ID: 1170813001

View in Genome Browser
Species Human (GRCh38)
Location 20:19689413-19689435
Sequence CTGAAGCCAGGGGCCGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 547
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 504}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170813001_1170813008 30 Left 1170813001 20:19689413-19689435 CCAGCTCCGGCCCCTGGCTTCAG 0: 1
1: 0
2: 1
3: 41
4: 504
Right 1170813008 20:19689466-19689488 CAGGTAATCACCAACACATCAGG 0: 1
1: 0
2: 3
3: 196
4: 2970
1170813001_1170813006 -9 Left 1170813001 20:19689413-19689435 CCAGCTCCGGCCCCTGGCTTCAG 0: 1
1: 0
2: 1
3: 41
4: 504
Right 1170813006 20:19689427-19689449 TGGCTTCAGCTCTCAGTTGCTGG 0: 1
1: 0
2: 3
3: 24
4: 230
1170813001_1170813007 11 Left 1170813001 20:19689413-19689435 CCAGCTCCGGCCCCTGGCTTCAG 0: 1
1: 0
2: 1
3: 41
4: 504
Right 1170813007 20:19689447-19689469 TGGCTGACTTTTGTGAAATCAGG 0: 1
1: 0
2: 0
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170813001 Original CRISPR CTGAAGCCAGGGGCCGGAGC TGG (reversed) Intronic
900358191 1:2274809-2274831 CTGCAGCAAGGGGCAGCAGCCGG - Intronic
900368349 1:2320555-2320577 GTGAAGCCAGGGGCCAGGGCAGG + Intergenic
900402393 1:2477916-2477938 CTGTGGCCAGGGGCGGGGGCAGG + Intronic
900406466 1:2495188-2495210 CAGAAGCCTGGGCTCGGAGCTGG + Intronic
900430223 1:2597856-2597878 CAGAGGCCAGAGGCAGGAGCAGG - Intronic
900457722 1:2785591-2785613 CTGAGACCTGGGGCCTGAGCTGG - Intronic
900577915 1:3393555-3393577 CTCGAGCCAGGAGCCGGCGCAGG + Intronic
900603697 1:3514673-3514695 CTGCAGCCACGGGCCCGAGGAGG + Intronic
900606070 1:3524082-3524104 CTGAAGCCAGGAGCCCAGGCAGG + Intronic
900956675 1:5890216-5890238 CTCAGGCCACGGGACGGAGCTGG - Intronic
901186429 1:7376282-7376304 CAGATGCCAAGGGCCAGAGCAGG - Intronic
902423855 1:16303824-16303846 GTGAATCCAGGGGGTGGAGCTGG - Intronic
902506466 1:16941649-16941671 CTGAACCCGGGAGGCGGAGCTGG + Intronic
903021730 1:20399798-20399820 CTGGAGCCAGGGGTCAGGGCAGG + Intergenic
903161303 1:21491059-21491081 CTGGAGCCCTGGGCCAGAGCAGG + Intergenic
903666366 1:25009972-25009994 CTCAAGCCAGAGGCTGGAGTTGG - Intergenic
904254573 1:29246694-29246716 TTGAACCCAGGGGGCGGAGGTGG - Intronic
904309693 1:29620852-29620874 CTGGTGACAGGGGCCAGAGCGGG + Intergenic
905351908 1:37352944-37352966 CTGAAGCCAGGCACCACAGCAGG - Intergenic
906399787 1:45496442-45496464 ATGAAGACAGGGGCAGGAGAGGG + Exonic
906519000 1:46456360-46456382 CAGAACCCAGGGGCTGGACCAGG - Intergenic
908492511 1:64660609-64660631 CTGAACCCAGGAGACGGAGGTGG - Intronic
908841778 1:68287623-68287645 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
909738638 1:78999490-78999512 GTGAACCCAGGAGGCGGAGCTGG + Intronic
912482703 1:109996124-109996146 TTGAACCCATGGGGCGGAGCAGG + Intronic
912910622 1:113755984-113756006 GTGAACCCAGGAGGCGGAGCTGG + Intronic
915102170 1:153508326-153508348 TGGAAGCCAGGGGCAGGGGCCGG + Intergenic
916026330 1:160836725-160836747 CTGAACCCAAGGGCCAAAGCAGG + Intronic
916607539 1:166358170-166358192 CTGAAGCCAGGCCCCTGAGCAGG + Intergenic
917886582 1:179391615-179391637 CTGAACCCAGGAGCTGGAGGTGG - Intronic
918044412 1:180933099-180933121 CTGGAGTCAGGGGTAGGAGCAGG + Intronic
918100119 1:181365655-181365677 CTGAAGCCAGGGTCTGGACAGGG + Intergenic
918553964 1:185777530-185777552 TTGAAGCCAGGAGGCGGAGATGG - Intronic
919024408 1:192149075-192149097 CTGAACCCAGGAGGCAGAGCTGG + Intergenic
919785492 1:201255475-201255497 CTGAGGCCAGGAGCCGGCACTGG + Intergenic
920972375 1:210753786-210753808 CTCAAGCCAGGGGCCCGAGTGGG + Intronic
921159304 1:212462110-212462132 CTGAAGCCAGCAGGCTGAGCGGG + Intergenic
921650723 1:217674746-217674768 CTGGAGCCACAGGCCAGAGCAGG - Intronic
921781651 1:219172590-219172612 CTGAAGGCAGTGGCCCCAGCAGG - Intergenic
921851250 1:219934205-219934227 GTGAACCCAGGAGGCGGAGCTGG + Intronic
923189928 1:231610672-231610694 CTGGAGCCAGGGGCCTGATTGGG + Intronic
923453051 1:234137797-234137819 CTGAAGACAGCAGCAGGAGCTGG + Intronic
923470514 1:234286387-234286409 CTGGGGCCAGGGGCGGGGGCGGG + Intronic
924436708 1:244049001-244049023 CAGGGGCCAGGGGCCGGCGCCGG - Intronic
924741594 1:246797325-246797347 CCGAAGCCTGGGGCCGGGGGTGG - Intergenic
1063108742 10:3017001-3017023 CTGAAACCAGGGCCCCGAGAGGG - Intergenic
