGAGAGGAGGG - Intergenic
911320726 1:96410569-96410591 GAAATGGAGGAGGAGGAGGAGGG - Intergenic
911364008 1:96914894-96914916 CAAACTGTGGAAGAGGATGAGGG + Intergenic
911816818 1:102363277-102363299 CTAAAGGAGGAAGAGGAGAATGG - Intergenic
911991270 1:104699679-104699701 CAAAAGGTGGAGGAGGTGGAAGG - Intergenic
912512944 1:110200890-110200912 CAAGAGGAGGAGGAGGAGGCAGG - Exonic
913053652 1:115138455-115138477 CAAAATTAGGATCAAGATGAGGG - Intergenic
913083589 1:115413107-115413129 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
913245905 1:116869735-116869757 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
913427580 1:118751186-118751208 GAAAATGACAATAAGGAGGATGG + Intergenic
913939863 1:125091643-125091665 AAAAAGGAGGAGGAGGGGGAAGG + Intergenic
913979212 1:143493449-143493471 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
914043603 1:144072783-144072805 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
914058053 1:144183179-144183201 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
914073615 1:144319099-144319121 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
914105540 1:144647261-144647283 AAAAAGGAGGAGGAGGGGGAAGG + Intergenic
914134484 1:144887708-144887730 AAAAAGGAGGAGGAGGGGGAAGG + Exonic
914763380 1:150617159-150617181 CAATTTGAGGAGGTGGAGGAAGG - Intronic
914857275 1:151361980-151362002 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
914932697 1:151949242-151949264 AAAAAAGAGGAGGAGGAGGAAGG - Intergenic
914982080 1:152423950-152423972 CACACTAAAGATGAGGAGGAAGG - Intergenic
915179757 1:154048048-154048070 CACACTGATGATGTGGAGGAAGG + Intronic
915313632 1:155016617-155016639 CCTGATGACGATGAGGAGGAAGG + Exonic
915468684 1:156113336-156113358 CAAACAGAGGATGAGGTGGATGG + Intronic
915557837 1:156670124-156670146 GAAAAGGAGGAGGGGGAGGAGGG - Exonic
915730033 1:158046737-158046759 CAAGATGAGGACGAAGATGAGGG + Intronic
915917269 1:159948080-159948102 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
916023456 1:160814306-160814328 GAGAAAGAGGAAGAGGAGGAGGG + Intronic
916576918 1:166075550-166075572 GAGCATGAGGATGATGAGGACGG + Intronic
916657077 1:166885796-166885818 CAAGAGGAGAAGGAGGAGGAGGG - Intergenic
917169621 1:172156614-172156636 AAAAAACAGGAGGAGGAGGAGGG - Intronic
917369765 1:174279810-174279832 AAAAAGAAGGATGGGGAGGAAGG - Intronic
917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG + Intronic
917524216 1:175773035-175773057 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
917799715 1:178559750-178559772 CACACTGATAATGAGGAGGAAGG - Intergenic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
918122124 1:181549355-181549377 CAGAGTGAGAATGAGGAAGAAGG + Intronic
918166222 1:181950294-181950316 GAAAATGAGGATGAGGATAGAGG - Intergenic
918372281 1:183872831-183872853 AAAAATGGGGAAAAGGAGGAGGG + Intronic
918849026 1:189659517-189659539 AAAAATGAGGCTGAGGAGTCTGG - Intergenic
919176734 1:194028458-194028480 AAAAAGGAGGAGGAGGAGGAGGG - Intergenic
919441658 1:197641293-197641315 AAAAATGAGGAGGAGGAGCTGGG + Intronic
919449334 1:197751867-197751889 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
919449350 1:197751936-197751958 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
919876742 1:201874867-201874889 GAAGAGGAGGAGGAGGAGGATGG + Exonic
920427711 1:205891393-205891415 CACACTGATGATGAGGAAGAAGG + Intergenic
921018873 1:211217830-211217852 CAAAATAAGGATGGAGAGGCAGG + Intergenic
921396866 1:214677825-214677847 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
921730778 1:218575717-218575739 CAAAATGAGGAGGCAGAGGTGGG - Intergenic
921835266 1:219771979-219772001 CAAAAAGAGGATTGGGAGGCCGG - Intronic
922174751 1:223188812-223188834 GAAAAGGAGGAAGAGGAAGAAGG + Intergenic
922193266 1:223338553-223338575 CACAAGGAGGATGAGCTGGAAGG + Intronic
922213258 1:223501191-223501213 GAAAAGGAGGAGGGGGAGGAGGG - Intergenic
922241005 1:223755524-223755546 GAGGATGAGGACGAGGAGGATGG + Exonic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
922990658 1:229908240-229908262 AAAAATGAGAATGAGGGGGACGG - Intergenic
923103065 1:230832658-230832680 CAAAATGAGGGGGTGGAGGGAGG + Intergenic
923460526 1:234205986-234206008 CACGCTGTGGATGAGGAGGATGG + Intronic
923603524 1:235423587-235423609 CGAGAGGAGGCTGAGGAGGAGGG + Intronic
923834168 1:237591223-237591245 CACAAAGAGGAGGAGGAGAAGGG - Intronic
924015512 1:239716822-239716844 CAAAATGAGAATGTACAGGAGGG + Intronic
924127682 1:240872676-240872698 CAAGATGTGGATGAGGCAGAAGG + Intronic
924327327 1:242908990-242909012 GAAAAGGAGGAGGAGGAGGAAGG - Intergenic
924500322 1:244631957-244631979 CCAAATGAGGCTGAGGTGGGAGG + Intronic
924608680 1:245556345-245556367 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
924765152 1:247025345-247025367 CACACTGATGATGAGGAGGAAGG + Intergenic
1062777544 10:165806-165828 TAAAATGAGGAAGAGGAGAGTGG - Intronic
1063058077 10:2524011-2524033 CAAAGCGAGGAGGGGGAGGAGGG - Intergenic
1063141083 10:3257143-3257165 GAAAATGAAGAAGAGGAGAAAGG - Intergenic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063201988 10:3792958-3792980 GAACAAGAGGAGGAGGAGGAGGG + Intergenic
1063201989 10:3792961-3792983 CAAGAGGAGGAGGAGGAGGGAGG + Intergenic
1063225759 10:4013414-4013436 CAAAGTGGGGAGGAGAAGGAAGG - Intergenic
1063235601 10:4112325-4112347 GAAAATGAGGATAAGAAGGGGGG + Intergenic
1063342383 10:5278882-5278904 CAGAATGAGAATGAGGACTATGG + Intergenic
1063438121 10:6050787-6050809 CAGGACGAGGAGGAGGAGGATGG + Intronic
1063443164 10:6089446-6089468 CATGAGGAGGAGGAGGAGGAAGG - Exonic
1063602991 10:7498810-7498832 CCAAAAGAGGAGGAGGAGGGAGG + Intergenic
1063836083 10:10014339-10014361 CAAGATGTGGATGTGGAAGATGG + Intergenic
1063885035 10:10568737-10568759 AAAAATGTGAGTGAGGAGGAGGG + Intergenic
1063897974 10:10702169-10702191 CAAAAAGAGGAGGAACAGGAAGG + Intergenic
1064496121 10:15912100-15912122 ACAAAGGAGGAGGAGGAGGAAGG + Intergenic
1064670906 10:17713068-17713090 CAAATGGAGGAGGAGGAGAATGG - Intronic
1064686504 10:17867258-17867280 GAAGAAGAGGAGGAGGAGGAAGG - Intronic
1064990488 10:21252657-21252679 AAAAATGAGGCAGAGGAGGCTGG + Intergenic
1065034612 10:21624977-21624999 CAGTAAGAGGAAGAGGAGGAAGG - Intronic
1065050534 10:21787337-21787359 AAAAAGGAGGAGGAGGAGGAAGG + Intronic
1065150816 10:22821339-22821361 CAAAATGAGGAGGAGCTTGAAGG + Intergenic
1065198768 10:23293550-23293572 TAAAATGAGGTTAAGAAGGATGG + Intronic
1065623830 10:27610681-27610703 GAAGAAGAGGAGGAGGAGGAAGG - Intergenic
1065667871 10:28082456-28082478 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1065681790 10:28242843-28242865 GAAAAGCAGGAAGAGGAGGAGGG + Intronic
1065966995 10:30778761-30778783 CAAGAGGAGGAGGAAGAGGAAGG + Intergenic
1066226882 10:33392496-33392518 GAGAATGAGGATGAGGAAGAGGG - Intergenic
1066658169 10:37713477-37713499 CCACAGGTGGATGAGGAGGAAGG + Intergenic
1066780271 10:38938142-38938164 AAAAAGGAGGAGGAGGGGGAGGG - Intergenic
1066956019 10:42173428-42173450 AAAAAGGAGGAGGAGGGGGAGGG - Intergenic
1066989125 10:42495605-42495627 CACACGGATGATGAGGAGGAAGG + Intergenic
1067203132 10:44192239-44192261 AAAAATGAAGAGGAGAAGGATGG + Intergenic
1067672784 10:48340390-48340412 CAAAAGGAGGCTGAGGGGGTAGG + Intronic
1068028181 10:51674899-51674921 AAAAAAGAGGATATGGAGGAGGG + Intronic
1068166675 10:53340295-53340317 CACACTGATGATGAGGAGGAAGG - Intergenic
1068365579 10:56045128-56045150 CACATTGAGTCTGAGGAGGATGG - Intergenic
1068698983 10:60000155-60000177 CAAAATAAGGATGTGAAGGGAGG + Intergenic
1068753986 10:60630179-60630201 CAAATTGGTAATGAGGAGGAGGG - Intronic
1068831541 10:61501415-61501437 CTAAATTAGGATGAAGAGTAGGG + Intergenic
1068846432 10:61680913-61680935 AATAAAGAGGAAGAGGAGGAAGG + Intronic
1069079337 10:64071050-64071072 CAAAAGGAGGGAGAGGAGGAGGG - Intergenic
1069491845 10:68867679-68867701 CACACTGACAATGAGGAGGAAGG - Intronic
1069577343 10:69540406-69540428 CAAGATGAAAAAGAGGAGGATGG + Intergenic
1069612112 10:69780961-69780983 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1069780839 10:70954401-70954423 GAAGATGAGGAGGAGGAGGCCGG - Intergenic
1069957094 10:72058821-72058843 AAAAATTAGGCTGAGAAGGAGGG - Intergenic
1070681537 10:78452475-78452497 CAAAATGAGGTAGAAGATGATGG + Intergenic
1070741667 10:78907463-78907485 AAGAAAGAGGAAGAGGAGGAGGG - Intergenic
1070894897 10:79975356-79975378 CACACTGATGAGGAGGAGGAAGG - Intronic
1071199885 10:83209427-83209449 CATAATGAGGGGGTGGAGGAGGG - Intergenic
1071347920 10:84710972-84710994 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1071798616 10:89032339-89032361 CAAAAAGAGGAAAAGGAGAAAGG - Intergenic
1071822333 10:89291218-89291240 AAAAATGAGGAAGAAGAGAATGG - Intronic
1071863147 10:89696806-89696828 CAAAATGTGAATGTGGAAGATGG - Intergenic
1071953864 10:90735500-90735522 CAAGAATAGGATGAGGAGGCAGG + Intergenic
1072066038 10:91872667-91872689 AAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072252336 10:93591398-93591420 CAAAATGTTGATGGGGAGGAGGG - Intronic
1072519521 10:96218775-96218797 CAGAAAGAGGAGGGGGAGGATGG - Intronic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073354465 10:102843034-102843056 GAAACTGAGGCTGAGGAGGTTGG + Intergenic
1073371663 10:102995202-102995224 AAAAAGGAGGAGGAAGAGGAAGG - Intronic
1073597832 10:104817715-104817737 AAAAAAGGGGAAGAGGAGGAGGG - Intronic
1074222614 10:111453242-111453264 CACAATGAGGATGATGATGGTGG + Intergenic
1074511710 10:114118509-114118531 CAAAAGGAACTTGAGGAGGAGGG - Intergenic
1074691141 10:116005100-116005122 GAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1074980383 10:118615015-118615037 CACACTGCTGATGAGGAGGAAGG - Intergenic
1075099182 10:119493973-119493995 CTAGATGAAGATGAGGAGCAGGG + Intergenic
1075301719 10:121330659-121330681 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1075540395 10:123307807-123307829 AAAAAGGAGGAGGAGGAGGAGGG + Intergenic
1075649444 10:124118125-124118147 CAAAATAAAGATGCAGAGGAAGG + Intergenic
1075759580 10:124845904-124845926 GAGAATGAGGATGAGGATGGCGG - Intergenic
1076100565 10:127774384-127774406 CAAAATAAGCAGGAAGAGGAAGG - Intergenic
1076172017 10:128327212-128327234 CCACCTGAGAATGAGGAGGAAGG - Intergenic
1076416243 10:130291507-130291529 CACACTAATGATGAGGAGGAAGG + Intergenic
1076442610 10:130490777-130490799 GGAGAAGAGGATGAGGAGGAGGG - Intergenic
1076559391 10:131351228-131351250 CATGATGAGGCTGGGGAGGAGGG + Intergenic
1076941684 10:133614394-133614416 GAAAATGATCATGATGAGGATGG - Intergenic
1077820651 11:5736671-5736693 CCAGATGATGATGAGGATGAGGG - Exonic
1077837792 11:5939303-5939325 TGAAATGAGGATGATGAGGCTGG + Intergenic
1077998904 11:7477024-7477046 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
1078246075 11:9574042-9574064 GAAGAAGAGGAGGAGGAGGAGGG + Exonic
1078748696 11:14139760-14139782 CATAAAGAGGATTAGGAGTAGGG + Intronic
1079079984 11:17407353-17407375 CAGGATGAGGAAGAGGAGGAAGG - Exonic
1079230179 11:18643017-18643039 GAAAAGGAGGAAGAGGAGGAGGG + Intergenic
1079250034 11:18780519-18780541 CACAAAGAGGAGGAGCAGGAAGG - Intronic
1079386858 11:19988164-19988186 AAAGAAAAGGATGAGGAGGATGG - Intronic
1079445578 11:20553722-20553744 CTCAAGGAGGAGGAGGAGGAAGG - Intergenic
1079503383 11:21127621-21127643 GAAGAGGAGGAAGAGGAGGAGGG + Intronic
1079623940 11:22592851-22592873 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1079661396 11:23041321-23041343 TAGAATGAGGATGAGGAAGTGGG - Intergenic
1079691156 11:23418975-23418997 GATGATGAGGAGGAGGAGGATGG + Intergenic
1079753895 11:24231711-24231733 CAAAAAGAAACTGAGGAGGAGGG - Intergenic
1079810956 11:24999387-24999409 GAAGATGGGGAGGAGGAGGAAGG + Intronic
1080073335 11:28115724-28115746 TAGACTGAGGAAGAGGAGGAGGG + Intronic
1080460317 11:32449202-32449224 AAAAAAGAGAAGGAGGAGGAGGG - Intergenic
1080550366 11:33369189-33369211 GAGAAAGAGGAAGAGGAGGAGGG - Intergenic
1080680752 11:34473590-34473612 AAAAATGAGGAGGAGGAGAAAGG - Intergenic
1081653917 11:44844480-44844502 CCAAGTGTGGATGAGGAGGTAGG - Intronic
1081976762 11:47240197-47240219 CACTATGAGGAGGAAGAGGATGG + Exonic
1082301248 11:50509145-50509167 CACACTAATGATGAGGAGGACGG + Intergenic
1082825266 11:57573049-57573071 AAAAATGAGGGTGAGAAGGCCGG + Intergenic
1083209343 11:61173269-61173291 CCAAATGGGCATGGGGAGGAGGG - Intergenic
1083571965 11:63765842-63765864 GAAGAAGAGGAGGAGGAGGAGGG - Exonic
1083573431 11:63772133-63772155 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1083732857 11:64662303-64662325 GAAGAGGAGGAGGAGGAGGAAGG + Intronic
