ID: 1170813001

View in Genome Browser
Species Human (GRCh38)
Location 20:19689413-19689435
Sequence CTGAAGCCAGGGGCCGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170813001_1170813007 11 Left 1170813001 20:19689413-19689435 CCAGCTCCGGCCCCTGGCTTCAG No data
Right 1170813007 20:19689447-19689469 TGGCTGACTTTTGTGAAATCAGG No data
1170813001_1170813008 30 Left 1170813001 20:19689413-19689435 CCAGCTCCGGCCCCTGGCTTCAG No data
Right 1170813008 20:19689466-19689488 CAGGTAATCACCAACACATCAGG No data
1170813001_1170813006 -9 Left 1170813001 20:19689413-19689435 CCAGCTCCGGCCCCTGGCTTCAG No data
Right 1170813006 20:19689427-19689449 TGGCTTCAGCTCTCAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170813001 Original CRISPR CTGAAGCCAGGGGCCGGAGC TGG (reversed) Intronic