1064172978 10:13050385-13050407 CTGAGGCCATGGGCCAGGGCTGG + Intronic
1064670414 10:17707969-17707991 CTGAACCCAGGAGGCGGAGCTGG - Intronic
1064696206 10:17967804-17967826 GTGAACCCAGGAGGCGGAGCTGG + Intronic
1065471787 10:26089518-26089540 GTGAACCCAGGAGGCGGAGCTGG + Intronic
1065993255 10:31032491-31032513 CGGGAGCCAGGGGCGGGAGCCGG - Intergenic
1067945138 10:50684449-50684471 CCTAAGCCAGGAGCTGGAGCAGG + Intergenic
1069014895 10:63418994-63419016 CTGAACCCAGGAGACGGAGGTGG + Intronic
1069658786 10:70109666-70109688 CTGGAGCCAGAGGTCGGAGATGG - Intronic
1071268060 10:83981919-83981941 CTGAAGGCTGGGCCCGGGGCTGG + Intergenic
1071515417 10:86293625-86293647 CTGAATCCAGGGCCTGGTGCTGG - Intronic
1071633555 10:87233544-87233566 CCTAAGCCAGGAGCTGGAGCAGG + Exonic
1071647002 10:87365760-87365782 CCTAAGCCAGGAGCTGGAGCAGG + Exonic
1071784107 10:88880206-88880228 CGGCACCCAGGGGCCGGGGCAGG + Exonic
1071816858 10:89241052-89241074 ATGTAGCCAGGGGCCTGACCTGG + Intronic
1072572571 10:96671580-96671602 CTGAAGTCAGGGGAGGGAGGAGG + Intronic
1072745126 10:97934471-97934493 CTTATGCCAGGGGCAGGGGCAGG - Intronic
1073381250 10:103079552-103079574 CTGAAGTCAGAGGCAGCAGCTGG - Exonic
1073533499 10:104254539-104254561 GTGAAGCCTTGGGACGGAGCGGG + Intronic
1073782875 10:106858525-106858547 GTGAACCCAGGAGGCGGAGCTGG + Intronic
1074623668 10:115153659-115153681 ATGAATCCAGGAGCAGGAGCTGG - Intronic
1074996035 10:118758422-118758444 CTGAGGCCAGGGGCTGTGGCAGG - Intergenic
1075008054 10:118844454-118844476 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
1075144509 10:119872333-119872355 CAGCAGGCAGGGGCAGGAGCCGG - Intronic
1075865695 10:125717770-125717792 GTGAACCCAGGAGACGGAGCTGG - Intergenic
1076572245 10:131440589-131440611 TGGCAGCCAGGGGCTGGAGCTGG + Intergenic
1077231037 11:1458320-1458342 CTGAGGTCAGGGTCCGGGGCAGG - Intronic
1080585091 11:33674589-33674611 CGGAAGCCAGAGGGCAGAGCAGG - Intergenic
1081108747 11:39105559-39105581 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
1081520601 11:43877560-43877582 ATGAATCCAGGAGGCGGAGCTGG + Intergenic
1081670523 11:44939801-44939823 CTAAAGCCAGGGGGCGTAGGAGG - Intronic
1081699921 11:45146573-45146595 CCCAATTCAGGGGCCGGAGCCGG - Intronic
1081749769 11:45501683-45501705 CTGAAGCCATCGGGCAGAGCTGG - Intergenic
1081759998 11:45570473-45570495 CTCAACCCAGGGGCCCAAGCAGG + Intergenic
1081965016 11:47164249-47164271 GTGAGGCCAGGGGCCGGCACTGG + Intronic
1081983214 11:47283172-47283194 ATGAAGCCGGGAGGCGGAGCTGG - Intronic
1082814812 11:57500899-57500921 GGGAAGCCAAGGGCGGGAGCTGG + Intronic
1083295369 11:61712469-61712491 GTGCAGCCAGGGGCAGGAGTGGG - Intronic
1083680244 11:64348398-64348420 CTGTGGCCAGGGCCCGGAGGAGG + Intronic
1083921691 11:65784442-65784464 CTGATGCCAAGGCCCTGAGCAGG - Intergenic
1084695905 11:70755547-70755569 CTGCAGGCCGGGGCCGGGGCTGG - Intronic
1084793155 11:71487748-71487770 ATGAACCCAGGAGGCGGAGCTGG + Intronic
1084987326 11:72887015-72887037 CTGGATCCAGGGGCATGAGCTGG - Intronic
1085377471 11:76078846-76078868 GTGAACCCAGGAGGCGGAGCTGG + Intronic
1085521798 11:77143519-77143541 CTGAAGTCAGGGGCCTGCCCCGG + Intronic
1086634549 11:89065660-89065682 ATCAAGCAAGGGGCGGGAGCTGG - Intronic
1086818674 11:91406529-91406551 CTGGAGCCATTGGCCAGAGCAGG - Intergenic
1086984074 11:93229496-93229518 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
1087006107 11:93473542-93473564 GTGAACCCAGGAGGCGGAGCTGG + Intergenic
1088801903 11:113314498-113314520 CAGGAGCCAGGGCCCGGGGCGGG - Intergenic
1089078841 11:115760041-115760063 CAGAAGCCGGCGGCAGGAGCGGG + Intergenic
1089108672 11:116036613-116036635 CTAGAGGCAGGGGCGGGAGCAGG - Intergenic
1089343814 11:117777640-117777662 CTGCAGCCAGGGTCAGAAGCAGG - Intronic
1089408132 11:118215902-118215924 CTGAGGCCAGGAGCAGTAGCAGG - Intronic
1090254604 11:125274644-125274666 CTGAGGCTGGGGGCTGGAGCAGG + Intronic
1090744588 11:129695973-129695995 CGGAAGCCAGGGGCAGAGGCTGG + Intergenic
1091085560 11:132718764-132718786 CTGAAACCTGGGGCTGGAGTAGG - Intronic
1091090047 11:132762778-132762800 CTGAAGCCAGGGAGCCGAGTGGG - Intronic
1091690013 12:2589543-2589565 CTGAGGCGAGAGGCCGGGGCAGG + Intronic