1083928014 11:65820693-65820715 GAGAATGACGATGGGGAGGAGGG - Intergenic
1084145209 11:67261600-67261622 CGGGATGAGGATGAGGATGAGGG + Intergenic
1084223645 11:67700571-67700593 GAAACTGAGGTTGAGGAGGTCGG - Intergenic
1084665664 11:70574896-70574918 CAAAATGAAGAGGATGGGGAAGG - Intronic
1084905337 11:72341750-72341772 CCAAGAGAGGATGAGGATGATGG - Intronic
1085041291 11:73327971-73327993 TAAAATGGGGATGATGATGATGG + Intronic
1085270297 11:75266194-75266216 GACAAGGAGGAAGAGGAGGATGG - Exonic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085711772 11:78835578-78835600 GAAAAGGAGGATGAGGACTAGGG - Intronic
1086035413 11:82409017-82409039 CTAAATGGTGAGGAGGAGGATGG + Intergenic
1086427368 11:86699199-86699221 TAAAATGAGTAGGAGGAGGGGGG - Intergenic
1086970403 11:93074935-93074957 CAATCTGAGGATGAGAAGAAAGG - Intergenic
1086990795 11:93302144-93302166 CAAAAAACGGAGGAGGAGGAGGG + Intergenic
1087260204 11:96002598-96002620 GATGATGGGGATGAGGAGGATGG + Intronic
1087496451 11:98896022-98896044 GAAAATTTGGAGGAGGAGGAAGG + Intergenic
1088079549 11:105894641-105894663 AAAAAGGAGGAGGAGGAGGAGGG + Intronic
1088784902 11:113172399-113172421 CACAATGAGGATCAGTTGGAGGG - Intronic
1089391478 11:118104860-118104882 GGAAAGGAGGAAGAGGAGGAAGG - Intronic
1089492508 11:118892690-118892712 GAAGAGGAGGATGGGGAGGAGGG + Intronic
1089503501 11:118947229-118947251 CCAAGAGAGGATGAGGAGGAAGG + Intronic
1089643489 11:119863204-119863226 GAGAAGCAGGATGAGGAGGATGG + Intergenic
1089690250 11:120182725-120182747 GAAAAGGAGAAAGAGGAGGAGGG + Intronic
1090674303 11:128974864-128974886 GACAATGAGAGTGAGGAGGAAGG - Exonic
1090745631 11:129702690-129702712 CAAGATGAAGAGGAGGGGGACGG + Intergenic
1090794389 11:130122360-130122382 GATGATGAGGATGAGGAAGAAGG + Exonic
1091119340 11:133043648-133043670 CAAAAAATGCATGAGGAGGAAGG - Intronic
1091179084 11:133587388-133587410 GATGATGAGGATGAGGATGATGG + Intergenic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091653416 12:2326155-2326177 AAAAAGGAGGATGACGAGGGAGG + Intronic
1091882044 12:3987513-3987535 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1092112602 12:5974414-5974436 CAAAAAGAAGATGAGTAGGGAGG - Intronic
1092198656 12:6566108-6566130 AACTCTGAGGATGAGGAGGAAGG - Exonic
1092589783 12:9941836-9941858 GAGAATGAGCATGAGGAGAATGG + Intergenic
1093335410 12:17899366-17899388 CAAAATGAGGGAGAGAAAGAGGG - Intergenic
1093457072 12:19374985-19375007 GAGAAGGAGGAGGAGGAGGAAGG + Intronic
1093622769 12:21312072-21312094 GAAGAAGAGGAGGAGGAGGAAGG + Intronic
1093754953 12:22842136-22842158 GAAAAAGAGAAGGAGGAGGAGGG - Intergenic
1093754958 12:22842158-22842180 GAAAAAGAGAAGGAGGAGGAGGG - Intergenic
1093754963 12:22842180-22842202 GAAAAAGAGAAGGAGGAGGAGGG - Intergenic
1093852625 12:24059513-24059535 GAAAATGAGGTAGATGAGGAAGG + Intergenic
1094191509 12:27702865-27702887 GAAGAGGAGGATGAGGAGGAAGG + Intergenic
1094473601 12:30824703-30824725 CCAAAAGAGGATGATCAGGATGG - Intergenic
1094566923 12:31607191-31607213 CAATATGAAGATGATGAGGATGG + Intergenic
1095185931 12:39200497-39200519 CACACTGATGAGGAGGAGGAAGG - Intergenic
1095404174 12:41849442-41849464 GAAGATGAGCATGAGGAGTAGGG - Intergenic
1095546010 12:43371222-43371244 AAAAATGAGTTTTAGGAGGAGGG - Intronic
1095854170 12:46842380-46842402 CATAGTGTGGAGGAGGAGGAGGG + Intergenic
1095913018 12:47448037-47448059 CACACAGAAGATGAGGAGGAAGG - Intergenic
1096017952 12:48295672-48295694 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1096065315 12:48735024-48735046 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
1096308259 12:50498111-50498133 CACACTGATGAGGAGGAGGAAGG - Intergenic
1096621067 12:52865818-52865840 CAAAATGAGGCTGAGGATCAGGG + Intergenic
1097258094 12:57695904-57695926 TAAGAGGAGGAGGAGGAGGAGGG - Intronic
1097790658 12:63811960-63811982 GAAAAGGAAGAAGAGGAGGAAGG + Intergenic
1097938381 12:65278487-65278509 GAGAAGGAGGAGGAGGAGGACGG + Intergenic
1098005671 12:65994535-65994557 TAACCTGAGGAGGAGGAGGAGGG - Intergenic
1098011717 12:66060457-66060479 AAAGATAAGGAAGAGGAGGAGGG - Intergenic
1098504853 12:71237609-71237631 AAAAAAGAGGAGGAGGAGGGTGG - Intronic
1098725582 12:73962029-73962051 CCAAATGAGCTTGAGGAGGCTGG + Intergenic
1098948169 12:76610607-76610629 GACAAAGAGGAGGAGGAGGAGGG + Intergenic
1099211816 12:79800302-79800324 CACACTGAGGAGGAAGAGGAGGG - Intronic
1099279629 12:80627391-80627413 GAAGAGGAGGAGGAGGAGGAAGG + Intronic
1099426972 12:82535406-82535428 CAGAATGAGGATGGGGACAAGGG - Intergenic
1099871707 12:88357961-88357983 CAAAAGGAGGAAGAGGAGGAGGG - Intergenic
1099922943 12:88981639-88981661 CAAAAAGTGGATGATGAGGATGG - Intergenic
1100098926 12:91078449-91078471 GAAAAGGAGGAGGAGGAGAAGGG + Intergenic
1100260166 12:92925761-92925783 AAAAAGGAGGAGCAGGAGGAGGG + Intronic
1100727204 12:97421193-97421215 CAAAAGGATGAGGAGAAGGAAGG + Intergenic
1101147772 12:101857443-101857465 CAAGAGCAGGAGGAGGAGGAAGG - Intergenic
1101193770 12:102361759-102361781 GAAGAGGAGGAGGAGGAGGACGG + Intergenic
1101282803 12:103276843-103276865 TAGAAGGAGGATGATGAGGAGGG - Intronic
1101431165 12:104628622-104628644 CAAGATGAGGCTGAAGAGGGAGG - Intronic
1101763344 12:107677161-107677183 AAAAATGAGAATGAAGAGAAAGG + Intergenic
1101875116 12:108592342-108592364 CAACAGAAGGATGAGGAGGCTGG + Exonic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102446163 12:113004373-113004395 AAAGAGGAGGAAGAGGAGGAGGG + Intronic
1102478971 12:113207793-113207815 CAGAAAGAGGCTGAGGAGGAAGG - Exonic
1102538807 12:113603092-113603114 GAAAATGAGGAAGAGGAGGAAGG - Intergenic
1102749148 12:115277179-115277201 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102792313 12:115657774-115657796 AAGAAGGAGGATGAGGAGGAGGG - Intergenic
1102899329 12:116624143-116624165 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1103020273 12:117528442-117528464 CCAAATGAGGATGGGGAAGGGGG - Intronic
1103202639 12:119100841-119100863 AAAACTGAGGCTGAGCAGGATGG + Intronic
1103235367 12:119368150-119368172 GAAAAGAAGGAGGAGGAGGAAGG + Intronic
1103411673 12:120716630-120716652 CAGGAGGAGGATGAGGAGGAGGG + Exonic
1103412462 12:120722162-120722184 TAGAAAGAGGATGTGGAGGAAGG + Exonic
1103786402 12:123436380-123436402 CGAGAAGAGGAAGAGGAGGAGGG - Exonic
1103934713 12:124468999-124469021 ACAGATGAGGATGAGGATGATGG - Intronic
1104316218 12:127704367-127704389 GAAGAAGAGGAGGAGGAGGAAGG + Intergenic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1105710753 13:23006801-23006823 CACACTGATGATGAGGAGGAAGG + Intergenic
1106015066 13:25861544-25861566 AAAAATGGGGATGGGGTGGAAGG + Intronic
1106243033 13:27925277-27925299 AAAGAAGAGGAGGAGGAGGAAGG - Exonic
1106353946 13:28961174-28961196 GAAAATGAGGAGAAAGAGGATGG + Intronic
1106763979 13:32895412-32895434 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1107153022 13:37133623-37133645 CAAGCAGAGGATGAAGAGGAAGG + Intergenic
1107198687 13:37686794-37686816 CACACTGAGCATGAGGAGAAAGG - Intronic
1107554250 13:41503688-41503710 GAAAAGGAGGATGAAGAGGAAGG + Intergenic
1107618018 13:42192558-42192580 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1107653862 13:42572485-42572507 GAAGAAGAGGAGGAGGAGGAGGG + Intronic
1107765594 13:43730825-43730847 CGGAATGAGGGTGAGGATGAAGG - Intronic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108392068 13:49956288-49956310 AGAAAGGAGGAGGAGGAGGAAGG - Intergenic
1108586533 13:51874848-51874870 CAAATTGTGGAGGAGGAGGGAGG - Intergenic
1108770239 13:53691764-53691786 CAAAATGAGGAAGAGGCACAGGG - Intergenic
1108865671 13:54919676-54919698 CACACTGATGATGAGGAGGAAGG - Intergenic
1109733684 13:66452449-66452471 ATAAATGGGGATGAGGAAGAGGG - Intronic
1110129321 13:71987540-71987562 CAAAAGGAGGAAGAGAGGGAGGG + Intergenic
1110438182 13:75498178-75498200 CAAAAGGAGGGAGAGAAGGAGGG - Intergenic
1110614457 13:77525822-77525844 CAATTTGAAGATGAGGTGGAAGG + Intergenic
1111362787 13:87197081-87197103 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1112307835 13:98291307-98291329 CATGAAGACGATGAGGAGGAAGG - Intronic
1112311086 13:98318051-98318073 AAAAAGGAGGAGGAGAAGGAAGG - Intronic
1112672191 13:101653177-101653199 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1113258609 13:108534806-108534828 GAAGAAGAGGAGGAGGAGGAAGG - Intergenic
1113258650 13:108535097-108535119 AAAAAGGAGGAGGAGAAGGAGGG - Intergenic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1114231326 14:20785644-20785666 AAAAAGGAGGAGGAAGAGGAGGG + Intergenic
1114241796 14:20874793-20874815 CAAAAGGAGGAAAAGGAGGAGGG + Intergenic
1114248388 14:20935359-20935381 CAAAAGGAGGAAGAGGAGGAGGG + Intergenic
1114253948 14:20985824-20985846 AAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1114316465 14:21514355-21514377 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1114553418 14:23547492-23547514 CAAGAGGAAGATGTGGAGGAGGG - Intronic
1114619451 14:24086519-24086541 CAAAATGGGAATGAGGATCATGG + Intronic
1114667846 14:24391019-24391041 CAAAAAGTGGAGGAGGAGGATGG + Intergenic
1114871948 14:26669241-26669263 CAAAATAAGGGAGAGAAGGAGGG + Intergenic
1115040690 14:28922392-28922414 GAAAAGGAGAAGGAGGAGGAAGG + Intergenic
1115223324 14:31078835-31078857 CAAAAAGAAGAAGAGGAAGAGGG + Intronic
1115433565 14:33348307-33348329 AAAAATGAGGGTGAGGAGGCAGG + Intronic
1116206524 14:41874564-41874586 CATTATGAGGAAGAGGAGAAAGG - Intronic
1116238704 14:42313470-42313492 CACACTGATGATGAAGAGGAAGG - Intergenic
1116665043 14:47764153-47764175 CAATAAAAGGATGAGGAGGCCGG + Intergenic
1116701399 14:48247870-48247892 CAGGATAAGGATGAGGATGAAGG - Intergenic
1117058140 14:51933843-51933865 GAGAATGAGGATGAGGAGAAAGG + Intronic
1117082337 14:52165299-52165321 CACACTAATGATGAGGAGGAAGG + Intergenic
1117247148 14:53897442-53897464 CAAAATGAGGAGGAGAAGGGAGG + Intergenic
1117386732 14:55221925-55221947 CAAAAGGAGGAGGAGGAAGATGG - Intergenic
1117600238 14:57366666-57366688 CACACTGATGATGAGGAGGAAGG + Intergenic
1117825140 14:59694008-59694030 CAAATTGAGGTTGAGGTGAAGGG - Intronic
1117869911 14:60189473-60189495 CACAAAGAGGTTGAGGTGGAGGG - Intergenic
1117951660 14:61089331-61089353 CCACAGGAGGAGGAGGAGGAGGG - Intergenic
1118140284 14:63072850-63072872 GAGAAGGAGGATGAGGAGGAGGG - Intronic
1118336986 14:64861905-64861927 CACAATGAGGATGAAGAGCCAGG - Intronic
1118534634 14:66746949-66746971 AAAAATGAGGAAGAGGAGAGGGG + Intronic
1118701229 14:68435175-68435197 CTAGATGGGGAAGAGGAGGATGG - Intronic
1119205134 14:72788415-72788437 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1119766494 14:77192835-77192857 GAAGAAGAGGAGGAGGAGGAAGG + Intronic
1119769594 14:77212108-77212130 TAAGCTGAGGAGGAGGAGGATGG + Intronic
1119961580 14:78863834-78863856 TATAATGATGATGAGGAGGAAGG - Intronic
1120044918 14:79794843-79794865 CTATATGAGGATGAGCAGCAAGG + Intronic
1120332271 14:83108667-83108689 AAAGATGATGATGAGGAGGAAGG - Intergenic
1120448213 14:84629370-84629392 CAAAAAGAGCATGAAGAGGCTGG + Intergenic
1120992391 14:90389100-90389122 GAGAATGAGAATGAGAAGGAAGG + Intergenic
1121053393 14:90834078-90834100 CAAAAGGGAGATGTGGAGGATGG - Intergenic
1121173490 14:91873254-91873276 AAAGATGAGGAGGAGGAGGATGG + Intronic
1121461127 14:94079474-94079496 GAAGAAGAGGAGGAGGAGGAGGG - Exonic
1121735707 14:96216675-96216697 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
1121889518 14:97575985-97576007 AACAATGATGATGATGAGGATGG + Intergenic
1122065047 14:99167152-99167174 AAAAATCAGGGCGAGGAGGATGG - Intergenic
1122082438 14:99274772-99274794 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1122105054 14:99446713-99446735 AGAGATGAGGAAGAGGAGGAAGG + Intronic
1122425837 14:101604799-101604821 CAGCATGAGGATGAGGGGCAGGG + Intergenic
1202843826 14_GL000009v2_random:148705-148727 CACACTGATGATGAGGAGGAAGG - Intergenic
1202913228 14_GL000194v1_random:138949-138971 CACACTGATGATGAGGAGGAAGG - Intergenic
1202879424 14_KI270722v1_random:43736-43758 CACACTGATGATGAGGAGGAAGG + Intergenic
1123789041 15:23701255-23701277 CACACTGATGAGGAGGAGGAAGG - Intergenic
1124117513 15:26859860-26859882 AAAAATGAGGCTGAGGTGGGTGG + Intronic
1124416338 15:29475652-29475674 AGAAATGAGGAGGAGGAGGAAGG + Intronic
1124816787 15:33001709-33001731 GAAGAGGAGGAGGAGGAGGAGGG - Intronic
1124989078 15:34652901-34652923 GATAATGAGTTTGAGGAGGAAGG + Intergenic
1125203779 15:37127842-37127864 CAAAATGAGCATGAGGTCCAAGG - Intergenic
1125364212 15:38896506-38896528 AACAAAGAGGATGAGCAGGAGGG - Intergenic
1125478291 15:40062557-40062579 CAGACTTAGGCTGAGGAGGAAGG + Intergenic
