ID: 1170812625

View in Genome Browser
Species Human (GRCh38)
Location 20:19686391-19686413
Sequence CCACCTGCTCTGATAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170812625_1170812632 9 Left 1170812625 20:19686391-19686413 CCACCCATTATCAGAGCAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1170812632 20:19686423-19686445 AAAGAATTCAGCCTATTTGCTGG 0: 1
1: 0
2: 1
3: 36
4: 581
1170812625_1170812634 28 Left 1170812625 20:19686391-19686413 CCACCCATTATCAGAGCAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1170812634 20:19686442-19686464 CTGGACCTTCCAGAAGCTTCTGG 0: 1
1: 1
2: 0
3: 32
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170812625 Original CRISPR CCACCTGCTCTGATAATGGG TGG (reversed) Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902735559 1:18398538-18398560 CCACCACCTCTTATGATGGGAGG + Intergenic
905911907 1:41661378-41661400 CACCCTGCTCTGATTAAGGGGGG + Intronic
908316830 1:62940950-62940972 CCACCTGCTAGGACAATTGGTGG - Intergenic
911057450 1:93720909-93720931 CCTCCTGCCCTGCTAATGGCAGG - Intronic
917355584 1:174123525-174123547 CCTCCTGCTCTGGTGATGTGAGG + Intergenic
918248730 1:182683184-182683206 AAACCTGCTCTAAGAATGGGTGG + Intronic
924805875 1:247361224-247361246 CCACCCGCTCTGCTCATGGGAGG + Intergenic
1063498968 10:6536191-6536213 CCACCTGCACTGAGCCTGGGTGG + Intronic
1067455330 10:46415054-46415076 ACACCTGCTGTGACAATGGAGGG + Intergenic
1067631874 10:47969581-47969603 ACACCTGCTGTGACAATGGAGGG - Intergenic
1070667503 10:78355791-78355813 GCACATGCTCTGAGTATGGGGGG + Intergenic
1075088171 10:119428013-119428035 TCACCAGGTCTGATACTGGGAGG + Intronic
1076500571 10:130933192-130933214 CCGCCTGCTCTGAGACTGGGAGG + Intergenic
1077682927 11:4262761-4262783 CTGCCTGATCTGAGAATGGGTGG + Intergenic
1077687114 11:4303997-4304019 CTGCCTGATCTGAGAATGGGTGG - Intergenic
1077692275 11:4355186-4355208 CTGCCTGATCTGAGAATGGGTGG - Intergenic
1082273882 11:50200803-50200825 CCACATGCTCTGTTGGTGGGTGG + Intergenic
1083484730 11:62976254-62976276 CCATCTGCTCTCAGAGTGGGAGG + Intronic
1084403154 11:68956364-68956386 GCACCTGCTCTGTGAGTGGGAGG + Intergenic
1084476840 11:69394143-69394165 CAACCTGCTCTGAAGAGGGGTGG + Intergenic
1088195019 11:107264515-107264537 AAACCTGCCCTGCTAATGGGGGG + Intergenic
1088781705 11:113141284-113141306 CCACCTGGTCTGTAACTGGGAGG - Intronic
1098146085 12:67499152-67499174 CCACCTGCTCAGGAAATGAGAGG + Intergenic
1102697236 12:114809387-114809409 CCAGCTCCTCTGATGAGGGGAGG + Intergenic
1104048106 12:125177683-125177705 ACACCTGCACTGATAATAGTGGG + Intergenic
1107881279 13:44833990-44834012 GCAACTGCTCTGAGAATTGGGGG + Intergenic
1110201917 13:72861390-72861412 CCAACTTCTCTGGTAATGGTAGG + Intronic
1110438224 13:75498622-75498644 CCATATGCTCTGATAATGAAGGG + Intergenic
1112222583 13:97506085-97506107 CCTCCTGCACTGATAATTTGGGG + Intergenic
1112313403 13:98340211-98340233 CCAGCTGGTCAGATAATTGGTGG + Intronic
1116525228 14:45895963-45895985 CCACGTGCTCTGGAAATGGTTGG + Intergenic
1118145279 14:63128166-63128188 TCACCCGCTATGAGAATGGGTGG + Intergenic
1118451634 14:65907592-65907614 CCTGCTGCTCTGGCAATGGGGGG + Intergenic