1091797867 12:3307573-3307595 CTGAAGCCAGGGCCAGCAGCTGG + Intergenic
1091802707 12:3334514-3334536 GGGAAGCCAGGGGCCTGAGAAGG - Intergenic
1092578972 12:9819276-9819298 CTGAATCCAAGGGGCTGAGCAGG + Intergenic
1094089298 12:26630102-26630124 CAGAAGGCAGGGGGCAGAGCTGG + Intronic
1094118092 12:26938720-26938742 CTAAATCCAGGGACGGGAGCAGG + Intronic
1094757840 12:33492745-33492767 CTGAAGCCAGGGAGCTGAGTGGG + Intergenic
1094794167 12:33951081-33951103 CTGAAGCCTGGGGTCAGAGGAGG + Intergenic
1095106028 12:38233695-38233717 CTGAAGCCTGGGGTCAGAGGAGG + Intergenic
1095824476 12:46516853-46516875 CTGAATCCAGGGGGCTGAGCAGG - Intergenic
1096784199 12:54008007-54008029 GTGAAGCCAGGGGCCCCACCAGG + Intronic
1097106681 12:56630091-56630113 CTGTGGCCAGGGGCCTGAGGGGG - Intronic
1097267828 12:57755864-57755886 CTGCTTCCAGGGCCCGGAGCAGG + Exonic
1097791680 12:63821935-63821957 CTGGGGCTAGGGGCCGGAGCTGG - Intergenic
1098127521 12:67315368-67315390 GTGAACCCAGGAGGCGGAGCTGG + Exonic
1098925794 12:76348459-76348481 CGGAAGCCAGGAGTCGAAGCCGG + Intergenic
1099927758 12:89038868-89038890 CTGAAGTCAGGGTATGGAGCCGG - Intergenic
1101210044 12:102526325-102526347 GTGAACCCAGGGGGCAGAGCTGG + Intergenic
1102002113 12:109563793-109563815 CTGTTCCCAGGGGCCTGAGCAGG + Intronic
1102253804 12:111405168-111405190 CGGAAGCCAGCGGTCGGAGAGGG + Intergenic
1102279240 12:111605629-111605651 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
1103567198 12:121822810-121822832 CTCAAGCTAGGGGACGGGGCTGG - Exonic
1103969135 12:124658807-124658829 CTGGAGCCAGGGGAGGCAGCGGG + Intergenic
1104475007 12:129063909-129063931 CTGAAGCCATGGGGCTGAACTGG + Intergenic
1104675668 12:130710312-130710334 CTGATGTCAGGGGCCGCACCTGG - Intronic
1104852040 12:131881230-131881252 TTGAACCCAGGAGCCGGAGGTGG - Intergenic
1105455914 13:20541216-20541238 GTGAACCCAGGAGGCGGAGCTGG + Intergenic
1105472522 13:20705375-20705397 CTGGAGACAGGTGCAGGAGCTGG + Intronic
1105541284 13:21319540-21319562 CTGCACCCAGCGGCTGGAGCAGG + Intergenic
1107427668 13:40309924-40309946 CTTAAGCCAGGGCCTTGAGCCGG - Intergenic
1108701455 13:52947801-52947823 CTGACTCCAGGGGCAGGGGCGGG - Intergenic
1109587532 13:64426230-64426252 GTGAAGCCGGGAGGCGGAGCTGG + Intergenic
1111091594 13:83453510-83453532 CAGGAGCCATGGGCCAGAGCTGG + Intergenic
1112085635 13:96029068-96029090 GTGAACCCAGGAGGCGGAGCTGG + Intronic
1112253830 13:97809146-97809168 GTGGGGGCAGGGGCCGGAGCTGG + Intergenic
1113912860 13:113852552-113852574 CGGATGCCAGGGTCCGGAGGTGG - Intronic
1114528106 14:23378801-23378823 CAGAAGCCAGGCGCTGGGGCTGG - Intronic
1115230609 14:31156164-31156186 GTGAACCCAGGAGGCGGAGCTGG + Intronic
1115243310 14:31270423-31270445 CTGGAGCCAAGGGCCAGAGCTGG + Intergenic
1118524168 14:66621503-66621525 GTGAACCCAGGGGGTGGAGCTGG - Intronic
1119335430 14:73829516-73829538 CAGAAGAAAGGGGCGGGAGCTGG - Intergenic
1120422261 14:84302959-84302981 CAGAAGCCACGGCCTGGAGCAGG + Intergenic
1120591990 14:86386484-86386506 CTGAAGGCAGGGACAGGTGCAGG + Intergenic
1121110803 14:91311549-91311571 CAGAAGCCAGGTGCCTGAACTGG + Intronic
1121485962 14:94314525-94314547 CTGAAGCCAGGCCCCGGTGATGG + Exonic
1122206866 14:100152027-100152049 CTGAAGCCAGGGCTTGGAGGTGG + Intronic
1122209394 14:100165346-100165368 CTGAAGTCAGGGGGAGGAGAGGG - Intergenic
1122425228 14:101601839-101601861 GGGCTGCCAGGGGCCGGAGCTGG - Intergenic
1122895931 14:104756990-104757012 CTGAAGACAGGGACTAGAGCCGG - Intronic
1123008782 14:105337264-105337286 GTGATGCCAGGGGCCGGGGAAGG + Intronic
1123061498 14:105596773-105596795 CTGAAGCCAGAGGCTGGACGAGG + Intergenic
1125674230 15:41493981-41494003 CTGCAGCCCGGGGCTGGAGCGGG + Exonic
1128240143 15:66096110-66096132 CTGAGGCCAGGGCTGGGAGCTGG - Intronic
1128322582 15:66703538-66703560 TCGGAGCCAGGGGCCGGCGCTGG + Exonic
1128389426 15:67173205-67173227 CTGATGCTGGGGGCCAGAGCTGG + Intronic
1129125325 15:73435552-73435574 ATGAAGCCAGGAGCTGGAGTGGG - Intergenic
1129299316 15:74616225-74616247 CTGAAGCCAGGGGTAGGGGAGGG - Intronic
1129701091 15:77769092-77769114 CTGCGGCCAGGGTCTGGAGCAGG - Intronic
1129835312 15:78701703-78701725 GTGAACCCAGGAGGCGGAGCTGG - Intronic
1130017661 15:80200211-80200233 GAGAAGCCAGGGGTCTGAGCTGG - Intergenic