1125933948 15:43618618-43618640 AGAACTGGGGATGAGGAGGAGGG - Intronic
1125947045 15:43718080-43718102 AGAACTGGGGATGAGGAGGAGGG - Intergenic
1127007071 15:54582565-54582587 CAGAATGAGGGTGAAGATGAGGG + Intronic
1127165658 15:56243398-56243420 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
1127215657 15:56820801-56820823 AAAAATGAGGAATAAGAGGAAGG - Intronic
1127279803 15:57479232-57479254 CAAGGTGAGGGTGTGGAGGATGG + Intronic
1128061930 15:64740827-64740849 CAAGGTGAGGAAGAGGAGGGAGG + Exonic
1128328641 15:66741484-66741506 TAAAATGAGGAGGAGGTGGGTGG + Intronic
1128338417 15:66803153-66803175 CAAACTCAGGATGGGGAGGCAGG - Intergenic
1128498104 15:68209729-68209751 CATGAAGAGGATGAGGAAGAAGG + Exonic
1128624138 15:69182082-69182104 AAAAGTGAGGATGAGAGGGAAGG + Intronic
1128790515 15:70430070-70430092 CAAAATGAGGATGGAGAGGGTGG - Intergenic
1128846075 15:70896426-70896448 CAAAATCAGAATGGGGAAGATGG - Intronic
1129094687 15:73192859-73192881 AAACCTGAAGATGAGGAGGAAGG + Intronic
1129153004 15:73700892-73700914 AAAAAAGAGGAGGAGGAGGAGGG - Intronic
1129406401 15:75321841-75321863 GAAGATGAGGATGAGGATGAAGG - Intergenic
1129599275 15:76988828-76988850 CAGAAACAGGATGAGGAAGAAGG - Intergenic
1129697363 15:77748253-77748275 CAAGGTGGGGAGGAGGAGGACGG - Intronic
1130092613 15:80833619-80833641 ACAAATGATGATGATGAGGAGGG - Intronic
1130226115 15:82059223-82059245 AAAAAGGAGGGGGAGGAGGAGGG - Intergenic
1130252456 15:82308780-82308802 CAACATGAAGAGGATGAGGATGG - Intergenic
1130298663 15:82664382-82664404 CAGGATGAGGATGAGGAGAAAGG - Exonic
1130335754 15:82955892-82955914 CTAATTTAGGTTGAGGAGGATGG + Intronic
1130349710 15:83080241-83080263 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1131073908 15:89483032-89483054 CAGAATGGGGATGAGGTGGTGGG - Intronic
1131263158 15:90900050-90900072 CAAAATGAGGCTGAGCACGGTGG + Intergenic
1131726580 15:95232594-95232616 GATAAGGAGGAAGAGGAGGAGGG + Intergenic
1131870305 15:96756928-96756950 GAAAAGGAGGAGGAGGAGGAGGG + Intergenic
1131901123 15:97088728-97088750 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131972309 15:97904688-97904710 GAAAGAGAGGAGGAGGAGGAGGG + Intergenic
1132014263 15:98301844-98301866 GAGGAGGAGGATGAGGAGGAGGG + Intergenic
1132053776 15:98633961-98633983 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1132314630 15:100880565-100880587 CAGAACGAGGAGGAGTAGGAAGG + Intronic
1132439302 15:101842643-101842665 TAAAATTAGGAAGAGGGGGAGGG - Intergenic
1133294091 16:4742107-4742129 CAGAGTGAGTCTGAGGAGGAGGG - Intronic
1133392761 16:5422795-5422817 AAGAAAGAGGAGGAGGAGGAGGG + Intergenic
1133413048 16:5584227-5584249 CAAAATGAAGTTGGGGAGAATGG - Intergenic
1133840172 16:9400909-9400931 CAAGACGGGGATGAAGAGGAAGG + Intergenic
1133953979 16:10423752-10423774 CACACTGATGAGGAGGAGGAAGG - Intronic
1134657622 16:15959073-15959095 GAAATGCAGGATGAGGAGGAAGG - Intronic
1134748052 16:16602967-16602989 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1134803593 16:17106915-17106937 TACTCTGAGGATGAGGAGGATGG + Exonic
1135395054 16:22124896-22124918 CAAAATGAGAATGGGGCAGAAGG + Intronic
1135724044 16:24840921-24840943 AGAAAAGAGGAGGAGGAGGAGGG + Intergenic
1135727543 16:24868814-24868836 GAAAAAGAGGAGGAGGAGGAAGG - Intronic
1135810556 16:25582873-25582895 TAAAAGGAGGCAGAGGAGGAGGG + Intergenic
1135929102 16:26721635-26721657 CAAACTCAACATGAGGAGGAGGG - Intergenic
1136058429 16:27707892-27707914 TAAAATGAGGCTGTGGGGGAGGG - Intronic
1136348698 16:29693553-29693575 TAAAATGAGGATGATGGGGCTGG - Intronic
1136637056 16:31531027-31531049 CAATATGAGGGTGAGGATAAGGG - Intergenic
1136799200 16:33055248-33055270 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
1136982939 16:35074781-35074803 CACACTGATGATGAGGAGGAAGG - Intergenic
1137395280 16:48112731-48112753 CTAAATGGGGATGATGAGGGAGG - Intronic
1137968355 16:52959102-52959124 AAAAAGGAGGAGGAGGGGGATGG - Intergenic
1138083146 16:54110886-54110908 CAAAATGAGGATCAGAGAGAAGG - Intronic
1138105448 16:54285216-54285238 GAAGAGGAGGACGAGGAGGACGG - Exonic
1138127206 16:54448537-54448559 CAAAGGGAGGATGAAGAAGACGG - Intergenic
1138153927 16:54685719-54685741 CAACAAGAGGAAGAGGAAGAGGG - Intergenic
1138176996 16:54909509-54909531 CCAAAACATGATGAGGAGGAGGG + Intergenic
1138520471 16:57568201-57568223 CACTATGACGATGAGGAGGAGGG - Intronic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1138894803 16:61190713-61190735 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1138955113 16:61962155-61962177 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1139154660 16:64426089-64426111 AAAAAGGAGGACGAGGAAGAGGG + Intergenic
1139165765 16:64563364-64563386 GAGAAGGAGGAAGAGGAGGAAGG + Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139946350 16:70644996-70645018 GAAGAAGAGGAAGAGGAGGAAGG + Intronic
1139972615 16:70785672-70785694 CTCAGTGAGGAGGAGGAGGAGGG + Intronic
1140144390 16:72291521-72291543 GAAACTGAGGATGAACAGGAAGG - Intergenic
1140467146 16:75191596-75191618 CAAAATTAGGAGCAGGGGGAGGG + Intergenic
1140468063 16:75197912-75197934 CAAAATGCGGATGCTGAGGTGGG - Intergenic
1140704609 16:77615034-77615056 AGAAAGGAGGAGGAGGAGGAAGG + Intergenic
1140870609 16:79102992-79103014 GAAGAAGAGGATGAGGAGAAAGG - Intronic
1140965000 16:79957336-79957358 TAAAAAGAGGAAGAGGAGCATGG - Intergenic
1141007121 16:80363056-80363078 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1141067524 16:80926250-80926272 CAAAAGGAGGAGGGGGAGAAGGG + Intergenic
1141115463 16:81304938-81304960 GAAAATGAGGTTGAGGAAGGAGG + Intergenic
1141350276 16:83288373-83288395 CTACATGAGGTGGAGGAGGAGGG + Intronic
1141651434 16:85395115-85395137 AAAGCTGAGGATGAGGAGGAAGG + Intergenic
1141780791 16:86159318-86159340 CAGAATGAGAATGTTGAGGATGG + Intergenic
1142062051 16:88036620-88036642 CGGAATGAGGATGAGGTGAAAGG + Intronic
1142063050 16:88043142-88043164 CATGATGAGGATGCGGCGGAGGG - Intronic
1142570713 17:872045-872067 CTAAAACAGGATGAGGAAGAAGG + Intronic
1143039078 17:4019195-4019217 CAAAATTAGGATACGGGGGATGG + Intronic
1143193781 17:5059804-5059826 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1143391491 17:6561523-6561545 GAGGATGAGGAAGAGGAGGAGGG - Intergenic
1143391558 17:6561756-6561778 GAGAAGGAGGAAGAGGAGGAGGG - Intergenic
1143430654 17:6880810-6880832 CACACTGATCATGAGGAGGAAGG - Intronic
1143615653 17:8047706-8047728 CAGAATGAGGCTGAGGAGCTGGG - Intronic
1143928786 17:10398555-10398577 CAGTATGAGGAAGAGCAGGAAGG - Exonic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1144026066 17:11276762-11276784 AAAAATGATGATGATGATGATGG - Intronic
1144235828 17:13259433-13259455 CAAGATGAGTATTAGGAGGTAGG - Intergenic
1144422347 17:15109916-15109938 CAGGATGAGGTTGAGGAGGTGGG - Intergenic
1144966305 17:19078807-19078829 CAAGAAGAGGCAGAGGAGGAGGG - Intergenic
1144981613 17:19173250-19173272 CAAGAAGAGGCAGAGGAGGAGGG + Intergenic
1144986611 17:19204989-19205011 CAAGAAGAGGCAGAGGAGGAGGG - Intergenic
1145179652 17:20735590-20735612 AAAAATGAGGTTGAGGACGTGGG + Intergenic
1145390178 17:22449533-22449555 CAAAATATGGATGAGGAGAAGGG + Intergenic
1145764924 17:27452017-27452039 CAAGATGAGGGAGAGGAGCAAGG - Intergenic
1145897238 17:28466241-28466263 CAAGCAGAGGCTGAGGAGGAAGG + Intronic
1146101887 17:29991039-29991061 CACACTGATAATGAGGAGGAAGG - Intronic
1146170795 17:30631321-30631343 CACACTGAGGATGAGGAGAGTGG + Intergenic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1146293974 17:31633804-31633826 CACACTAACGATGAGGAGGAAGG + Intergenic
1146300030 17:31680653-31680675 CAGGAGGAGGATGAGGTGGAAGG + Intergenic
1146344242 17:32047340-32047362 CACACTGAGGATGAGGAGAGTGG + Intronic
1146471732 17:33130289-33130311 GAAGATGAGGAGGGGGAGGAAGG - Intronic
1146572878 17:33968137-33968159 CAACATGGGGATGTGGAGGAAGG - Intronic
1146657683 17:34644718-34644740 CAAGCTGAGGATTAGGAGCAGGG + Intergenic
1146908629 17:36633629-36633651 GAAAAGGAGGAGGAGGAGGAAGG + Intergenic
1147121792 17:38339398-38339420 CCAGGTAAGGATGAGGAGGATGG - Exonic
1147917532 17:43897710-43897732 AAGAATGAGGAAGAGGGGGAGGG - Intronic
1147976541 17:44251213-44251235 CACAGTGAGGATGAGGACGAAGG + Exonic
1148190038 17:45672050-45672072 CAAAATGATGAAGAAGAGGGTGG - Intergenic
1148193795 17:45698895-45698917 AAGAATGAGGAGGAAGAGGAAGG + Intergenic
1148233291 17:45950483-45950505 CAAAATGAGGAAGAAGGTGAAGG + Intronic
1148539708 17:48470609-48470631 AAAAAAGAGGAGGAGGAGCAAGG - Intergenic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1148734166 17:49855462-49855484 CAAAGAGGTGATGAGGAGGAGGG + Intergenic
1148890111 17:50801065-50801087 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1148913663 17:50956870-50956892 CCCACTGAGGATGAAGAGGAGGG + Intergenic
1149301635 17:55309546-55309568 TAAACTGGTGATGAGGAGGAGGG + Intronic
1149696968 17:58623714-58623736 CACAAATAGGAGGAGGAGGAAGG + Intronic
1149696979 17:58623789-58623811 GAAGATGAAGAAGAGGAGGAGGG + Intronic
1149839367 17:59945260-59945282 AAAAATGAGGTTGAGGACGTGGG + Intronic
1149933307 17:60777819-60777841 CAAAAAGAGGATGAGGACATAGG - Intronic
1150176492 17:63062647-63062669 CAAAATGGGGAGGAGGGGGCTGG - Intronic
1150475836 17:65474001-65474023 GAAAAAGAGGAGGAAGAGGAAGG - Intergenic
1150781722 17:68128676-68128698 CACACTGAGGATGAGGAGGGAGG - Intergenic
1150857492 17:68767239-68767261 AATAATGAGGATGATGATGATGG + Intergenic
1150866108 17:68852134-68852156 TTAAATGAGGATTAGGAGAATGG - Intergenic
1151074408 17:71254656-71254678 CAAAATGAGGAGGAACAGGATGG - Intergenic
1151091338 17:71443544-71443566 CTAACTGAGGATGAAGATGAAGG - Intergenic
1151158775 17:72147057-72147079 AAGAAGGAGGAAGAGGAGGAGGG + Intergenic
1151158791 17:72147189-72147211 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1151206743 17:72513497-72513519 AAAAATGAGGCTGAGGTGGGAGG - Intergenic
1151441586 17:74132805-74132827 CAAGAAGAGAAGGAGGAGGAAGG + Intergenic
1151507190 17:74537130-74537152 CAAGAGGAGGAGGAAGAGGAAGG + Intergenic
1151860835 17:76760370-76760392 CACATTGAGAAGGAGGAGGAGGG + Intronic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152043045 17:77917423-77917445 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1152198993 17:78934307-78934329 CACACGGAGGAGGAGGAGGAAGG - Intergenic
1152787707 17:82258608-82258630 CAAAATGAGTATTAAGAAGAAGG - Intronic
1153000753 18:453353-453375 GAAAATGAGAAGGATGAGGAAGG + Intronic
1153248962 18:3101435-3101457 TAAAATGAGCATGGGGAGAATGG - Intronic
1153530903 18:6044669-6044691 GAAAAAGAGGAAGAAGAGGAGGG + Intronic
1153537829 18:6121459-6121481 CAAAATGAGAATGAGATGAAGGG + Intronic
1154031190 18:10755860-10755882 CGAATGGAGGATGAGGAGGCAGG + Intronic
1154031223 18:10755980-10756002 AAGATGGAGGATGAGGAGGAGGG + Intronic
1154031258 18:10756118-10756140 AAGATGGAGGATGAGGAGGAGGG + Intronic
1154031292 18:10756304-10756326 GAAATGGAGGATGAAGAGGAAGG + Intronic
1154031321 18:10756460-10756482 AGCTATGAGGATGAGGAGGAGGG + Intronic
1154031328 18:10756500-10756522 GAAATGGAGGATGAGGAGGAAGG + Intronic
1154031349 18:10756619-10756641 TAGATGGAGGATGAGGAGGAGGG + Intronic
1154031359 18:10756657-10756679 AGCTATGAGGATGAGGAGGAGGG + Intronic
1155163516 18:23214660-23214682 CAAAAGGAGCACAAGGAGGAAGG - Intronic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1155350036 18:24897342-24897364 AAAAAAGAGGAGGAGGAGAAGGG - Intergenic
1155566212 18:27137548-27137570 GAGAATGAGGCTGAGGAGGCAGG + Intronic
1155886903 18:31218894-31218916 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1156487500 18:37475838-37475860 AGAAATGAGTAAGAGGAGGAAGG - Intronic
1156535533 18:37861158-37861180 CCGAAGGAGGATGATGAGGAGGG - Intergenic
1156666808 18:39418494-39418516 CAAGAGGAGGATGAGGAGAGAGG + Intergenic
1157279206 18:46334558-46334580 AAAAATGGGGCTGGGGAGGAAGG - Intronic
1157472053 18:47997143-47997165 AGAAAGGAGGAGGAGGAGGAGGG - Intergenic
1157775350 18:50390682-50390704 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
1157793150 18:50550863-50550885 CAAAGTGAAGATGACAAGGATGG + Intergenic
1158209537 18:55031879-55031901 CAGAAGGAGGAGGAGAAGGAAGG - Intergenic
1158423136 18:57313545-57313567 CAGAAGGAAGAGGAGGAGGAAGG + Intergenic
1158423153 18:57313609-57313631 CAGGAGGAGGAAGAGGAGGAAGG + Intergenic
1158943358 18:62426626-62426648 GAAAATGAGAATCAGGAGGATGG - Intergenic
1159198706 18:65153785-65153807 AAGAAGGAGGAGGAGGAGGATGG - Intergenic
1159331048 18:66994379-66994401 CAAAATGGGGGTGGGGAGGAGGG - Intergenic
1159408348 18:68036029-68036051 AAAAATGAGGAAGAGAATGATGG + Intergenic