1119265057 14:73259527-73259549 CCACCTGCTCTGCTGACAGGGGG - Exonic
1121208898 14:92191667-92191689 CCACTTCCTCTGTTTATGGGTGG + Intergenic
1123404723 15:20012855-20012877 GCAGATGCTCTGAGAATGGGAGG + Intergenic
1123514056 15:21019502-21019524 GCAGATGCTCTGAGAATGGGAGG + Intergenic
1126496019 15:49291581-49291603 CCACCTACTCTGATATTGCTTGG + Intronic
1128216523 15:65938095-65938117 CCACCTGCTCTGCTAATGCATGG + Intronic
1128797943 15:70478639-70478661 CCACCTGCTCAGCACATGGGCGG - Intergenic
1129617484 15:77110545-77110567 CCACTTAATCTGATAATGGGAGG + Exonic
1134474805 16:14563981-14564003 CCCCCTGTACTGAGAATGGGAGG + Intronic
1134777367 16:16864870-16864892 TCACCTGCTCTGCTAATAGGTGG + Intergenic
1135382301 16:22005234-22005256 CCAGCTGCTCTGCTTAGGGGTGG + Intergenic
1135461023 16:22643021-22643043 CCACCTGCCCTGATATTAGCTGG - Intergenic
1137397316 16:48125309-48125331 CCACCTCCTCTGCCATTGGGTGG - Intronic
1143774836 17:9192070-9192092 CCACCTACTCTGGTGGTGGGAGG + Intronic
1146063451 17:29618701-29618723 CCAGGGGCTCTGATAATGGTGGG + Intronic
1147459022 17:40556868-40556890 CAAACTGCTGTGATCATGGGTGG + Intronic
1147558855 17:41496843-41496865 CCACCTGCTGGGATACAGGGTGG - Intergenic
1147582597 17:41635696-41635718 CTTCCTGCTCAGATAGTGGGTGG + Intergenic
1147949337 17:44098249-44098271 CCACCTGCTCTGCTCATGCCAGG - Intronic
1148141762 17:45333983-45334005 TCACCTGCACTGACAGTGGGTGG - Intergenic
1152040165 17:77897818-77897840 GCCCCTGCTCTGACAAAGGGAGG - Intergenic
1153575992 18:6522572-6522594 CCACCTACTCTAATAATAGATGG + Intronic
1155451187 18:25964235-25964257 CCCACTGCTGTGCTAATGGGTGG - Intergenic
1155837930 18:30610529-30610551 TCATCCGCTCTAATAATGGGAGG - Intergenic
1158644346 18:59231346-59231368 CCACATTCTCTGAAAATGGAAGG - Intergenic
1158745622 18:60196399-60196421 CCACCCCCTCTGTTACTGGGGGG - Intergenic
1159747398 18:72254868-72254890 CCATCTGCCCAGATAATTGGGGG - Intergenic
1163706611 19:18817767-18817789 CCACCTGCTCTCAGAATTGCTGG + Intergenic
1163796119 19:19338963-19338985 CCTCCTGCTCTGTTAACAGGAGG + Intronic
1166483755 19:43195453-43195475 CCACCTGCTCTGTTTTAGGGAGG + Intronic
1168145089 19:54416048-54416070 TCACCTGCTCTGATCCTGTGGGG - Intronic
926079543 2:9973223-9973245 ACGCCTGCTCTGATGGTGGGAGG - Intronic
933300010 2:80530799-80530821 CCACCTGGTCTGGGAATGGATGG + Intronic
934654146 2:96108634-96108656 CCAGCTGCTCTGAGATTGGTGGG + Intergenic
936077237 2:109409374-109409396 CCAGCTGCTCTGATACTGCAGGG - Intronic
944609391 2:201386229-201386251 CCACCTGCTGAAGTAATGGGTGG + Exonic
947548875 2:231032470-231032492 GCACCTGCTCTGAGACTTGGGGG + Intergenic
1170812625 20:19686391-19686413 CCACCTGCTCTGATAATGGGTGG - Intronic
1175752400 20:61508498-61508520 CCACCTGCTCTGCTCAGGAGGGG - Intronic
1176276610 20:64274497-64274519 CGACCTGCTCTGAGGATGGAGGG - Exonic
1179626473 21:42652433-42652455 CCACCTGCTCTCATGGCGGGGGG - Intergenic
1181681430 22:24498425-24498447 GCACCGCCTTTGATAATGGGAGG + Intronic
1182558376 22:31141052-31141074 CCTCCTGGTCTGATAACTGGGGG + Intergenic
1185231528 22:49686818-49686840 CCACCTGCCCTGTTGGTGGGAGG - Intergenic
951111391 3:18808560-18808582 CCACCTGCCATGAGCATGGGTGG - Intergenic