1130662674 15:85842994-85843016 CTCGTGCCAGGGGCTGGAGCAGG + Intergenic
1131047147 15:89323540-89323562 CTGAATGCAGGTGCTGGAGCAGG - Intronic
1131076600 15:89499224-89499246 CTGAAGCCTGGGCCGGGAGGGGG + Intergenic
1131156930 15:90081245-90081267 CTGGTTCCAGGGGCAGGAGCTGG - Exonic
1132387194 15:101409015-101409037 CTATATCCGGGGGCCGGAGCAGG + Intronic
1132416263 15:101621110-101621132 GTGATGCCTGGGGCCGCAGCTGG - Intergenic
1132728229 16:1348034-1348056 CTGGAGCCTGGGGCTGGGGCTGG - Intronic
1132936016 16:2481673-2481695 CCAAAGGCAGGGGCTGGAGCTGG - Intronic
1133199168 16:4192001-4192023 TTGAGGCCAGGGGTCGGGGCAGG - Exonic
1133379916 16:5321398-5321420 ATGAACCCAGGAGGCGGAGCTGG - Intergenic
1134172859 16:11982508-11982530 CTGAACCCAGGAGGCAGAGCTGG - Intronic
1135830124 16:25765620-25765642 CTGAAGCCAGGAGCCCAGGCAGG - Intronic
1136376651 16:29869822-29869844 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
1136428627 16:30184748-30184770 CTAAAGGCAGGGACAGGAGCTGG - Intronic
1136542958 16:30938715-30938737 GTGAACCCAGGAGGCGGAGCTGG - Intronic
1136652281 16:31683124-31683146 CTGATGCCAGGGCCCTAAGCTGG + Intergenic
1138344898 16:56314651-56314673 CAGAAGCCAGGCGCCGGCGCTGG - Intronic
1139961529 16:70720810-70720832 CTCAAGACTGGGGCCGGGGCAGG + Intronic
1140034911 16:71364531-71364553 CTGAAGCCAGAGGCCCCAGATGG - Intronic
1140903808 16:79393589-79393611 CTGCACCCAGGGGCTGGAGCTGG - Intergenic
1141730112 16:85816663-85816685 CTGAACCCAGGAGGTGGAGCTGG - Intergenic
1142162851 16:88567964-88567986 TTGAACCCAGGGGGCGGAGGTGG + Intergenic
1142376902 16:89711247-89711269 CTGGTGCCAGGTGCCGGAGAGGG - Intronic
1142741360 17:1933528-1933550 CAGACGCAAGGGGCTGGAGCTGG + Intergenic
1142760054 17:2036792-2036814 GTGAAGCCAGCGGCTGGGGCAGG - Intronic
1143685707 17:8514092-8514114 CTGGTGCCAGGGGCCTGAGGTGG - Intronic
1143786122 17:9257003-9257025 CCGAAGTCAGGAGCCGCAGCAGG - Intronic
1143855961 17:9849691-9849713 GTGAACCCAGGAGGCGGAGCTGG - Intronic
1143918919 17:10315371-10315393 TTGAACCCAGGGGGCGGAGGTGG - Intronic
1144477532 17:15601326-15601348 GTGAACCCAGGAGGCGGAGCTGG + Intronic
1144920706 17:18762041-18762063 ATGAACCCAGGAGGCGGAGCTGG - Intronic
1146625429 17:34431598-34431620 GTGAACCCAGGAGGCGGAGCTGG + Intergenic
1146946479 17:36877156-36877178 CAGAAGCCAGAGGCCTGGGCCGG + Intergenic
1147223473 17:38955305-38955327 ATGAACCCAGGAGGCGGAGCTGG + Intronic
1147401053 17:40180173-40180195 CTGAAGCTGGGGGTCAGAGCTGG + Intronic
1147410843 17:40250992-40251014 ATGAACCCAGGAGGCGGAGCTGG - Intronic
1147653707 17:42076539-42076561 GTGAACCCGGGGGGCGGAGCTGG + Intergenic
1147663246 17:42128921-42128943 CTCAAGCCAGGAGCCAAAGCAGG + Intronic
1147804576 17:43121292-43121314 CTGAACCCGGGAGGCGGAGCTGG + Intronic
1148048985 17:44759915-44759937 GTGAGGCCAGGGGCTGAAGCAGG + Intronic
1148128306 17:45247942-45247964 CGGAAGCCGGGGCCCGGGGCTGG + Intergenic
1149571265 17:57674050-57674072 CTGGAGGCTGGGGCCAGAGCTGG - Intronic
1149999818 17:61426842-61426864 CTGAACCCAGGAGCTGGAGGTGG - Intergenic
1150737219 17:67751210-67751232 CTGGAGCCTTGGGCCAGAGCAGG + Intergenic
1151426974 17:74037357-74037379 CTGAGCCCAGGGGCCTGGGCAGG + Intergenic
1151656615 17:75499199-75499221 CTTAGACCAGGGGCCGGGGCAGG - Intronic
1151738875 17:75965255-75965277 GTGAACCCAGGAGGCGGAGCTGG + Intronic
1152290657 17:79438221-79438243 CTGAGCTCAGGGGCCAGAGCAGG - Intronic
1152350577 17:79781969-79781991 CTGCTGCCAGGGGCCCCAGCCGG + Intronic
1152571998 17:81125015-81125037 CTGCAGGCAGGGGCAGGGGCAGG + Intronic
1152594984 17:81233592-81233614 CAGAAACCAGGTGCCAGAGCTGG + Intronic
1152627794 17:81396216-81396238 CCGAAGCTAGGGGCCGGGGAGGG + Intronic
1152639127 17:81442431-81442453 CTGCAGGCAGGGGAAGGAGCCGG - Exonic
1152947184 17:83204176-83204198 GTGAATGCAGGGGCAGGAGCAGG + Intergenic
1153824226 18:8860551-8860573 GAGAGGCCAGGGGCCAGAGCAGG + Intergenic
1154312543 18:13278474-13278496 CTGAGGCCAGAGGCTGAAGCTGG - Intronic
1155502598 18:26502128-26502150 GTGAACCCAGGAGGCGGAGCTGG - Intronic
1156165711 18:34418484-34418506 GTGAAGCCGGGAGGCGGAGCTGG - Intergenic
1157753647 18:50199183-50199205 TTGAACCCAGGGGGCGGAGGGGG + Intergenic
1158673782 18:59500512-59500534 CTGAAGCCAGGGGTAACAGCTGG + Intronic