1159446844 18:68551267-68551289 AAGAAAGAGGAAGAGGAGGAAGG + Intergenic
1159638674 18:70837552-70837574 CCAAAGGAGCATGGGGAGGAAGG - Intergenic
1159833125 18:73303061-73303083 CAGGATGAGGAGGAGGATGAGGG - Intergenic
1159926998 18:74278412-74278434 TAAAATGGGGATGAGGAAGAAGG - Intronic
1160141871 18:76331422-76331444 CAAAAGCAGGATGAGGAGAGAGG + Intergenic
1160249932 18:77193648-77193670 AAAGATGATGATGAGGATGATGG - Intergenic
1160251215 18:77204887-77204909 CAACATGAGGTTGGGGGGGAAGG - Intergenic
1160265788 18:77340035-77340057 CAGCATGAGGATGAGCAGGTGGG + Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160448599 18:78946890-78946912 AAAAGGGAGGAGGAGGAGGATGG + Intergenic
1160513669 18:79466712-79466734 CCAACTGAGGAAGAGGAGGCAGG - Intronic
1160699542 19:499137-499159 CAGAATGAGGAGGGGGAGAAAGG - Intronic
1161270310 19:3386006-3386028 TATAATCAGAATGAGGAGGATGG - Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161370514 19:3908577-3908599 GAAGAGGAGGAGGAGGAGGACGG - Intronic
1161415623 19:4145135-4145157 GAAAAGGAGGAGGAGGAGGAGGG + Intergenic
1161509558 19:4662976-4662998 TAAAATGAGGACAGGGAGGAGGG - Intronic
1161509588 19:4663110-4663132 TAGAATGAGGATGAGGTGGGTGG - Intronic
1161509641 19:4663332-4663354 TAGAATGAGGATGGGGTGGATGG - Intronic
1161509762 19:4663819-4663841 CAGAATGAGGATGGGGTGGGTGG - Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161865971 19:6832474-6832496 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
1161915788 19:7226874-7226896 CAAAATTGGCAGGAGGAGGAGGG - Intronic
1161952742 19:7476933-7476955 CCAAATCAAGATGAGGAAGAGGG - Exonic
1162038196 19:7953611-7953633 GAAGAGGAGGATGGGGAGGAGGG - Intergenic
1162252166 19:9454818-9454840 CACACTGATGATGAGGAGGAAGG + Intergenic
1162558144 19:11400307-11400329 CAATATGTGGATGAGGTGGTGGG + Intronic
1162603234 19:11686611-11686633 CATGATGATGATGAGGATGATGG + Intergenic
1162642503 19:12022703-12022725 CACACTGATGAGGAGGAGGAAGG + Intronic
1162922585 19:13912376-13912398 CCGGATGAGGATGAGGAGGAGGG + Exonic
1162969576 19:14172103-14172125 AAAGAAGAGGATGAGGTGGATGG - Intronic
1163082834 19:14956074-14956096 AAAAAGGAGGAAGAGGATGAAGG + Intronic
1163213278 19:15857598-15857620 CTACAAGAGGATGTGGAGGAAGG + Intergenic
1163442391 19:17328583-17328605 GAAGAGGAGGACGAGGAGGAGGG - Exonic
1163827864 19:19533606-19533628 GAGAATGGGGAGGAGGAGGATGG - Intronic
1164032258 19:21418314-21418336 CACACTGATAATGAGGAGGAAGG - Intronic
1164234882 19:23323290-23323312 GAAGATGAGGAAGAGAAGGAGGG - Intronic
1164256833 19:23534505-23534527 CACAATAATGATGAGGAGGAAGG + Intronic
1164262048 19:23576591-23576613 CACACTGATGATGAGGAGGAAGG - Intronic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1164591891 19:29511973-29511995 GGAAAGGAGGATGAGGAGGAAGG + Intergenic
1164591899 19:29512016-29512038 GAGAGTGAGGATGAGGATGAAGG + Intergenic
1164591934 19:29512167-29512189 GAGAAAGAGGATGAAGAGGAAGG + Intergenic
1164591984 19:29512329-29512351 GAGAAGGGGGATGAGGAGGAAGG + Intergenic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164592302 19:29513522-29513544 GAAGAGGGGGATGAGGAGGAAGG + Intergenic
1164592629 19:29514575-29514597 GGAGAGGAGGATGAGGAGGAAGG + Intergenic
1164592636 19:29514596-29514618 GGAAAGGGGGATGAGGAGGAAGG + Intergenic
1164592691 19:29514807-29514829 GAGAGTGAGGATGAGGAGGAAGG + Intergenic
1165690887 19:37862382-37862404 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1165690920 19:37862544-37862566 AAGAAGGAGGAAGAGGAGGAGGG + Intergenic
1165714514 19:38035772-38035794 GATAATGAGGAGGAGGAGGATGG + Intronic
1165799332 19:38537951-38537973 CACAATAATGGTGAGGAGGAGGG + Exonic
1166008634 19:39925157-39925179 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1166093525 19:40525528-40525550 CAAAACGAGGAGGAGGAGCCCGG + Intronic
1166241690 19:41499119-41499141 AAGAATGAGGATGAAGAGGAGGG + Intergenic
1166373574 19:42315209-42315231 GAGGATGAAGATGAGGAGGAAGG - Exonic
1166915312 19:46191431-46191453 GGAAGTGAGGATGAGGATGAAGG + Intergenic
1167130514 19:47582246-47582268 CAAGGGGAGGATGAAGAGGAGGG - Intergenic
1167269447 19:48499129-48499151 GAAGAAGAGGAGGAGGAGGAGGG - Exonic
1167354267 19:48993555-48993577 CAAAGTGGGGAGGAGGAGGAGGG + Exonic
1167384025 19:49153664-49153686 GATGAGGAGGATGAGGAGGAAGG - Exonic
1167465951 19:49651233-49651255 GAAGACGAGGAGGAGGAGGAAGG + Exonic
1167806214 19:51787698-51787720 CAGAATGAAGACGAGAAGGATGG + Intronic
1167898734 19:52602161-52602183 CAGAGTGAGGGAGAGGAGGAGGG + Intronic
1167903162 19:52637398-52637420 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167904556 19:52648019-52648041 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167913847 19:52724795-52724817 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167921351 19:52785791-52785813 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167925858 19:52820649-52820671 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167930044 19:52856638-52856660 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167934179 19:52892870-52892892 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167937855 19:52922427-52922449 GAGAATGAGGGAGAGGAGGAGGG - Intergenic
1167940355 19:52941693-52941715 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167946372 19:52992360-52992382 CAGAGTGAGGGAGAGGAGGAGGG - Intergenic
1167995211 19:53396116-53396138 CAGAGTGAGGGAGAGGAGGAGGG + Intronic
1168510138 19:56967299-56967321 GAAAATGAGGAGGAGGGGAAGGG - Intergenic
1168510199 19:56967523-56967545 AAAGAGGAGGATGAGGAGGGAGG - Intergenic
1168664265 19:58191436-58191458 CAAAAGGAAGATCAGGAGGCTGG - Intronic
1202655042 1_KI270708v1_random:12745-12767 CACACTGATAATGAGGAGGAAGG + Intergenic
925232048 2:2242046-2242068 GAAAAGGAGAAGGAGGAGGAAGG + Intronic
925422081 2:3720482-3720504 CAAGATGAGGAGGAGGTCGAAGG + Intronic
925439903 2:3876516-3876538 GAGAGTGAGGGTGAGGAGGATGG + Intergenic
925496218 2:4452473-4452495 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
925899556 2:8498871-8498893 CAAAATGAGGATGAGGATGGAGG + Intergenic
926217223 2:10912989-10913011 CGAGACGAGGATGAGCAGGAAGG - Exonic
926559756 2:14403049-14403071 CAGCCTGAGGATGAGGAAGAAGG + Intergenic
926582917 2:14651048-14651070 TATGATGAGGATGAGCAGGATGG - Intergenic
926679934 2:15655308-15655330 CAAAGTCAGGTTGAGGAGGTTGG - Intergenic
927117929 2:19923455-19923477 CACACTGATGATGAGGAGGAAGG + Intronic
927135020 2:20090757-20090779 CGAAGTGTGGAGGAGGAGGAGGG - Intergenic
927191360 2:20519304-20519326 GAAAGTGAGGAAGAGGAGAATGG + Intergenic
927426068 2:22982604-22982626 AAAAATGAGGTTGGAGAGGAAGG - Intergenic
927572931 2:24175428-24175450 TAAACTGAGGCTGAGGAAGACGG - Intronic
927924845 2:27004405-27004427 GAAAATGAGGGGGAGGAGGAAGG - Intronic
928046009 2:27932937-27932959 CAACAGGAAGATGAAGAGGAAGG - Intronic
928056278 2:28058407-28058429 TAAAATGATGGAGAGGAGGAAGG + Intronic
928357203 2:30629270-30629292 CAAAATGAGGCTGAGCATGGTGG + Intronic
928546979 2:32337459-32337481 CAAGATGAGGTTCAGGAGGAGGG - Intergenic
928703077 2:33918795-33918817 CACACTGATAATGAGGAGGAAGG - Intergenic
929283741 2:40112668-40112690 AAAAATAAGGATGGGAAGGATGG + Intronic
929429542 2:41875436-41875458 CAAAATGTGACTGAGCAGGAGGG - Intergenic
929437412 2:41939191-41939213 GATGATGAGGAAGAGGAGGAGGG - Intronic
929739026 2:44583504-44583526 TAAAATGAGGCTGAGGACCATGG + Intronic
929778906 2:44944826-44944848 GAAGAGGAGGAAGAGGAGGAGGG - Exonic
929859070 2:45660253-45660275 AGAAGTGAGGAGGAGGAGGAAGG + Intronic
930140561 2:47947571-47947593 CAAGATGAGGATGTTGAGGATGG + Intergenic
930183186 2:48385236-48385258 CACACTGATGATGAGGAGGAAGG + Intergenic
930615226 2:53586832-53586854 CACAGTGAGGAAGAGGAGGAAGG + Intronic
930660128 2:54044955-54044977 CTAAATGACGATGAGGAAGCAGG - Intronic
930691773 2:54372308-54372330 GAAGATGAGGCTAAGGAGGAAGG - Intronic
930707198 2:54516282-54516304 CAAAAGGTTGCTGAGGAGGATGG + Intronic
930715279 2:54588190-54588212 TAAAAGGAGGAGGAAGAGGAAGG - Intronic
930807564 2:55506635-55506657 CCATATGAGGCTGAGGAGGAAGG - Intergenic
931513152 2:63022297-63022319 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
931690695 2:64832429-64832451 CAAAGGGAGGATTAGGAGCAAGG + Intergenic
931902756 2:66807544-66807566 AAAGAAGAGGAGGAGGAGGAGGG + Intergenic
931992766 2:67807740-67807762 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
932552975 2:72790941-72790963 CAGAATGGGGAAGGGGAGGATGG + Intronic
932614922 2:73225878-73225900 GAAGAGGAGGAGGAGGAGGAAGG + Exonic
932686710 2:73876598-73876620 CAAGATGAGGATAGGGAGGCTGG + Intergenic
932778342 2:74542919-74542941 AAAAATGAGTAAGAGGAGGCTGG - Intronic
932941731 2:76174737-76174759 CAAAATGAACAGGAGTAGGAAGG - Intergenic
933014408 2:77105996-77106018 CAAGATGAGGAATAGGAAGAAGG - Intronic
933197385 2:79407605-79407627 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
933275180 2:80276678-80276700 GAAGAAGAGGAGGAGGAGGAGGG + Intronic
933483579 2:82889112-82889134 AAAAATGAGGATTAGAAGGTTGG - Intergenic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
934653205 2:96104077-96104099 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
934739253 2:96707343-96707365 GAAAAAGACGATGAGGAAGAGGG + Exonic
934845003 2:97656889-97656911 AAAAAGGAGTATGAAGAGGATGG - Exonic
935026027 2:99277874-99277896 CACACTGATGATGAGGAGGAAGG - Intronic
935151222 2:100438360-100438382 CAATAAAAGGATGAGGTGGAAGG - Intergenic
936008674 2:108910978-108911000 GAACATGATGATGAGGACGATGG + Exonic
937092725 2:119217269-119217291 GAAAAGGAGAAAGAGGAGGAGGG + Intergenic
937268779 2:120633784-120633806 CAAAATGGTGATGAGGAGAGGGG + Intergenic
937546929 2:123033767-123033789 CATAAAGAGGAAGAGGTGGAAGG + Intergenic
937969403 2:127537687-127537709 GAAGAAGAGGAGGAGGAGGAGGG + Intronic
938042787 2:128090180-128090202 CAACATGATGAAGGGGAGGAAGG - Intergenic
938324774 2:130391094-130391116 GAAAATGGGGATGAGAAGAAGGG - Intergenic
938453287 2:131442774-131442796 GATAAAGAGGACGAGGAGGAGGG - Intergenic
938518674 2:132042416-132042438 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic
938736594 2:134191669-134191691 GAGAAAGAGGAGGAGGAGGAGGG - Intronic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939291309 2:140198894-140198916 TAAAAGGAGGATGAGGAGAAGGG + Intergenic
939966950 2:148619636-148619658 AAAAAGGAGGAGGAGGAGGGAGG - Intergenic
940301536 2:152180717-152180739 CACGCTGATGATGAGGAGGAAGG - Intergenic
940334816 2:152514943-152514965 CATCATGAGGGTGATGAGGATGG - Intronic
941494542 2:166183415-166183437 AAAAAGGAGGAGGAGGAGAATGG - Intergenic
941515522 2:166471130-166471152 GAGGATGAGGATGAGGATGATGG + Intronic
941999571 2:171632463-171632485 CAGAATGAGAATCAGAAGGAAGG + Intergenic
942572042 2:177324509-177324531 CAAAATGAAGAGGAGGGGGTGGG - Intronic
942626182 2:177903083-177903105 TAAAATGAGGACGTGGAGGCAGG - Intronic
942800729 2:179872586-179872608 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
942909417 2:181224974-181224996 CAAAACAAGGATGGTGAGGAAGG - Intergenic
943062477 2:183053035-183053057 CACACTGATGATGAGGAGGAAGG - Intergenic
943278237 2:185896710-185896732 GAAGAAGAGGAAGAGGAGGAGGG + Intergenic
943800892 2:192056398-192056420 GAAGAAGAGGAAGAGGAGGAGGG + Intronic
944084611 2:195830788-195830810 CAAAATGAGGATTTAGAAGATGG - Intronic
944205448 2:197153283-197153305 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
944704008 2:202270791-202270813 AAAAATGAAAATGAGGAGGCTGG + Intronic
945385881 2:209200612-209200634 CAAAATGAGGCTGAAGGGAAGGG - Intergenic
945680019 2:212902825-212902847 AAAAAGGAGGAGGAGAAGGAAGG - Intergenic
946085100 2:217162915-217162937 CAAGATGAGGATCAGCAGGCAGG - Intergenic
946089403 2:217207598-217207620 CAAAATGAGCACGAGGATGACGG - Intergenic
946206545 2:218112962-218112984 CACACTGATGATGAGGAGGAAGG + Intergenic
946429787 2:219619172-219619194 GAAGATGAGGATGAGGAGGAAGG + Intergenic
946433717 2:219638821-219638843 CAGGATGAGGACGAGGAGGGCGG - Exonic
946535224 2:220620289-220620311 CAAAATGAAGATGTGAAGCAGGG - Intergenic
946693239 2:222325762-222325784 CAAAGGGAGGCTGAGGAGGGAGG + Intergenic
946694631 2:222342299-222342321 GAAAAGGAGGAGGAAGAGGAGGG - Intergenic
946724108 2:222644378-222644400 GAGAATGAAGAGGAGGAGGAAGG + Intronic
946888180 2:224245897-224245919 GAGAATGAGGATGAGGATGAGGG - Intergenic
946899107 2:224355316-224355338 GAACAAGAGGAGGAGGAGGAGGG - Intergenic
946945754 2:224820359-224820381 CAAAGTGTGGAGCAGGAGGAAGG + Intronic
947220718 2:227789479-227789501 GAAAGAGAGGAGGAGGAGGAAGG - Intergenic