954297689 3:49683261-49683283 CCTCCACCTCTGATAATGCGTGG - Exonic
955938103 3:64121997-64122019 CACACTGATCTGATAATGGGTGG - Intronic
955938247 3:64122981-64123003 ACACCTGCTCTGATATTTTGGGG - Intronic
962083400 3:132164890-132164912 CCACCTGTGCTGATAATGCTGGG - Intronic
962697159 3:137961483-137961505 GAATCTGCTCTGATTATGGGTGG + Intergenic
962750801 3:138433878-138433900 CCACCTGCTCTGATCATTAAAGG + Intergenic
969007434 4:4031961-4031983 CCAACTGCTCTGAAAGTAGGCGG - Intergenic
981555609 4:145990323-145990345 CTACCAGCTCTGATAGTGTGTGG - Intergenic
982748322 4:159129650-159129672 ACACCTGCTCTTATTATAGGGGG - Intronic
985954374 5:3252381-3252403 CCTCCTGCTCTGATAACAGTGGG - Intergenic
986476721 5:8142225-8142247 CCACCTGCTTTGCTAATCTGAGG - Intergenic
988182017 5:27807470-27807492 ACACGTGCTCTGATAAGGTGTGG + Intergenic
991174258 5:63668176-63668198 CCACATGCTCTGATGCTTGGGGG - Intergenic
993193894 5:84715508-84715530 CCACTTTTTCTGATATTGGGAGG + Intergenic
996039437 5:118793670-118793692 CCACCTGCTCTAAAGAAGGGGGG - Intergenic
998391574 5:141790211-141790233 CCTCCTGCCCTGATGATGAGGGG - Intergenic
998818283 5:146035127-146035149 ACAACTGCTTTGATAATGGGTGG + Intronic
1013662259 6:112309505-112309527 CCACCTGCTCTGAAACAGGGTGG + Intergenic
1018273453 6:162104959-162104981 CTACATGCTCTGATTTTGGGTGG + Intronic
1024053876 7:45647081-45647103 CCCCCTCCTCTGATGCTGGGCGG + Intronic
1025625284 7:63215947-63215969 CCACATGCTCTGTTGGTGGGTGG + Intergenic
1025847787 7:65216458-65216480 CCACAGGCTCTAATAAAGGGGGG + Intergenic
1028896580 7:96048338-96048360 TCACCTGCTCTAGTAATGGTGGG - Intronic
1034162269 7:149002382-149002404 CCACCTGCTCTCCTGATGTGAGG + Intergenic
1034463619 7:151212603-151212625 CCAGCTGCTCTGATAAGAGGAGG - Intronic
1041809227 8:61888880-61888902 CCTCCTGTTCTAATAATGGGAGG - Intergenic
1045198830 8:99957848-99957870 CCAGCTGCTCTGGTAGAGGGAGG + Intergenic
1049342036 8:142118365-142118387 CCACCTGCTCCGTGAATCGGAGG - Intergenic
1053744030 9:41175159-41175181 CCACCTGCTCTGACAAGATGTGG + Intronic
1054349307 9:64004962-64004984 CCACCTGCTCTGACAAGATGTGG + Intergenic
1054483243 9:65690138-65690160 CCACCTGCTCTGAAAAGATGTGG - Intronic
1054684314 9:68256094-68256116 CCACCTGCTCTGACAAGATGTGG - Intronic
1059919999 9:119149486-119149508 CCACCTGTTATGATCATGGCAGG - Intergenic
1061389180 9:130307695-130307717 CCACCAGCTCTGACACTGGCTGG - Intronic
1062048182 9:134433983-134434005 CCACCTGCTCTGCCCATGGTGGG + Intronic
1062217434 9:135396908-135396930 CCACCTGCTGTGAGAAGGTGAGG - Intergenic
1193277897 X:79611900-79611922 CCTCCTGCTCTGTTCATGTGAGG - Intergenic
1193693368 X:84675887-84675909 CAACCTGCTCTGTTTATAGGTGG - Intergenic
1194440707 X:93929903-93929925 CCATCTGCTCTCCTAAGGGGAGG - Intergenic
1197467353 X:126821044-126821066 CCTCCTGCACTGATAGTAGGGGG + Exonic
1198023670 X:132683647-132683669 CCACTTGTTCTGATATTTGGGGG + Intronic
1199195489 X:145024727-145024749 CTACCTGCTCTCATAAAGGAGGG + Intergenic
1200323962 X:155217894-155217916 CCTCATGCTCTGCTACTGGGAGG + Intronic
1200887131 Y:8281191-8281213 CCACCTGTTCTGAAAAGGGGTGG - Intergenic
1201457774 Y:14189246-14189268 CTGCCTGCTCTGTCAATGGGAGG + Intergenic