1158714273 18:59863909-59863931 ATGAACCCGGGGGGCGGAGCTGG - Intergenic
1159250116 18:65864808-65864830 GTGAACCCAGGAGGCGGAGCTGG + Intronic
1159439810 18:68463801-68463823 CTGAAGTCAAGGGCAGGAACTGG + Intergenic
1159959824 18:74546712-74546734 CCGAAGCCAGGGGATGGAGGAGG - Intronic
1160231003 18:77048998-77049020 CTGAACCCGGGAGGCGGAGCTGG - Intronic
1160953585 19:1679306-1679328 CTCAGGCCAGGGGCTGGGGCTGG + Intergenic
1161302185 19:3548067-3548089 CTCGAGCCAGGGGCGGGGGCTGG - Intronic
1161473323 19:4472246-4472268 GCGAAGCCGGGGGCGGGAGCGGG - Intergenic
1161600778 19:5181233-5181255 ATGAACCCAGGAGGCGGAGCTGG + Intronic
1161650787 19:5483399-5483421 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
1161898651 19:7101309-7101331 ATGAAGCCGGGAGGCGGAGCTGG - Intergenic
1162009752 19:7805382-7805404 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
1162045994 19:8000820-8000842 GAGAAGCCCGGGGCAGGAGCAGG + Intronic
1162068753 19:8141434-8141456 GTGAACCGAGGGGCTGGAGCGGG - Intronic
1162086659 19:8253538-8253560 GTGAACCCAGGAGGCGGAGCTGG - Intronic
1162571817 19:11478814-11478836 CTGGGGCCAGGGGCCGCAGCTGG - Intronic
1163636274 19:18438423-18438445 CACAAGCCAGGGGGTGGAGCTGG + Intergenic
1164520272 19:28973577-28973599 CCAGAGCCAGGGGCAGGAGCTGG - Intergenic
1164743563 19:30594679-30594701 CTGCAGCCAGGGAGGGGAGCAGG - Intronic
1165056246 19:33177817-33177839 CTGAAGCCAGCTGCCTGGGCTGG + Intronic
1165329888 19:35135486-35135508 CTGTAGCCAGGGGAGGGGGCTGG - Intronic
1165443868 19:35845969-35845991 CTGAGGCCCGGGGGCGGGGCGGG - Intronic
1165480382 19:36060036-36060058 CTGAGGCCTGGGCCCGGGGCAGG + Intronic
1166329534 19:42070072-42070094 CTGGAGCCGGGGACTGGAGCCGG - Intronic
1166375089 19:42323560-42323582 CTGAGGCCAGGGCCAGGAGCAGG - Intronic
1167049255 19:47068587-47068609 CTGAAGCCAGAGGCCACAGGTGG - Intronic
1167437194 19:49486345-49486367 CTGGAGCCCCGGGCCGGCGCTGG + Intergenic
1167494208 19:49808547-49808569 CTGAGGACAGGGGCAGGGGCAGG - Intronic
1167889103 19:52525917-52525939 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
1168148112 19:54430659-54430681 CTGAAGGGAGGGGGCGGGGCTGG + Intronic
1168261501 19:55197597-55197619 CTGTAGCCAGGGGACGGAGAGGG - Intronic
1168263675 19:55209529-55209551 GTGAAGCCAGAGGCCAGGGCGGG + Intergenic
1168635137 19:57990282-57990304 GTGAACCCAGGAGGCGGAGCTGG + Intronic
926085456 2:10017004-10017026 GTGATGGCATGGGCCGGAGCAGG + Intergenic
927712066 2:25332218-25332240 ACGAAGCCAGGGGCCTGGGCCGG - Intronic
927933824 2:27063512-27063534 GTGAACCCAGGAGGCGGAGCTGG + Intronic
928288000 2:30010085-30010107 TTGAAGCCAGGGGGTAGAGCAGG + Intergenic
928720543 2:34115887-34115909 CTGTAGTCTGGGGCCGGAGGAGG - Intergenic
929844566 2:45509513-45509535 GTGAACCCAGGAGGCGGAGCTGG + Intronic
930818440 2:55621789-55621811 CTGAAGCCACGGGCCTGAGTGGG + Intergenic
930991015 2:57654970-57654992 CTGAAGCCATGGGCTGAGGCAGG - Intergenic
931349551 2:61475114-61475136 CTGAACCCGGGAGGCGGAGCTGG - Intergenic
932157405 2:69430788-69430810 CTGTAGCCAGGGGCCAGAAGAGG - Intronic
932272217 2:70420244-70420266 CAGAAGCCTGGGGCCAAAGCAGG - Intergenic
932285179 2:70525605-70525627 CAGAAGCAAGGGGCAGGAGGAGG + Intronic
932418562 2:71588149-71588171 CTGAAGCCAAGGGCCGGGTTTGG + Intronic
932556029 2:72825684-72825706 CCGAAGGGAGGGGCCGGCGCCGG + Intronic
932873291 2:75425343-75425365 CTGGAGCCATGAGCCGGAGCAGG - Intergenic
933974332 2:87496327-87496349 CTGAAGGCAGAGGCCTCAGCAGG - Intergenic
934850872 2:97700348-97700370 CTGAGGCCAGGGGGCAGAGGAGG + Intergenic
935274899 2:101467718-101467740 CTGTCCCCAGGGGCCGGGGCTGG - Intronic
935645334 2:105329677-105329699 CAGGAGCCGCGGGCCGGAGCGGG - Exonic
935844982 2:107155824-107155846 CTCAAGGCAGAGGCTGGAGCTGG - Intergenic
936319492 2:111454492-111454514 CTGAAGGCAGAGGCCTCAGCAGG + Intergenic
936869063 2:117110682-117110704 CTGAGGCCAGTGGCAAGAGCAGG + Intergenic
937093644 2:119222771-119222793 CGGAGGCCAGAGGCAGGAGCTGG - Intergenic
937207031 2:120243428-120243450 CTGGAGCCATGGGGAGGAGCAGG + Intronic
937337039 2:121068551-121068573 CTGAAGCCAGGGGATGAAGTGGG + Intergenic
938047898 2:128139701-128139723 CTGAACCCAGGCGCCACAGCAGG - Intronic
941542653 2:166805928-166805950 CTGAGTCCAGGGGATGGAGCTGG - Intergenic