947458847 2:230284371-230284393 CAGAATGAGAATGAGAAGGCAGG + Exonic
947636945 2:231684981-231685003 CACAGCGAGGAGGAGGAGGATGG + Intergenic
947951185 2:234148715-234148737 CCAAATGAGCATGTTGAGGAAGG - Intergenic
948258158 2:236583620-236583642 CAAAATGGGGAGGGGGAGGAGGG + Intergenic
948341680 2:237257787-237257809 TAAAATGGGGATGTGGAGGGTGG - Intergenic
948558554 2:238835228-238835250 GAAGAAGAGGAGGAGGAGGAGGG - Intergenic
948606778 2:239140929-239140951 CACAGTGAGGAGGATGAGGAGGG + Intronic
948617017 2:239205684-239205706 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
948720566 2:239897679-239897701 GAAGAAGAGGAGGAGGAGGAGGG - Intronic
948875541 2:240825370-240825392 GGAAAGGAGGAAGAGGAGGAGGG - Intergenic
948928884 2:241117500-241117522 TAAAATGAGTGTCAGGAGGAGGG + Intronic
948939284 2:241188031-241188053 GAGAATGAGGACGAGGAGGAGGG + Intergenic
1168888504 20:1277043-1277065 CAAAATCAGGCCCAGGAGGAAGG + Intronic
1168912251 20:1458206-1458228 GAAGATGAGGAGGAAGAGGAAGG - Exonic
1168989184 20:2079689-2079711 AGAAATGAGGATGGTGAGGAAGG - Intergenic
1169214347 20:3784877-3784899 GACGATGATGATGAGGAGGATGG - Exonic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169403534 20:5303941-5303963 CACACTGATGATGAGGAGGAAGG + Intronic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169554594 20:6735950-6735972 GAAAATGAGAGAGAGGAGGAAGG - Intergenic
1169734812 20:8826000-8826022 CAAACTGGGAATGAGGGGGAGGG + Intronic
1169954354 20:11084682-11084704 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1170006457 20:11675132-11675154 CACTCTGAGGAGGAGGAGGAAGG - Intergenic
1170024268 20:11872005-11872027 AAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1170058150 20:12229827-12229849 GAGATTGAGGATGAGGAGGGAGG - Intergenic
1170158570 20:13290257-13290279 CAATATGAGGAGGAGGAAGAGGG + Intronic
1170779626 20:19412611-19412633 CAAGAGGAGGAGGAGGAGGAGGG + Intronic
1170809721 20:19664484-19664506 CAAAATGAGGATGAGGAGGAAGG - Intronic
1171295770 20:24015470-24015492 AAAAATGAGAATGCGAAGGAAGG - Intergenic
1172043035 20:32059460-32059482 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1172091363 20:32435101-32435123 GAAAGTGATGATGAGGAGCAAGG + Exonic
1172437327 20:34938621-34938643 CAAAAAGAGGCGGAGGAGGAAGG + Intronic
1172442609 20:34976741-34976763 CAGAAAGAGGATGGGGAGGGAGG + Intronic
1172599108 20:36171477-36171499 TAGAAGGAAGATGAGGAGGAAGG - Intronic
1172815820 20:37685137-37685159 GAAGAAGAGGAGGAGGAGGAAGG + Intergenic
1172823703 20:37761835-37761857 CAAAATGATCAAGAGCAGGATGG + Intronic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1173000696 20:39103388-39103410 GATGATGAGGATGAGGATGATGG + Intergenic
1173630434 20:44509979-44510001 CTGAATGAGGATGAAGAGGGCGG + Exonic
1173636891 20:44567518-44567540 CAAGATGAGTATGAGGATAAAGG - Intronic
1174091329 20:48050817-48050839 CAACATGAAGATGACAAGGATGG - Intergenic
1174094961 20:48081010-48081032 CAGGCTGAGGATGAGGAGAAGGG + Intergenic
1174808256 20:53623534-53623556 CAGCACGAGGAGGAGGAGGAGGG - Intergenic
1175164424 20:57033238-57033260 CAAAATTGGGATGAGGAGGTGGG + Intergenic
1175226154 20:57445070-57445092 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1175267422 20:57710735-57710757 CAAAAGGGGTATGAGCAGGAGGG + Intronic
1175341842 20:58236915-58236937 CTAAATGGGGATGGGGAGAAGGG + Intergenic
1175579895 20:60090272-60090294 CAAGAAGAGGAGGAGGATGAAGG - Intergenic
1175770841 20:61623138-61623160 CCAGATGAGGATGTGGAGGTGGG + Intronic
1175996101 20:62812974-62812996 CAAGGTGAGGAAGCGGAGGAAGG + Exonic
1176362063 21:6006180-6006202 CAAAAGGAGGAGGAGGAGGGGGG + Intergenic
1176632578 21:9153619-9153641 CACACTGATGATGAGGAGGAAGG - Intergenic
1176640728 21:9301200-9301222 CACACTGATAATGAGGAGGAAGG + Intergenic
1177201783 21:17965439-17965461 GAAGAGGAGGAGGAGGAGGATGG - Intronic
1177482815 21:21713964-21713986 GGTAATGAGGATGATGAGGATGG + Intergenic
1177618515 21:23556520-23556542 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1177758325 21:25373733-25373755 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1177817270 21:25991157-25991179 CAGAATGAGGAAGAGTGGGAAGG + Intronic
1177913713 21:27061761-27061783 TAAAAGGGGGATGAAGAGGAAGG - Intergenic
1178213149 21:30560665-30560687 AAGAATGACGAGGAGGAGGAGGG + Intronic
1178692726 21:34763127-34763149 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1178694018 21:34777641-34777663 CAAAGTGAGTATCAGGAGGTGGG + Intergenic
1178719559 21:34996283-34996305 CTAAGAGGGGATGAGGAGGAGGG + Intronic
1178857374 21:36261608-36261630 GAAAATGAGGGTGAGGTGGCTGG + Intronic
1179189651 21:39112823-39112845 GAAAAGGAGGAGAAGGAGGATGG + Intergenic
1179215810 21:39366402-39366424 AAAAATGAGGCTGAGTATGATGG - Intergenic
1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG + Intronic
1179436916 21:41368635-41368657 GAAAATGAGGGTGAGGGTGAGGG + Intronic
1179566006 21:42249632-42249654 CAAAATGATGATGCTGATGATGG - Intronic
1179761455 21:43532365-43532387 CAAAAGGAGGAGGAGGAGGGGGG - Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180349752 22:11790583-11790605 CACACTGATAATGAGGAGGAAGG + Intergenic
1180374038 22:12074033-12074055 CACACTGATGATGAGGAGAAAGG + Intergenic
1180388452 22:12201656-12201678 CACACTGATAATGAGGAGGAAGG - Intergenic
1180433749 22:15280160-15280182 CAAAAAGAGGATGCCTAGGATGG - Intergenic
1180516304 22:16148069-16148091 CGAAAAGAGGATGACTAGGATGG - Intergenic
1180534273 22:16383077-16383099 AAAAAGGAGGAGGAGGGGGAGGG - Intergenic
1181886087 22:26023514-26023536 CAGGAGGAGGAAGAGGAGGAGGG - Intronic
1181887209 22:26030797-26030819 CCAAGTGAAGAGGAGGAGGAAGG - Exonic
1181931335 22:26403936-26403958 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182259064 22:29059810-29059832 AAAAATAAGGGTGAGAAGGAAGG - Intronic
1182420510 22:30246424-30246446 GAAGAAGAGGAGGAGGAGGAAGG + Intronic
1182561908 22:31166606-31166628 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1182897869 22:33873756-33873778 GGAAAGGAGGAGGAGGAGGAAGG - Intronic
1182942357 22:34288949-34288971 AAAGAGGAGGAAGAGGAGGAAGG - Intergenic
1183021704 22:35032762-35032784 GAAGAAGAGGAAGAGGAGGACGG + Intergenic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183342094 22:37287069-37287091 CAGGAAGAGGATGGGGAGGAGGG + Intronic
1183357312 22:37366699-37366721 CCAAGGGAGGAGGAGGAGGACGG - Intergenic
1183487228 22:38095260-38095282 CAAAACCAGGAAGTGGAGGATGG + Intronic
1183494337 22:38133869-38133891 CAAGATGATGATGATGATGATGG - Intronic
1184237212 22:43189313-43189335 CAAAGTGAGCATGGGGAGAAAGG - Intergenic
1184902787 22:47457914-47457936 GAAAAGCAGGAGGAGGAGGAAGG + Intergenic
1184927411 22:47652933-47652955 CAAAAAGAGCATGAAGAAGATGG + Intergenic
1185078506 22:48696177-48696199 CACACTGAGGCTGGGGAGGAAGG + Intronic
1203315370 22_KI270737v1_random:2719-2741 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic
949250100 3:1973200-1973222 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
949355763 3:3179346-3179368 CACAAGGAGGATGGAGAGGATGG + Intronic
949475350 3:4439935-4439957 CAAAATGATGCTGAGCAGGCTGG + Intronic
949758638 3:7443030-7443052 AAAGAGGAGGAGGAGGAGGATGG - Intronic
949828812 3:8191807-8191829 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
950013416 3:9739801-9739823 GAAGATGAGGAGGAGGATGAGGG + Exonic
950130054 3:10536466-10536488 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
950335138 3:12187452-12187474 GAAGAGGAGGAAGAGGAGGAAGG - Exonic
950723778 3:14902655-14902677 CAAAATGAGGAGGGGCAGGGAGG - Intronic
950891916 3:16411729-16411751 AAAAATCAGGATGAGGGAGAGGG + Intronic
951023016 3:17800823-17800845 CAAGATGAGAATGGAGAGGAAGG - Intronic
951266438 3:20573451-20573473 GAAAAAAAGGATGAGGAGCATGG + Intergenic
951270677 3:20619758-20619780 CACACTGATGATGAGGAGGAAGG - Intergenic
951276797 3:20697363-20697385 ACAAAGGAAGATGAGGAGGAGGG + Intergenic
951702666 3:25511800-25511822 CAACTTGAGGATGGGAAGGAGGG + Intronic
951807529 3:26662909-26662931 CAAATGGAGGATGAGGAAGGAGG + Intronic
952056821 3:29457242-29457264 CAAAGGAAGGATGAGGAGAAAGG - Intronic
952557483 3:34549402-34549424 CAAAATGAGGATAACGATTATGG + Intergenic
953374306 3:42415829-42415851 GGAAAGGAGGAGGAGGAGGAAGG + Intergenic
953592216 3:44269364-44269386 GAAAGTGAGGAAGAGGAGGGAGG - Intronic
954055681 3:48022318-48022340 CAAAAAGAAGATGATGAGGTGGG + Intronic
954130578 3:48558712-48558734 CAAAAGGAGGATGAGGAAGGAGG - Intronic
954231307 3:49219844-49219866 CATACTAATGATGAGGAGGAAGG + Intronic
954887806 3:53891893-53891915 CAAAATGCTGACGAGGACGAAGG + Exonic
955087826 3:55720104-55720126 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955333980 3:58069969-58069991 GAAAATGAGGATGGAGGGGAGGG + Intronic
955833638 3:63030420-63030442 CAAGAAGAGGAGGAAGAGGAAGG + Intergenic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
956013576 3:64857743-64857765 CAAAATGTGCATGGGGTGGAAGG + Intergenic
956198802 3:66683937-66683959 AAAAAGGAGGAGGAGGAGGGAGG - Intergenic
956198828 3:66684102-66684124 GAAGAAGAGGAGGAGGAGGAAGG - Intergenic
956212623 3:66817301-66817323 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
956989308 3:74745077-74745099 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
957099432 3:75809415-75809437 CACACTGATGATGAGGAGGAAGG - Intergenic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
957748297 3:84374674-84374696 GAAAAAGAGGAAGAGAAGGATGG + Intergenic
958157765 3:89776246-89776268 AAGAAAGAGGAGGAGGAGGAGGG - Intergenic
958796819 3:98714826-98714848 CAAAATAAGGATGAGATGAAGGG + Intergenic
959155871 3:102665379-102665401 AAAGAAGAGAATGAGGAGGAAGG - Intergenic
959197904 3:103209642-103209664 CACACTAATGATGAGGAGGAAGG + Intergenic
959431811 3:106263342-106263364 CAAGATGAGACTGAAGAGGAAGG - Intergenic
959520983 3:107322727-107322749 GAAATTGAGGATGAGGAACATGG - Intergenic
960051634 3:113244366-113244388 CAAAATTTGGATGAGGAATAAGG + Intronic
960529920 3:118753007-118753029 GAAAATGAGGAGAAGGAGAAAGG + Intergenic
960598666 3:119432870-119432892 CAAAGACAGGATAAGGAGGAAGG + Intronic
960664026 3:120093466-120093488 CAAAAGGAAGAAAAGGAGGAAGG - Exonic
960788357 3:121399150-121399172 CACACTGATGAGGAGGAGGAAGG - Intronic
960836439 3:121911459-121911481 TAAATGGAGGAGGAGGAGGAGGG - Intronic
961236945 3:125375261-125375283 GAAGAGGAGGAGGAGGAGGAGGG - Exonic
961323225 3:126092805-126092827 CACACTGATGATGAGGAAGAAGG + Intronic
961372389 3:126439656-126439678 CACAGTGAGGAAGGGGAGGAAGG + Exonic
962054411 3:131854796-131854818 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
962295446 3:134179986-134180008 GAAAAGGAGGATGAAGGGGAAGG + Intronic
962625586 3:137222653-137222675 TAAAATGAGTACAAGGAGGAAGG - Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
962897281 3:139727419-139727441 CGACATGAGAATGAGGATGATGG + Intergenic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
962989591 3:140566152-140566174 GAAGAGGAGGAGGAGGAGGAAGG + Exonic
963003973 3:140708772-140708794 AAGAGAGAGGATGAGGAGGAAGG + Intergenic
963600949 3:147378431-147378453 AAAGAGGAGGAGGAGGAGGATGG + Intergenic
963657786 3:148080390-148080412 AAAAATGAGGATGAAGGGGAGGG + Intergenic
963995327 3:151701982-151702004 CACACTGTTGATGAGGAGGAAGG + Intergenic
964081420 3:152763226-152763248 TAAAATGAGGAAGAGGAATATGG - Intergenic
964352226 3:155814655-155814677 CAAAAAGAGGATAAGGAATATGG + Intergenic
964400782 3:156296357-156296379 CAATTTCAGAATGAGGAGGAGGG - Intronic
964445442 3:156752780-156752802 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964568135 3:158080875-158080897 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964568155 3:158081025-158081047 TGAAGTGAGGATGAGGAGAAGGG + Intergenic
964667620 3:159191305-159191327 GAAGATGAGGAGGAGGAGGCTGG + Intronic
964736183 3:159920974-159920996 CAAAAATAGAAGGAGGAGGAAGG + Intergenic
965099298 3:164276532-164276554 CAAAATGAGGCAGAGCAAGATGG + Intergenic
965172176 3:165279900-165279922 GAAGAAGAGGAGGAGGAGGAAGG - Intergenic
965315307 3:167183204-167183226 CACACTGATGATGAGGAGGAAGG - Intergenic
965598222 3:170428622-170428644 AAAAATGAGAAGGAGGAGAAGGG - Intronic
965680189 3:171242314-171242336 GAAAATGAGGAAGAGGAGGAAGG - Intronic
966026214 3:175286288-175286310 AAAAAGGAGGAGGAGGAGGCTGG + Intronic
966087355 3:176084736-176084758 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
966104454 3:176319530-176319552 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
966554353 3:181242598-181242620 CAAATGGAGGAAGAGGAGGAGGG - Intergenic