943360701 2:186915565-186915587 GTGAACCCAGGAGGCGGAGCTGG + Intergenic
945229627 2:207572143-207572165 TTGAACCCAGGAGGCGGAGCTGG + Intronic
946063018 2:216961089-216961111 CTGTGGCCAGGGGCCAGGGCTGG + Intergenic
946400187 2:219464502-219464524 CTGCAGCCAGGATCCGCAGCCGG - Exonic
946422483 2:219572425-219572447 CAGCTGCCAGGGGCTGGAGCTGG + Exonic
946904743 2:224405531-224405553 AGGAAGCCAGGGGCCTGATCAGG + Intergenic
947732544 2:232439331-232439353 CTGAAGCCAGGGCAGGGGGCAGG + Intergenic
948189273 2:236045624-236045646 CTGAAGCCAGGTGGAGGGGCAGG + Intronic
1168760667 20:347689-347711 CGGAAGCCAGGGCCCGAAGATGG - Intronic
1168836239 20:879689-879711 CTGAAACCTGGGGCTGGGGCTGG - Intronic
1169483510 20:6006475-6006497 CCCAGGCCAGCGGCCGGAGCGGG + Exonic
1169750067 20:8982518-8982540 CTGTTGCCAGGGGCTGGGGCTGG + Intergenic
1170813001 20:19689413-19689435 CTGAAGCCAGGGGCCGGAGCTGG - Intronic
1171972530 20:31573170-31573192 CTGGAGCCAGGCGCCGGCCCGGG - Intronic
1172342445 20:34168974-34168996 GTGAACCCAGGAGGCGGAGCTGG + Intergenic
1173482749 20:43416255-43416277 CTGAAGCCCGGTGCTGGAGAGGG - Intergenic
1173740193 20:45394849-45394871 CAGGAGCCACAGGCCGGAGCAGG + Intronic
1174061141 20:47833898-47833920 CTGGAGACAGGGGGAGGAGCCGG - Intergenic
1174070635 20:47896801-47896823 CTGGAGACAGGGGGAGGAGCCGG + Intergenic
1174100466 20:48122928-48122950 CTGGAGACAGGGGGAGGAGCCGG - Intergenic
1174309095 20:49636512-49636534 CTGCAGCCAGAGGATGGAGCAGG + Intronic
1175183808 20:57166484-57166506 GTGAACCCAGGAGGCGGAGCTGG + Intergenic
1175442418 20:59001250-59001272 CTGCAGCGAGAGGCTGGAGCTGG + Intronic
1175458842 20:59135648-59135670 GTGAACCCGGGGGGCGGAGCTGG + Intergenic
1175713123 20:61236892-61236914 CTGAATCCAAGGGCATGAGCTGG - Intergenic
1175744014 20:61441302-61441324 CTGAAGCCAAGGGGCTGACCTGG - Intronic
1175764068 20:61581074-61581096 CTGTAGGCAGGGGAGGGAGCAGG + Intronic
1176366346 21:6035212-6035234 CAGCAGCCAGGGGCAGGCGCTGG - Intergenic
1176977240 21:15335481-15335503 CTGAATCCAGGGGCCTGAGTAGG - Intergenic
1177538512 21:22461420-22461442 GTGAACCCGGGGGGCGGAGCTGG - Intergenic
1177637299 21:23803875-23803897 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
1177913700 21:27061622-27061644 ATGAACCCAGGAGGCGGAGCTGG + Intergenic
1179757171 21:43503333-43503355 CAGCAGCCAGGGGCAGGCGCTGG + Intergenic
1179797432 21:43793514-43793536 CTGAAGCCAGGGGTGGGAGGTGG + Intronic
1180059041 21:45375341-45375363 CTGAGTCCAGCGGCCGTAGCAGG + Intergenic
1181258953 22:21583569-21583591 CTGAAGTCAGTGCCAGGAGCAGG - Intronic
1181412036 22:22730884-22730906 CTGAGGCCAGTGGCTAGAGCAGG + Intergenic
1181863881 22:25840303-25840325 CTGAAGCCAGGGCCCAGAGGTGG - Intronic
1182291272 22:29281659-29281681 GTGAACCCAGGAGGCGGAGCTGG - Intronic
1182581691 22:31316950-31316972 GTGAACCCAGGAGGCGGAGCTGG + Intergenic
1182588790 22:31363119-31363141 GTGAACCCAGGAGGCGGAGCTGG + Intergenic
1182676155 22:32041637-32041659 CTGAACCCAGGTGCAGGTGCAGG - Intergenic
1182893334 22:33837710-33837732 CTGAAGCCTATGGCCAGAGCCGG + Intronic
1183205980 22:36419256-36419278 CCGGAGCCAGGGGCTGGGGCTGG + Intergenic
1183667892 22:39255736-39255758 CTGGAGGCAGGGGACGGGGCAGG + Intergenic
1183913932 22:41101490-41101512 ATGAACCCAGGAGGCGGAGCTGG - Intronic
1184058041 22:42065760-42065782 CTGCAGCCAGTGGCCGGCCCTGG - Exonic
1184252800 22:43270428-43270450 CTGAACCCAGCGGACAGAGCTGG + Intronic
1184344245 22:43903300-43903322 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
1184502033 22:44880155-44880177 CAGAAGCCAGGGGCAGGTGAAGG + Intergenic
1184636838 22:45839407-45839429 CTGAAGCCTGGGGCTGCAGGGGG + Intronic
1184764424 22:46564154-46564176 CTGGTGGCAGGGGCCGGGGCTGG + Intergenic
1185078018 22:48693719-48693741 CAGAAACCAAGGCCCGGAGCAGG - Intronic
1185113998 22:48920814-48920836 CTGAAGCCAGTGCCAGGAGGGGG + Intergenic
1185114911 22:48927246-48927268 CTGAACCCAGGGGCTGGAGTTGG + Intergenic
1185227738 22:49662724-49662746 CTGAAAACATGGGCTGGAGCAGG + Intergenic
1185321449 22:50201825-50201847 CCAAACCCAGGGGCGGGAGCCGG + Intronic
950158726 3:10743164-10743186 ATGAAGCCAGGGGCCAGGTCTGG + Intergenic
950215489 3:11155399-11155421 AGGAAGCCAGGAGCAGGAGCTGG + Intronic
950508443 3:13410835-13410857 GTGAACCCAGGAGGCGGAGCTGG + Intronic
951509602 3:23486540-23486562 CAGGAGCCATGGGCCGGAGCAGG - Intronic
952525453 3:34205686-34205708 GTGAACCCAGGAGGCGGAGCTGG + Intergenic
952817930 3:37461892-37461914 CTGGAGCCTGGGGTGGGAGCTGG - Intronic
952867606 3:37864241-37864263 CTGACTCCAGGAGCAGGAGCAGG + Intronic
954128035 3:48543674-48543696 CTGGAGCCAGGGTCGGGTGCTGG - Intronic
954808310 3:53232795-53232817 CTGGAGCAGGTGGCCGGAGCTGG + Intronic
955352723 3:58205935-58205957 CTGCAGCCATGGGCATGAGCGGG - Intronic
956006304 3:64782050-64782072 ATGAACCCAGGAGGCGGAGCTGG + Intergenic
956221103 3:66904269-66904291 CTGAAGGCAGGAGACCGAGCTGG - Intergenic
956558134 3:70543670-70543692 CTGGAGCCATGGGCCAGAGTGGG - Intergenic
956576464 3:70757809-70757831 CTGAAGCCAAGCTCCTGAGCAGG - Intergenic
957964051 3:87299361-87299383 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
958131814 3:89436088-89436110 CTAAAGCCTGGGGATGGAGCAGG + Intronic
958165847 3:89877222-89877244 CTGAAGCCAGAGGCTGGAGGAGG + Intergenic
959974552 3:112443972-112443994 CTGAACCCGGGAGGCGGAGCTGG + Intergenic
960061400 3:113325523-113325545 GTGAACCCAGGAGGCGGAGCTGG - Intronic
960397933 3:117159742-117159764 TTGAACCCAGGGGGTGGAGCTGG + Intergenic
961780163 3:129316392-129316414 GAGAAGCCAGCGGCCGGAGAAGG - Intergenic
962249840 3:133829163-133829185 CTGAGGCCAGGGCTGGGAGCTGG - Intronic
963737475 3:149036052-149036074 GTGAACCCAGGAGGCGGAGCTGG + Intronic
963870316 3:150408759-150408781 CGGGAGCCGCGGGCCGGAGCTGG - Exonic
964203186 3:154141040-154141062 GTGAACCCAGGAGGCGGAGCTGG - Intronic
965768909 3:172160127-172160149 CTGAAGCCAAGGGCAGCAGTGGG + Intronic
966510343 3:180755277-180755299 CTGAACCCAGGAGGCGGAGATGG + Intronic
966785468 3:183619124-183619146 CTGAGGACAGGGCCCAGAGCTGG - Intergenic
966887027 3:184382508-184382530 CTGCAGCCAGGGCCCGGTGCCGG - Exonic
968133776 3:196207802-196207824 GTGGAGCCAGGGGACGGGGCGGG - Intronic
968344235 3:197987238-197987260 GTGAACCCAGGAGGCGGAGCTGG - Intronic
968427992 4:535759-535781 CAGAAGCCAGAGGGCGGAGCGGG - Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968579937 4:1385136-1385158 CTGAAGCCCATGGCAGGAGCTGG + Intronic
968689955 4:1985306-1985328 CTGAGGCCAGGGCCTGGAGGAGG - Intronic
968770795 4:2505404-2505426 GTGAACCCAGGAGGCGGAGCTGG - Intronic
969395217 4:6916156-6916178 CGGAAGTCAGTGGCCAGAGCTGG + Intronic
969448330 4:7257971-7257993 CTGTAGCCATGGGCCAGGGCTGG - Intronic
969466043 4:7357034-7357056 CTGCAGGGAGGGGCTGGAGCTGG + Intronic
971028444 4:22611011-22611033 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
971826929 4:31635694-31635716 GTGAAGCCAGAGGCCTGAGCTGG + Intergenic
972514566 4:39800047-39800069 CTGAATCCGGGAGGCGGAGCTGG - Intergenic
973101991 4:46283838-46283860 ATGAACCCAGGAGGCGGAGCTGG - Intronic
973608105 4:52607754-52607776 CAGAAGCCAGGGGTTGGAGGAGG - Intronic
974885248 4:67809831-67809853 CTCCAGCCAGGGGCTCGAGCTGG + Intergenic
974910669 4:68115274-68115296 GTGAACCCAGGAGGCGGAGCTGG + Intronic
974936114 4:68411509-68411531 CTGAAGTCATGTACCGGAGCCGG - Intergenic
975237014 4:72011182-72011204 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
976505234 4:85838516-85838538 GTGAACCCAGGAGGCGGAGCTGG + Intronic
977492747 4:97734990-97735012 ATGAACCCAGGAGGCGGAGCTGG + Intronic
979136672 4:117118772-117118794 CAGGAGCCATGGGCTGGAGCAGG - Intergenic
980027327 4:127782206-127782228 CCGAAGTCCGGGCCCGGAGCTGG + Exonic
980481610 4:133395167-133395189 CTGGAGCCACGGGCTGGAGAGGG + Intergenic
981764973 4:148238970-148238992 CTGAGTCCAAGGGCCGGAGGTGG + Intronic
981815326 4:148824699-148824721 CCGAATCCAGGGGCAGGAGCAGG - Intergenic
982063182 4:151625020-151625042 CTGCAGCCAAGGGCAGCAGCTGG - Intronic
982668207 4:158291702-158291724 CTGGTTCCAGGGGCAGGAGCTGG + Intergenic
982758655 4:159253885-159253907 GTGAACCCAGGAGGCGGAGCTGG + Intronic
985802348 5:2013022-2013044 CTGCTGCCAGGGGCCCCAGCGGG + Intergenic
985894364 5:2739936-2739958 CTGAAGCCCGGGACCAGAGCTGG + Intergenic
986729695 5:10626100-10626122 CCGCAGCCAGGGGCCGGAGTGGG + Intronic
987114777 5:14717534-14717556 GTGAAGGCAGGGTCCAGAGCAGG + Intronic
988065805 5:26228180-26228202 CTGAAGACCCGGGCAGGAGCTGG - Intergenic