966978299 3:185105909-185105931 CACACTGATGATGAGGAGGAAGG + Intronic
967852668 3:194093908-194093930 GGAAATGAGGCTGAGAAGGAAGG + Intergenic
968078175 3:195828304-195828326 CCAACTGAGGAGGAGGAGGAGGG + Intergenic
968329561 3:197855003-197855025 CAAAATGAGTATAAGATGGAAGG + Intronic
1202746165 3_GL000221v1_random:103824-103846 CACACTGATAATGAGGAGGAAGG - Intergenic
968742990 4:2340698-2340720 GAAACTGAGGCTGGGGAGGAGGG + Intronic
968757092 4:2422463-2422485 CAAATCGAGGAGGAGGAAGAGGG - Intronic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
969628525 4:8321365-8321387 AATAATGAGGATGAGGGTGATGG - Intergenic
969668284 4:8574922-8574944 CAACAGGAGGCTGAGGAGGTAGG - Intronic
969838267 4:9861008-9861030 CAAAATGAGGAGGAGAATGATGG - Intronic
970110792 4:12635893-12635915 CAAGATGAGGTTGAAGTGGAAGG + Intergenic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970329029 4:14959912-14959934 AAAAATTAGGATAAGGATGAAGG + Intergenic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970873973 4:20848283-20848305 AAAATAGAGGAAGAGGAGGATGG + Intronic
971769858 4:30882194-30882216 TAAAAGGAAGAGGAGGAGGAAGG - Intronic
971982949 4:33778352-33778374 AAAGATGAGGAAGAGGAAGAGGG + Intergenic
972080204 4:35140449-35140471 CACACTGATAATGAGGAGGAAGG + Intergenic
972633987 4:40866484-40866506 CAAAGTGAGGAGGAAGAGGGAGG - Intronic
973156484 4:46961335-46961357 CGGGAGGAGGATGAGGAGGATGG - Intronic
973330313 4:48905964-48905986 TAGGATGAGGATGAGGATGAGGG + Intronic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
974704531 4:65495017-65495039 GAAGAAGAGGAAGAGGAGGAAGG + Intronic
974760535 4:66267833-66267855 CAAAAAGAAGAGGAGGAGAATGG + Intergenic
974828674 4:67162204-67162226 CTAGATGAGGTTGAAGAGGAGGG - Intergenic
974928852 4:68337299-68337321 AACACTGAGAATGAGGAGGAAGG - Exonic
974998554 4:69193345-69193367 CAAACTGAGGTTGAGGAGGTCGG - Intronic
975238021 4:72023605-72023627 AAAAATGAGGATGAGGGCCAGGG - Intergenic
975245614 4:72117297-72117319 AAAAATGAGGATAATTAGGAAGG - Intronic
975360280 4:73461072-73461094 GAAGAAGAGGAAGAGGAGGAAGG - Intergenic
975383972 4:73733674-73733696 CAAAAGGAGGCTGAAGAGAAGGG - Intergenic
975388524 4:73788134-73788156 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
975684445 4:76905731-76905753 CCAAGTGAAGATGGGGAGGAGGG + Intergenic
975875542 4:78831884-78831906 AGAAAAGAGGATGAAGAGGAGGG - Intronic
975991948 4:80266835-80266857 GAAGAAGAGGAGGAGGAGGAAGG - Exonic
976106930 4:81629207-81629229 GAAAAAGAAGAAGAGGAGGAGGG - Intronic
976172064 4:82314569-82314591 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
976269774 4:83219155-83219177 GAAAAGGAGGAGGAGGAGGAGGG - Intergenic
976332517 4:83849133-83849155 CAAGATGAGAGTGAGGAGGAGGG + Intergenic
976502138 4:85803496-85803518 CAAAATGAGCATCATGATGAAGG - Intronic
976557020 4:86461610-86461632 CACACTGATGATGAGGAGGAAGG + Intronic
976633883 4:87267784-87267806 GAAAAGGAAGAAGAGGAGGAAGG + Intergenic
976977880 4:91186297-91186319 CACACTGATGAGGAGGAGGAAGG - Intronic
977443722 4:97101908-97101930 CACACTAATGATGAGGAGGAAGG - Intergenic
977503799 4:97877542-97877564 GAAAATGAGGATGAAGTGAAAGG + Intronic
977641989 4:99367758-99367780 CACACTGATGATGAGGAGGAAGG + Intergenic
977666977 4:99653632-99653654 GAAAAGGAGGAGGGGGAGGAGGG - Exonic
977731095 4:100352919-100352941 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
978362041 4:107940780-107940802 CTAAAGGAAGATGAGAAGGAAGG + Intronic
978466787 4:109016837-109016859 CAACTGGAGGATGAGCAGGATGG - Intronic
978514134 4:109553337-109553359 GATAATGAGGAGGAGGAGGAAGG - Intergenic
978725473 4:111964359-111964381 AAAAATTAGGACTAGGAGGATGG + Intergenic
978816095 4:112907496-112907518 TGAAAGTAGGATGAGGAGGAGGG - Intronic
978935609 4:114371416-114371438 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
979000912 4:115217806-115217828 TAAAATGAGTAGGAGGAAGAAGG + Intergenic
979324520 4:119363042-119363064 CAAAAGGAAGATGAGGAAGAAGG + Intergenic
979721181 4:123902170-123902192 CATCCTGAGGATGAGGAGGGAGG + Intergenic
979893581 4:126131445-126131467 CACACTGATGATGAGGAGGAAGG + Intergenic
979982766 4:127276759-127276781 CACACTAATGATGAGGAGGAAGG - Intergenic
980129314 4:128803603-128803625 CCAGGTGAGGAGGAGGAGGATGG - Intergenic
980647107 4:135655912-135655934 TTAAATGAAGATGAGAAGGAAGG + Intergenic
980667687 4:135960314-135960336 CACACTGATGATGAGGAGGAAGG - Intergenic
980736619 4:136898694-136898716 CAAAATTAGGCTGAGTAGAAAGG + Intergenic
980792345 4:137635599-137635621 AAAAAGGAGGAAGAGGAGGAGGG + Intergenic
981085633 4:140680598-140680620 GAAAATGAAGATGAGGCGGGAGG - Intronic
981197744 4:141940893-141940915 CATACTGATGAGGAGGAGGAAGG - Intergenic
981254402 4:142644303-142644325 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
981695892 4:147558411-147558433 GAAAAGCAGGAGGAGGAGGAGGG + Intergenic
981732162 4:147911002-147911024 AAAAGGGAGGAAGAGGAGGAGGG - Intronic
982234980 4:153243790-153243812 AAAAAGGAGGGGGAGGAGGAAGG - Intronic
982282064 4:153693702-153693724 CACACTAAAGATGAGGAGGAAGG - Intergenic
982350773 4:154412982-154413004 GAAAAGGAAGAGGAGGAGGAAGG + Intronic
982438028 4:155400051-155400073 CAAGATGAGGGAGAGGAGCAAGG - Intergenic
982723082 4:158879421-158879443 CAGAGTGAGGATGAGAAGCAGGG + Intronic
982745948 4:159103867-159103889 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
982757481 4:159239694-159239716 CAAAAATAAGATGAGGTGGAAGG + Intronic
982816055 4:159886206-159886228 CAAAATGAGGTTAAGGAAGCAGG - Intergenic
982954529 4:161746808-161746830 AAAAAAGAGGCTTAGGAGGAAGG - Intronic
983242357 4:165247739-165247761 CAAAAGGAAGATGAGGAAGAGGG + Intronic
983907742 4:173202449-173202471 CGAAATGGGGAGGAGGAGGAGGG + Intronic
984169641 4:176344443-176344465 CACACTGATGATGAGGAGAAAGG + Intergenic
985011638 4:185588606-185588628 AACAAGGAGGAGGAGGAGGAGGG - Intronic
985085884 4:186312025-186312047 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
985294823 4:188425503-188425525 CAAGAGCAGGATGGGGAGGAAGG - Intergenic
1202755621 4_GL000008v2_random:59472-59494 CACACTGATGATGAGGAGAAAGG + Intergenic
985857323 5:2440005-2440027 AAGAATGAGGATGATGATGATGG - Intergenic
985895798 5:2749456-2749478 GAAGATGAGGACGAGGACGAGGG - Exonic
985917718 5:2936966-2936988 GAAAAGGAGGAGGAAGAGGAGGG - Intergenic
986026212 5:3853792-3853814 AAGAAGGAGGAAGAGGAGGAGGG + Intergenic
986067067 5:4245154-4245176 CAGAATGAGGAGGAAGAGAAAGG - Intergenic
986429193 5:7664979-7665001 CAAAGTGAGGAGGAGGGGGCGGG - Intronic
986467151 5:8037285-8037307 CACACTGATGAGGAGGAGGAGGG - Intergenic
987001539 5:13664848-13664870 AAGAAGGAGGATGAGAAGGAGGG + Intergenic
987034744 5:14008255-14008277 GAAAAAGAGGATGAGGGAGAGGG + Intergenic
987095454 5:14545614-14545636 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
987194398 5:15511014-15511036 CAAAATGAGGGTGATGGGCAGGG - Intronic
987241957 5:16009041-16009063 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
987473785 5:18365133-18365155 AAAAAAGATGATGAGGAGGTTGG - Intergenic
987574046 5:19703388-19703410 CACAATGATGATGAGGAGGAAGG + Intronic
987808213 5:22798058-22798080 CAAAATAAGGGAGAGTAGGAAGG - Intronic
987851289 5:23358754-23358776 AAGGAAGAGGATGAGGAGGAGGG - Intergenic
988246449 5:28688741-28688763 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
988450938 5:31342478-31342500 CTAACTGAGGGTGAGGAAGAGGG + Intergenic
988556422 5:32240053-32240075 AAAAATGTCCATGAGGAGGATGG + Intronic
988606139 5:32679924-32679946 AAACAAGAGGATGAGGAAGAGGG - Intergenic
988793133 5:34627366-34627388 GAAGATGAGGCTGAAGAGGAGGG + Intergenic
988797013 5:34660574-34660596 AGAAATGAGGAAGAGGAGGTTGG - Intronic
989112751 5:37923107-37923129 CACAGTGAGAATGAAGAGGAAGG - Intergenic
989553577 5:42764384-42764406 AAAACAGAGGAGGAGGAGGAGGG + Intronic
989627785 5:43448224-43448246 CAAAATGTGGAGGAGAAGGCAGG - Intronic
989742479 5:44789286-44789308 CACACTGATGATGAGGAGGAAGG + Intergenic
989758700 5:44986938-44986960 CACACTAATGATGAGGAGGAAGG + Intergenic
990109405 5:52305199-52305221 CACACTGATGATGAGGAGGAAGG + Intergenic
990148662 5:52790889-52790911 CAAAATGAACATGAGGATTATGG - Intronic
990235348 5:53761429-53761451 AAAACTTAGGATCAGGAGGAGGG + Intergenic
990494974 5:56338184-56338206 CAAGAGGAGGAGGACGAGGAGGG - Intergenic
990526482 5:56633167-56633189 AAAAAGGAGGAGCAGGAGGAGGG + Intergenic
990739164 5:58894787-58894809 CAGAATGAGGCTGAACAGGAGGG + Intergenic
990779012 5:59337107-59337129 CAAAAAGAGGAGAAGGATGAAGG + Intronic
990991763 5:61691199-61691221 AAAAAGGAAGAGGAGGAGGAGGG + Intronic
991074458 5:62519329-62519351 GGAAATGAGGAGGAGGAGCAGGG - Intronic
991301663 5:65134473-65134495 CAAAGTGAGGTTGAGGATTATGG + Intergenic
992090644 5:73312955-73312977 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
992199326 5:74368328-74368350 GAAAAGGAGGAGGAGGAGGCAGG + Intergenic
992214909 5:74516431-74516453 AAAGAGGAGGAGGAGGAGGATGG - Intergenic
992996096 5:82335128-82335150 CAAAGTGAGACTGAGGAGGATGG + Intronic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993234685 5:85289300-85289322 AAAAGTGGGGAAGAGGAGGAAGG + Intergenic
993347505 5:86802888-86802910 TAAACTGAGGAAGAGGAGGAAGG - Intergenic
993418343 5:87665454-87665476 GAAAAGGATGAGGAGGAGGAGGG + Intergenic
993463471 5:88215540-88215562 CAAAAAGAGGGTGGGGAAGAAGG - Intronic
993503292 5:88684994-88685016 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
993505106 5:88699712-88699734 CAGGAAGAGGATGAGGAGAAAGG - Intergenic
993505374 5:88702535-88702557 CAAAAGGAGGAGGAGCAGGTTGG - Intergenic
993558473 5:89372615-89372637 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
993995260 5:94715042-94715064 TTAAAGGAAGATGAGGAGGAAGG + Intronic
994074966 5:95640582-95640604 CCAAATGAGGGTGAGGGCGAGGG - Intergenic
994275819 5:97836147-97836169 AAAGAAGAGGAGGAGGAGGAAGG - Intergenic
995016788 5:107318875-107318897 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
995390164 5:111632078-111632100 CTAAGTGAGGATGCAGAGGAAGG - Intergenic
995438414 5:112163005-112163027 CAAAATGAGGCTGAAGAGGTAGG + Exonic
995592339 5:113712629-113712651 CACACTGATGATGAGGAGGAAGG + Intergenic
995662510 5:114500797-114500819 GAAAAGGAGGAAGAGGAAGAAGG + Intergenic
995739597 5:115341522-115341544 CAACATGAAGATGATGAGGATGG - Intergenic
995754016 5:115483071-115483093 CAAGATGTGGAAGAGGAAGATGG + Intergenic
995816998 5:116181714-116181736 CAAAATTAAAATGAGAAGGAAGG + Intronic
995916169 5:117247622-117247644 AATAATGAGGATGAAGATGATGG + Intergenic
996116461 5:119625430-119625452 CAGAAAGAAGAGGAGGAGGAGGG - Intronic
996344169 5:122471798-122471820 AAGGATGAGGGTGAGGAGGAGGG - Intergenic
996651910 5:125888461-125888483 GAAGATGAGGAGGAGGAGAAGGG + Intergenic
996673511 5:126148339-126148361 AGACAGGAGGATGAGGAGGAGGG - Intergenic
996950714 5:129121833-129121855 AATAATGAGGAAAAGGAGGAGGG + Intergenic
997297226 5:132776155-132776177 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
997346594 5:133196721-133196743 GAGAAGGAGGAAGAGGAGGAAGG - Exonic
997619530 5:135276564-135276586 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
997718195 5:136057661-136057683 GAAAAGGAGGAGGAAGAGGAAGG + Intronic
998054042 5:139058701-139058723 GAAAATGATGGTGGGGAGGAAGG - Intronic
998211046 5:140198670-140198692 AAAAAAGAGGGGGAGGAGGAAGG - Intronic
998270390 5:140701058-140701080 CAAAATGAGAGCGAGGAGGTGGG + Intronic
998358733 5:141565636-141565658 CCAACTGAGAATGAGGATGAGGG + Intronic
998611515 5:143694310-143694332 AAAAAGGAGGAGGAGGAGGGAGG - Intergenic
998933953 5:147214598-147214620 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
999084814 5:148878257-148878279 GAGAATGAGGAAGAAGAGGAGGG + Intergenic
1000161907 5:158606067-158606089 CAATGTGAAGATGAAGAGGACGG - Intergenic
1000633231 5:163614918-163614940 AAAAATTTGGATGAGGAGAAAGG - Intergenic
1000703099 5:164477492-164477514 GAAAAGGAGGAGGAAGAGGAGGG + Intergenic
1000909163 5:166999935-166999957 TAAAATGAGGAAAAGGAGGTGGG + Intergenic
1000975309 5:167757982-167758004 CAAACTGTGGCTGAGGTGGAAGG - Intronic
1001112810 5:168912089-168912111 CAACATGAAGATGAGGACGGAGG + Intronic
1001288528 5:170440419-170440441 AAAACTGAGGATGCTGAGGAAGG + Intronic
1001299044 5:170520548-170520570 GAAAAGGAGGAAGAGAAGGAAGG - Intronic
1001368382 5:171168930-171168952 GAAAAAGAGGGAGAGGAGGAAGG - Intronic
1001516343 5:172357840-172357862 AGAAAAGAGGATGAGGAGAAGGG - Intronic
1001737789 5:174021023-174021045 AAAAAGGAGGAGGAGGAGAAGGG + Intergenic
1001740066 5:174045784-174045806 CAATTTGAAGAGGAGGAGGACGG - Exonic
1002681325 5:180967558-180967580 GAGAATGGGGAAGAGGAGGAGGG - Intergenic
1002844888 6:937364-937386 GACAAGGAGGAGGAGGAGGATGG - Intergenic
1003504493 6:6728491-6728513 CAAAATAAGGATGGTAAGGAAGG + Intergenic
1003514149 6:6804404-6804426 ACAGATGAGGATGAGGATGAGGG - Intergenic
1003722344 6:8718006-8718028 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1004119676 6:12808834-12808856 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1004258389 6:14085817-14085839 CAAAATGTGCAAGAGGAGAAAGG - Intergenic
1004295933 6:14410570-14410592 GAAAATGAGGATGATAATGATGG - Intergenic
1004314636 6:14575190-14575212 CAAAGTGAGGATGATAGGGAGGG - Intergenic
1004395364 6:15243260-15243282 GAAAATGAAAAAGAGGAGGAAGG + Intergenic
1005388916 6:25313554-25313576 CAGCATGAGGATGAGGGGCAGGG + Intronic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005635957 6:27753205-27753227 GAAAAGGAGGATGAGGGTGAGGG + Intergenic
1005813810 6:29534564-29534586 CAAAATCAGTAAGAGGAGAAAGG - Intergenic
1006038698 6:31235365-31235387 CACACTGATGATGAGGAGGAAGG - Intergenic
1006574131 6:35031530-35031552 CAAAATGGGGAGGAGGAGGAAGG - Intronic
1006749126 6:36365603-36365625 AAAACTGAGGATGAGGGGGCTGG + Intronic
1006855429 6:37129791-37129813 CATCATGAGGCTGAGGAGGGAGG + Intergenic
1006919079 6:37615678-37615700 CCATGTGAGGATGAGGAGGGAGG + Intergenic
1007236339 6:40393401-40393423 CACAATGAGTATGAAGATGAAGG + Intronic
1007641870 6:43347264-43347286 TGAAATGAGGTTGAGGAGGTAGG + Intronic
1007732730 6:43958672-43958694 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1007886537 6:45236430-45236452 CACACTGATGATGAGGAGGAAGG + Intronic
1008016420 6:46525596-46525618 CAGACTGAGGATGAGGAAGAAGG + Intergenic
1008126697 6:47677311-47677333 CAAAATGAGGGAGAGTATGAAGG + Intronic
1008352564 6:50509728-50509750 CAAAATGTGGGTTAGGACGAAGG + Intergenic
1009051968 6:58286770-58286792 AAAAATGATGATGATGATGATGG - Intergenic
1009062939 6:58418981-58419003 CACACTGATGATGAGGAGGAAGG - Intergenic
1009204949 6:60789842-60789864 CAAAGAGAGAATGAGGAAGACGG - Intergenic
1009250619 6:61293528-61293550 CACACTGATGATGAGGAGGAAGG - Intergenic
1009400394 6:63247901-63247923 CAGGATGAGGAAGAGCAGGAAGG + Intergenic
1009714029 6:67364008-67364030 AAAAATGAGTTTGAGGAGGTCGG - Intergenic
1009955538 6:70448332-70448354 CACACTAATGATGAGGAGGAAGG - Intronic
1010232218 6:73545113-73545135 TAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1010311404 6:74390030-74390052 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1010511540 6:76726750-76726772 GAAAAGGAGAAGGAGGAGGAAGG - Intergenic
1010658202 6:78537606-78537628 AGAAATGAGGATGATGAGGATGG + Intergenic
1010839034 6:80625420-80625442 CAAAAGGAGGATAAGAAGGAAGG + Intergenic
1010850399 6:80768566-80768588 CTAAATTAGGATGAGAAGGTTGG + Intergenic
1011484715 6:87829849-87829871 GAAGAAGAGGAGGAGGAGGAAGG - Intergenic
1011484792 6:87830139-87830161 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1011553309 6:88549277-88549299 AAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1012059146 6:94455432-94455454 AATAATGAAGAGGAGGAGGAAGG - Intergenic
1012214402 6:96563673-96563695 TAAAAAGAGGAAGAAGAGGAGGG + Intronic
1012399125 6:98830460-98830482 TAAAAAGAGGAGGAGGAGTAGGG + Intergenic
1012637731 6:101566083-101566105 GAAAAGGAGGAGGAAGAGGAGGG + Intronic
1012990662 6:105922586-105922608 AAGAAGGAGGAAGAGGAGGAAGG + Intergenic
1013079226 6:106798085-106798107 CAAAATGAGGTTGTTGAGAAAGG + Intergenic
1013369836 6:109459102-109459124 CGAAATGAGAATGGGGAAGAGGG + Intergenic
1013507219 6:110813364-110813386 CAAAGTTAGCATGAGGAGTATGG + Intronic
1013519250 6:110917447-110917469 CACACTAATGATGAGGAGGAAGG + Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1013985811 6:116191987-116192009 AAACATGAGGATGAGGATGCAGG + Intronic
1014218867 6:118780194-118780216 CTAAATGAAGAAGGGGAGGATGG - Intergenic
1014528074 6:122524219-122524241 GAGGATGAGGAAGAGGAGGAGGG - Intronic
1014561912 6:122901174-122901196 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1014680767 6:124427377-124427399 CAAGATGATGATTAGGATGATGG - Intronic
1014804868 6:125818095-125818117 GAAAGTAAGGAGGAGGAGGAAGG - Intronic
1014808343 6:125857202-125857224 CAAAAAGAGGAAGAGGATTAAGG + Intronic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015847563 6:137536701-137536723 AAAAACAAGGATGAAGAGGAAGG - Intergenic
1015850691 6:137568795-137568817 GAAAAGGAGGAGGAGAAGGAGGG + Intergenic
1016779598 6:147943471-147943493 GCAAAGGAGGAGGAGGAGGATGG - Intergenic
1017060383 6:150478905-150478927 CTAAAGGGGGATGGGGAGGATGG - Intergenic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018569972 6:165199288-165199310 CAAAACGAGGATGAGATGGGAGG + Intergenic
1018577705 6:165276753-165276775 TTCCATGAGGATGAGGAGGAAGG - Intergenic
1018581130 6:165309245-165309267 GAAGAGGAGGAGGAGGAGGAGGG - Intronic
1018996575 6:168714884-168714906 GAGAATGATGATGAGGAGGAGGG + Intergenic
1018996668 6:168715455-168715477 GATAGTGAGGAAGAGGAGGATGG + Intergenic
1018996717 6:168715822-168715844 GAGAATGATGATGAGGAGGATGG + Intergenic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1018996745 6:168716012-168716034 TAAAATGATGTTGAGGATGATGG + Intergenic
1019089612 6:169517424-169517446 CAAAATGATGATGTGGAAGCAGG - Intronic
1019403889 7:872476-872498 GAAAATGAGTATCAGGAAGAAGG + Exonic
1019535370 7:1526478-1526500 AAAAAGGAGGAAGAGGAAGAAGG + Intergenic
1019551837 7:1606927-1606949 CACGAAGAGGAGGAGGAGGAGGG - Intergenic
1019781170 7:2940651-2940673 GAAAAAGAGGAAGAAGAGGAGGG + Intronic
1020125517 7:5530786-5530808 GAGATTGAGGAAGAGGAGGAGGG + Intronic
1020577401 7:9950017-9950039 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1020906017 7:14065658-14065680 AAAAAAAAGAATGAGGAGGAAGG - Intergenic
1021279105 7:18694903-18694925 GAAAATGAGGAGTAGGAGGGAGG - Intronic
1021603250 7:22385649-22385671 CAAAAAGAGGCAGAGAAGGAAGG - Intergenic
1021960526 7:25868297-25868319 CAAACTGAGGAGGAGGAAGTGGG - Intergenic
1022037810 7:26550571-26550593 AAAAATGAGGAGGAAGAGGGAGG + Intergenic
1022440132 7:30426361-30426383 GAACATGGGGATGAGAAGGAAGG - Intronic
1022470162 7:30677092-30677114 CAAGATGAGGTGCAGGAGGAGGG + Intronic
1022797553 7:33744210-33744232 CAACATGAGGAGGTGGATGATGG + Intergenic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1023205467 7:37745040-37745062 TTAAATGAAGTTGAGGAGGAAGG - Intronic
1023347431 7:39285845-39285867 AGATATGAGGATGGGGAGGAAGG - Intronic
1023483321 7:40658482-40658504 CTTGATGAGGATGAGGAGAAGGG - Intronic
1023820979 7:43980401-43980423 CCAAATGGGGCTGAGGAGCAAGG + Intergenic
1024063409 7:45715161-45715183 GAAAATAAGGATGATGGGGACGG + Exonic
1024195568 7:47055368-47055390 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1024410385 7:49034014-49034036 GAAAAGGAGGTTGGGGAGGATGG + Intergenic
1024527009 7:50357412-50357434 CAAAATGAGAAGCAGGAAGAGGG - Intronic
1024542273 7:50486603-50486625 CAACATGTGAATGAGGAGGAAGG - Intronic
1024819108 7:53306126-53306148 AAAATTGAGAATGAGTAGGAAGG - Intergenic
1024822286 7:53346718-53346740 GAGAAGGAGGATGAGGAGGAGGG - Intergenic
1024835400 7:53512290-53512312 GAAAATGAAAATGAGGAGAAGGG + Intergenic
1024911915 7:54456244-54456266 CAACATGAGAATGAAGAGGAGGG + Intergenic
1025102294 7:56145567-56145589 CACACTGATAATGAGGAGGAAGG + Intergenic
1025122572 7:56317641-56317663 CACACTGATGATGAGGAGGAAGG + Intergenic
1025307294 7:57873035-57873057 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic
1025794304 7:64723627-64723649 CAAAATGAGGAAGGTGAGGCTGG + Intergenic
1025973562 7:66351220-66351242 CAACATAATGATGAGGAGGTGGG - Intronic
1026191879 7:68136335-68136357 GAAGAAGAGGAGGAGGAGGAAGG + Intergenic
1026284168 7:68948546-68948568 AAAAGGGAGGAAGAGGAGGAAGG - Intergenic
1026334635 7:69383258-69383280 AATAATGAGGATAAGGGGGAAGG - Intergenic
1026464558 7:70643048-70643070 CAAAATGAAGATGAGGAGACGGG - Intronic
1026638631 7:72105766-72105788 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1026639233 7:72109846-72109868 GAAATTGAGGCTGAGGGGGAAGG - Intronic
1026647595 7:72185788-72185810 CAAAGAGAGAATGAGGAAGACGG - Intronic
1026769679 7:73187591-73187613 CAAGGTGCGGATGAGGAGGGAGG - Intergenic
1026905066 7:74058102-74058124 AAGAATGAGAAGGAGGAGGAGGG - Intronic
1026953070 7:74360317-74360339 CTTAAGGAGGATGAGGAAGAGGG + Intronic
1027001496 7:74657694-74657716 AAAAAGGAGGAGGAGGAGGAGGG + Intronic
1027189304 7:75988450-75988472 GGAGATGAGGATGAGGATGATGG + Exonic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027328319 7:77065173-77065195 CCAAATGGGGCTGAGGAGCAAGG - Intergenic
1027835913 7:83241836-83241858 CAAAATGAGGATGAGAGTGTGGG + Intergenic
1028042578 7:86073504-86073526 GAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028686479 7:93594712-93594734 CAGAACGTGGATGAGGAGGGAGG + Intronic
1028964432 7:96786456-96786478 GAAAAGGAGGTGGAGGAGGAGGG - Intergenic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029230531 7:99064300-99064322 CAAAAAGACGAGGAGGAGGAGGG - Intronic
1029459443 7:100686711-100686733 GAACAGGAGGAGGAGGAGGAGGG - Exonic
1029534125 7:101145888-101145910 AAAAAGGAGGAGGAGGAGAAGGG + Intergenic
1029575659 7:101401745-101401767 GAAGAGGAGGAAGAGGAGGAGGG + Intronic
1029584404 7:101461288-101461310 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1029749252 7:102533841-102533863 CCAAATGGGGCTGAGGAGAAGGG + Intergenic
1029767195 7:102632945-102632967 CCAAATGGGGCTGAGGAGAAGGG + Intronic
1029790992 7:102843010-102843032 GAAAAGGAGGTAGAGGAGGAGGG - Intronic
1029983681 7:104902392-104902414 GAAGAGGAGGAAGAGGAGGAGGG + Intronic
1029983689 7:104902419-104902441 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
1030067944 7:105674758-105674780 CAAATAGAAGAGGAGGAGGAAGG - Intronic
1030389055 7:108902938-108902960 CGAGATGAGGATGAAGATGATGG - Intergenic
1030394802 7:108972451-108972473 AAAAATGAAAAAGAGGAGGAAGG + Intergenic
1030902054 7:115136795-115136817 GAAAGAGAGGAAGAGGAGGAAGG - Intergenic
1031100926 7:117479483-117479505 GAAAAGGAGGAGGAGGAGGAAGG + Intronic
1031222183 7:118982186-118982208 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1031693108 7:124815586-124815608 CAAAATGAGTATGAAATGGAAGG - Intergenic
1031762917 7:125737116-125737138 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1032284393 7:130529937-130529959 CATAGTGAAGCTGAGGAGGAGGG + Intronic
1032409187 7:131681474-131681496 TAAACTGAGGATGATGATGATGG + Intergenic
1032523188 7:132561573-132561595 GAGAAGGAGGAAGAGGAGGAGGG - Intronic
1032523694 7:132563744-132563766 GAAAAGGAGGAGAAGGAGGAGGG - Intronic
1032859822 7:135866319-135866341 CATGGTGATGATGAGGAGGAGGG - Intergenic
1032869959 7:135974540-135974562 CAAAAAAAAGAGGAGGAGGAGGG + Intronic
1033019664 7:137711022-137711044 GAAAAGGGGGAGGAGGAGGACGG - Intronic
1033567842 7:142597125-142597147 CAAAATTAAAATGAGGATGAGGG - Intergenic
1033840954 7:145372390-145372412 CAAACTGAGAATGAAGAGGATGG + Intergenic
1034070052 7:148175833-148175855 GATAAGGAGGATGGGGAGGAGGG - Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034255925 7:149724671-149724693 CAAGATCAGGATGGGGAGGAGGG - Exonic
1034438741 7:151076110-151076132 CACTGTGAGGATGAGGATGAAGG - Exonic
1035041893 7:155935058-155935080 ACAAGTGATGATGAGGAGGAGGG - Intergenic
1035161138 7:156950509-156950531 GAAAGTGAGGAGGAGGAGGAGGG + Exonic
1035265294 7:157686761-157686783 AGAAGTGAGGAGGAGGAGGAGGG + Intronic
1036227430 8:6971525-6971547 CACTATGAGAAGGAGGAGGAGGG - Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036553517 8:9836845-9836867 CAAAATAAGGCTGAGCATGATGG + Intergenic
1036557852 8:9875794-9875816 CAAAATGAGGAAGAGGTGGCTGG + Intergenic
1036908889 8:12735101-12735123 AAAAGTGAGGTTGAAGAGGATGG - Intronic
1037041694 8:14244258-14244280 AAGAATGAGGAAGAGGAAGAAGG - Intronic
1037679366 8:21082424-21082446 GAAAATGAGGGTGAGGGGAAAGG - Intergenic
1037699315 8:21259602-21259624 GAAAAAGAGGAGGAGGAGAAGGG + Intergenic
1037773739 8:21818938-21818960 AAAGATGAGGAGGAGGAGGGTGG - Intergenic
1037778864 8:21854159-21854181 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1037908835 8:22731322-22731344 CAATGTGAAGATGATGAGGATGG + Intronic
1038123527 8:24644922-24644944 CAAAATGAAAATGAGGAGGTAGG + Intergenic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038313415 8:26463163-26463185 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1038483642 8:27918788-27918810 GAGAAAGAGGAGGAGGAGGAGGG + Intronic
1038609734 8:29049305-29049327 CGCAATGGGGAGGAGGAGGAGGG + Intronic
1038728737 8:30106812-30106834 CAAAAGGAGGAAGCAGAGGAAGG - Intronic
1038839875 8:31174723-31174745 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1039440203 8:37589820-37589842 CAACACGAGGATGAAGATGAAGG - Intergenic
1039483429 8:37892796-37892818 TAAGATGAGGCTGAAGAGGAAGG - Intronic
1039691671 8:39871092-39871114 CACACTAATGATGAGGAGGAAGG + Intergenic
1039897375 8:41725742-41725764 CAAGGTGAGGGCGAGGAGGAGGG - Exonic
1040071896 8:43195519-43195541 GAAGAGGAGGAAGAGGAGGAGGG + Intronic
1040318776 8:46278742-46278764 CACACTGATGATGAAGAGGAAGG + Intergenic
1040381471 8:46877241-46877263 CACACTGATGATGAGGAGGAAGG + Intergenic
1040447654 8:47511873-47511895 GAGGATGAGGAAGAGGAGGAAGG - Intronic
1040528943 8:48249787-48249809 CACACTGATGATGAGGAGGAAGG - Intergenic
1040750621 8:50701846-50701868 CAAAAAGAGGAAGAAGAAGAGGG - Intronic
1040869026 8:52080879-52080901 GACACTGAGGCTGAGGAGGAGGG + Intergenic
1041018838 8:53617775-53617797 CACACTGATGATGAGGAGGAAGG + Intergenic
1041199149 8:55433715-55433737 TTAAATGAGTATTAGGAGGAAGG + Intronic
1041291155 8:56310085-56310107 AAGAAGGAGGAAGAGGAGGAAGG + Intronic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041324395 8:56649637-56649659 CTAAATCAGTATGAGGGGGATGG - Intergenic
1041328554 8:56697299-56697321 GAAAAGGAGGAGGAGAAGGAGGG - Intergenic
1041858133 8:62481298-62481320 CAAATGGAGGATGAAGAGGGTGG - Intronic
1041954444 8:63542063-63542085 CAAAATGAGACAGAAGAGGAAGG - Intergenic
1042446319 8:68889350-68889372 CACACTGATGATGAGGAGGAAGG + Intergenic
1042517937 8:69679255-69679277 CAAAATTAGCATGTGCAGGAGGG - Intronic
1042611345 8:70604847-70604869 GAAAGTGAGTATGTGGAGGAGGG - Intronic
1042882667 8:73511306-73511328 GAAGAAGAAGATGAGGAGGAGGG - Intronic
1042909961 8:73816536-73816558 GGGAATGAGGATGAAGAGGAAGG + Intronic
1043542840 8:81281515-81281537 CCACTTGAGGGTGAGGAGGAAGG + Intronic
1044086842 8:87952998-87953020 AAAAGTGAGGATGAGGTGTAAGG + Intergenic
1044442355 8:92237251-92237273 CACACTGATGATGAGGAAGAAGG + Intergenic
1044613283 8:94115287-94115309 CTACATTAGGAAGAGGAGGAGGG - Intergenic
1045130036 8:99140687-99140709 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
1045358607 8:101411788-101411810 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1045607816 8:103797556-103797578 CAAAATGAGGCTAAGGGGCAGGG - Intronic
1046350577 8:113005634-113005656 CATAATGAAAATGAGGAGGATGG - Intronic
1046399937 8:113691896-113691918 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1046711173 8:117513203-117513225 CAGAATGGTGAGGAGGAGGAGGG - Intergenic
1047062444 8:121242880-121242902 GAAGAAGAGAATGAGGAGGAAGG - Intergenic
1047308190 8:123670214-123670236 TCAAAGGAGGAGGAGGAGGAAGG - Intergenic
1047526415 8:125638086-125638108 AAAAAGGAGGAGGAGGAGGAGGG + Intergenic
1047628380 8:126679481-126679503 GAAGAGGAGGAAGAGGAGGAGGG + Intergenic
1048007633 8:130432012-130432034 GAAAATGGGGAGGAGAAGGAGGG + Intronic
1048197693 8:132346081-132346103 CAAGATGACGATGATGATGATGG + Intronic
1048293435 8:133197559-133197581 CATAGAGAGGAGGAGGAGGAGGG - Intronic
1048402304 8:134083361-134083383 AAAAAAAAGGAAGAGGAGGATGG - Intergenic
1048484816 8:134837235-134837257 CAACATGAAGATGATGAGGATGG + Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048889422 8:138934437-138934459 AAAAAGAAGGAAGAGGAGGAAGG + Intergenic
1049036448 8:140079966-140079988 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1049184701 8:141243773-141243795 CAACATGAAGATGAGGATGAAGG + Intronic
1049857461 8:144871753-144871775 CACACTGATGATGAGGAGGAAGG + Intergenic
1050191107 9:3027391-3027413 CAAAGTGAAGAGGAGGAGGCTGG + Intergenic
1050744238 9:8858093-8858115 GAAGAGGAGGAGGAGGAGGAGGG - Intronic
1051170386 9:14314705-14314727 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1051412723 9:16807536-16807558 GAAAATGAGAAGGAGGTGGAGGG + Intronic
1051656538 9:19387271-19387293 CATAATGACGATGATGAGGATGG - Intergenic
1051919004 9:22241831-22241853 GAAGATGAGGATGAGGAAGTGGG - Intergenic
1052042370 9:23753668-23753690 GAAAATGTCGATGAGGAAGATGG - Intronic
1052406345 9:28065805-28065827 CATAATGAGAATGAGAATGATGG + Intronic
1052613583 9:30809101-30809123 AAAAATGGTAATGAGGAGGAAGG + Intergenic
1052918221 9:33940086-33940108 AAAAAGGAGGAGGAGGAAGAAGG + Intronic
1053126197 9:35582666-35582688 CACACTGATGATGAGGAGGAAGG + Intergenic
1053263594 9:36693950-36693972 GAAAAGGAGGAGGAGGAGGAAGG - Intergenic
1053281108 9:36820256-36820278 CAAACTGAGAATCCGGAGGACGG - Intergenic
1053448610 9:38173140-38173162 CAAAATGAGGATGAAGGGCTGGG - Intergenic
1053504052 9:38625587-38625609 GAAAAGGAGGAGGAGGAGAAGGG - Intergenic
1054991409 9:71331661-71331683 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1056240102 9:84636740-84636762 AAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1056433654 9:86554111-86554133 GAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1056702371 9:88921449-88921471 GAAAATGATGATGCAGAGGAGGG + Intergenic
1057286027 9:93755084-93755106 CACACTGATGATGAGGAGGAAGG - Intergenic
1057556950 9:96095546-96095568 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1057744776 9:97742076-97742098 GAAGATGAGGAGGAGGAGGAGGG + Intergenic
1057776205 9:98012451-98012473 GAAGATGAGGATGAGGATGAAGG + Exonic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1058400935 9:104618333-104618355 GAAAATAGGGAAGAGGAGGAAGG + Intergenic
1058710095 9:107671698-107671720 CAAAATGATGTTGTGGAAGAAGG - Intergenic
1058913285 9:109541023-109541045 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059199099 9:112398071-112398093 GAAACTGAGGTTGAGGAGGTCGG + Intronic
1059220693 9:112615123-112615145 AAAAATGAAGAGGAGGAGGCCGG + Intronic
1059592777 9:115679956-115679978 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1060501113 9:124156580-124156602 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1061293234 9:129664262-129664284 CAAAATGAGGCCGAGTAGGCCGG - Intergenic
1061511755 9:131065889-131065911 CAAGATGATGATGAAGATGATGG + Intronic
1061541570 9:131280305-131280327 GAAAATGACGAGCAGGAGGAAGG - Intergenic
1061602578 9:131681081-131681103 CACACCGATGATGAGGAGGAAGG + Intronic
1062080794 9:134622429-134622451 GAGAAGGAGGAAGAGGAGGATGG - Intergenic
1062607144 9:137353430-137353452 CATAATGAGGAGGAGGGGAAGGG - Intronic
1062744610 9:138203433-138203455 GAGAATTAGGAAGAGGAGGAGGG + Intergenic
1203687223 Un_GL000214v1:6515-6537 CACACTGATGATGAGGAGGAAGG + Intergenic
1203755410 Un_GL000218v1:121243-121265 CACACTGATGATGAGGAGGAAGG - Intergenic
1203714785 Un_KI270742v1:133783-133805 CACACTGATGATGAGGAGGAAGG - Intergenic
1203536424 Un_KI270743v1:44308-44330 CACACTGATGATGAGGAGAAAGG + Intergenic
1203649052 Un_KI270751v1:97538-97560 CACACTGATGATGAGGAGGAAGG - Intergenic
1185521777 X:745657-745679 CTGGATGAGGATGAGGAGGGTGG - Intergenic
1185523727 X:761079-761101 AAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1185575471 X:1168957-1168979 GAGAAAGAGGAAGAGGAGGAGGG + Intergenic
1185591528 X:1280647-1280669 GAAGAGGAGGAAGAGGAGGAAGG - Intronic
1185603658 X:1355159-1355181 GAAAAGGAGGGGGAGGAGGAAGG + Intronic
1185661959 X:1735285-1735307 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1185747432 X:2584074-2584096 CACGTAGAGGATGAGGAGGATGG + Intergenic
1185814997 X:3146430-3146452 AAGGATGAGGAAGAGGAGGAGGG - Intergenic
1185850000 X:3476316-3476338 GAAAAGGAAGATGAGGAGGAGGG + Intergenic
1186444527 X:9615427-9615449 CAGAATGAGGATGGGGACTAGGG - Intronic
1187207837 X:17199670-17199692 CAAAATGAGGACAATGATGATGG + Intergenic
1187243239 X:17531888-17531910 CACTATGAGGATAAGAAGGAGGG - Intronic
1187435431 X:19264164-19264186 CAAAATGTGGGTGAGGGGAATGG - Intergenic
1189134159 X:38531996-38532018 GATAAAGATGATGAGGAGGATGG - Intronic
1189197072 X:39161922-39161944 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1189256321 X:39642504-39642526 CAGGATGAGGAGGAGGAGTAGGG + Intergenic
1189725701 X:43966339-43966361 AAAGAGGAGGAGGAGGAGGAAGG + Intronic
1189843742 X:45111394-45111416 CAATATCAAGATGAGGCGGATGG - Exonic
1190329396 X:49226436-49226458 GGCGATGAGGATGAGGAGGAGGG - Exonic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1191055569 X:56236447-56236469 GAAAATGAGGAAGAGGGGAAAGG - Intronic
1191256295 X:58281051-58281073 CTAGAGGAGGTTGAGGAGGATGG - Intergenic
1191895421 X:65987438-65987460 AAAAATGAGGAGGGGGAGAAAGG + Intergenic
1191937761 X:66443178-66443200 AAAAATGAGAAGGGGGAGGAGGG - Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192105990 X:68317460-68317482 GAAGAGGAGGAGGAGGAGGAAGG + Intronic
1192191082 X:68991540-68991562 GAAGATGAGGATGAAAAGGAGGG - Intergenic
1192629952 X:72769617-72769639 CACAATGAGGAGGATGGGGAAGG - Intergenic
1192651758 X:72951187-72951209 CACAATGAGGAGGATGGGGAAGG + Intergenic
1192677488 X:73213888-73213910 GAATATGTGGATGAGGACGATGG - Exonic
1193048651 X:77078610-77078632 CACACTGATTATGAGGAGGAAGG + Intergenic
1193248451 X:79259133-79259155 CACAAAGTGGAGGAGGAGGATGG + Intergenic
1193502200 X:82292392-82292414 TAAAATTAGGATGAGGAAGTTGG + Intergenic
1194041647 X:88948823-88948845 CATGATGATGATGAGGAGGATGG - Intergenic
1194536260 X:95108536-95108558 CACACTGATGATGAGGAGGAAGG - Intergenic
1194997189 X:100603866-100603888 GAACAAGAGGAGGAGGAGGAAGG + Intergenic
1195382764 X:104286398-104286420 CAAAAGGAGGCTGAGGTGGGAGG + Intergenic
1195577558 X:106468177-106468199 GAATTTGAGGAGGAGGAGGAGGG - Intergenic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1196267713 X:113671178-113671200 CTAAATGAGAATGCAGAGGAGGG - Intergenic
1196339573 X:114582018-114582040 AATTATGAGGATGAGGATGATGG - Intergenic
1196976280 X:121161357-121161379 CAAAGGGAGAATGAGGGGGAAGG - Intergenic
1197101868 X:122665523-122665545 CAAAATGAGGTTAAAGAGGTAGG - Intergenic
1197237359 X:124082452-124082474 CTAAATGAGCAAGAGGATGAAGG - Intronic
1197326485 X:125100764-125100786 CAAAATCAGGAGGAGAAGGAGGG - Intergenic
1197461110 X:126742498-126742520 CAAAATGCGCATGAGGAGGCTGG - Intergenic
1197719973 X:129738593-129738615 AAAAAGGAGGAGGATGAGGAGGG + Intergenic
1197742758 X:129908017-129908039 AACAATCAGGATGAGGGGGAGGG - Intronic
1197992446 X:132332630-132332652 TAAAACGAGGTTGAGGAGAAGGG - Intergenic
1198576521 X:138016156-138016178 GAAGAGGAGGAGGAGGAGGATGG - Intergenic
1198721269 X:139623572-139623594 CAAAAGGGGGAAGAGGAGGAAGG + Intronic
1198852251 X:140977330-140977352 GAAAATAAGAAAGAGGAGGAGGG - Intergenic
1199109932 X:143919749-143919771 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1199225656 X:145369947-145369969 ACAAATGAGGATGAGAAGGGTGG - Intergenic
1199502813 X:148527746-148527768 TAGAATGAGGATGAGGTGGCGGG - Intronic
1200699429 Y:6389602-6389624 AAAGAGGGGGATGAGGAGGAAGG + Intergenic
1200812358 Y:7499279-7499301 AAATATGATGATGAGGAAGAAGG - Intergenic
1200970809 Y:9150598-9150620 CGTACTGATGATGAGGAGGAAGG - Intergenic
1200978448 Y:9238761-9238783 CACACTGCTGATGAGGAGGAAGG + Intergenic
1201034682 Y:9775096-9775118 AAAGAGGGGGATGAGGAGGAAGG - Intergenic
1201195075 Y:11485302-11485324 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic
1201266277 Y:12210275-12210297 ACAGATGAGGAGGAGGAGGAGGG + Intergenic
1201300294 Y:12498890-12498912 GAAAAGGAGGAGGAGGAGGTGGG - Intergenic
1201390056 Y:13488429-13488451 CAAATAGAGGATGAGATGGATGG - Intergenic
1201637600 Y:16142713-16142735 GAATAAGAGGAGGAGGAGGAAGG - Intergenic
1201684060 Y:16681902-16681924 CACACTAATGATGAGGAGGAAGG - Intergenic
1202140222 Y:21713715-21713737 CATACTGATGGTGAGGAGGAAGG + Intergenic
1202164108 Y:21968742-21968764 CACACTGATGATGGGGAGGAAGG - Intergenic
1202169856 Y:22031836-22031858 CACATTGATGATTAGGAGGAAGG + Intergenic
1202221510 Y:22554537-22554559 CACATTGATGATTAGGAGGAAGG - Intergenic
1202227248 Y:22617622-22617644 CACACTGATGATGGGGAGGAAGG + Intergenic
1202274383 Y:23100275-23100297 GAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1202291644 Y:23320396-23320418 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1202315874 Y:23578032-23578054 CACACTGATGATGGGGAGGAAGG - Intergenic
1202321607 Y:23641125-23641147 CACATTGATGATTAGGAGGAAGG + Intergenic
1202427376 Y:24734026-24734048 GAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1202443415 Y:24936068-24936090 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1202549160 Y:26028931-26028953 CACATTGATGATTAGGAGGAAGG - Intergenic
1202554891 Y:26092042-26092064 CACACTGATGATGGGGAGGAAGG + Intergenic