988573691 5:32397936-32397958 GTGAACCCAGGAGGCGGAGCTGG - Intronic
989147002 5:38258781-38258803 TGGAAGCCAGGAGCAGGAGCCGG - Exonic
990376563 5:55176538-55176560 CAGAAGCTAGGGGCGGGAGCGGG - Intergenic
991702393 5:69328872-69328894 GTGAACCCAGGAGGCGGAGCTGG - Intronic
992029477 5:72707381-72707403 CTGAGTCTAGGGGCTGGAGCTGG - Intergenic
994031317 5:95147165-95147187 ATGAACCCAGGAGGCGGAGCTGG - Intronic
994670124 5:102754580-102754602 CTGAATCCAGGGGCCGGGCAAGG + Intronic
996363028 5:122671482-122671504 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
996549585 5:124716060-124716082 CTGAACCCGGGAGGCGGAGCTGG + Intronic
997365667 5:133323681-133323703 CTGAGGCCAGGGCCAGGGGCTGG - Intronic
998062874 5:139132911-139132933 CTTATGCCAGGGACCGCAGCTGG - Intronic
998451640 5:142239079-142239101 GTGAACCCAGGAGGCGGAGCTGG + Intergenic
998488921 5:142528960-142528982 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
998699986 5:144687272-144687294 ATGAACCCAGGAGGCGGAGCTGG - Intergenic
999378884 5:151106148-151106170 CTGCAGCCAGGGTAGGGAGCAGG - Intronic
999661136 5:153863864-153863886 CTGCAGTCAGGGGCTTGAGCTGG - Intergenic
1001704783 5:173733982-173734004 CTGCTGGCAGGCGCCGGAGCCGG + Intergenic
1001908433 5:175493170-175493192 ATGAAGCCAGGAGGCAGAGCCGG + Intronic
1001999628 5:176190449-176190471 CAGAACCCAGGGGCCGGGGGAGG + Intergenic
1002181373 5:177432750-177432772 CTGCACCCAGCGGCTGGAGCAGG + Exonic
1002184590 5:177448112-177448134 CTGAAGCCCGCGGTCGGGGCTGG - Intronic
1002418728 5:179134735-179134757 CTGGAGCCGGGAGCTGGAGCTGG - Intronic
1002418803 5:179134946-179134968 CTGGAGCCGGGAGCTGGAGCTGG - Intronic
1002418880 5:179135165-179135187 CTGGAGCCGGGAGCTGGAGCTGG - Intronic
1002720147 5:181254207-181254229 ATGAATCCAGGAGGCGGAGCTGG + Intergenic
1002824524 6:761047-761069 TTGAACCCGGGGGGCGGAGCAGG + Intergenic
1003416200 6:5910644-5910666 CTGGAAGCAGGGGCTGGAGCAGG - Intergenic
1003590317 6:7431816-7431838 CCTAAGCCAGGGGGAGGAGCTGG + Intergenic
1005345295 6:24883452-24883474 CTGAGGCCAGGGACGGGAGCAGG + Intronic
1006592984 6:35171747-35171769 GTGAAGGCAGTGGCAGGAGCTGG - Intergenic
1006712694 6:36088639-36088661 GTGAACCCAGGAGGCGGAGCTGG + Intronic
1006763610 6:36485572-36485594 GTGAACCCAGGAGGCGGAGCTGG - Intronic
1006907956 6:37545655-37545677 CTGGGGCCAGGGGCAGGACCAGG + Intergenic
1006991571 6:38219213-38219235 TTGAACCCAGGAGGCGGAGCTGG - Intronic
1007175475 6:39893435-39893457 ATGAACCCAGGAGGCGGAGCTGG + Intronic
1007412986 6:41675446-41675468 CTCAGGGCAGGGGCCAGAGCTGG - Intergenic
1007652903 6:43434200-43434222 CTCAAGCCGGGGGCCGGAACTGG + Intronic
1008683569 6:53900116-53900138 GTGAACCCAGGAGGCGGAGCTGG - Intronic
1010044179 6:71420870-71420892 CTGGAGCCAGGGGGCGGAGCGGG - Intergenic
1011675596 6:89730276-89730298 CAGATGCCAGGGACCGGATCAGG + Intronic
1012427678 6:99131917-99131939 CTGATGGCAGGTCCCGGAGCAGG - Intergenic
1012503883 6:99922185-99922207 ATGAACCCAGGAGGCGGAGCTGG - Intronic
1013322606 6:109009511-109009533 CTGCAGCCAGGAGCCGCGGCCGG - Intronic
1014214145 6:118736748-118736770 CTGGAGCCAGAGGCTGGGGCTGG + Intergenic
1015536175 6:134269575-134269597 TTGAACCCAGGAGCCGGAGGTGG + Intronic
1015942620 6:138467231-138467253 GTGAACCCGGGGGGCGGAGCCGG - Intronic
1018085760 6:160300193-160300215 CTGAAGGCTGGGGCGGGGGCGGG - Intergenic
1018807004 6:167269685-167269707 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
1018954031 6:168395992-168396014 CTGAGGCCACGGGCCTGAGATGG - Intergenic
1020310857 7:6867469-6867491 CTGAAGCCAGGATGCTGAGCAGG + Intergenic
1020477641 7:8616970-8616992 CTGAAGCCAGTGGCCCAAGCTGG - Intronic
1020774627 7:12437316-12437338 CTGAAGCCAGGTCTCGCAGCTGG - Intergenic
1020819198 7:12944571-12944593 ATGAACCCAGGAGGCGGAGCTGG - Intergenic
1023027098 7:36060600-36060622 ATGAACCCAGGAGGCGGAGCTGG + Intergenic
1023230727 7:38025315-38025337 CAGAAGCCAGAGGCTGGAGCCGG - Intronic
1023316688 7:38944809-38944831 ATGAACCCAGGAGGCGGAGCTGG + Intergenic
1023705036 7:42932344-42932366 CTGAAAGCAGGGGCGGGACCGGG + Exonic
1023934539 7:44730099-44730121 CTGGAGCCACGGGCCAGAGTGGG + Intergenic
1024116132 7:46195616-46195638 CTGAAGACAGGGGTTGGATCTGG - Intergenic
1025233160 7:57216466-57216488 CTGGAGCCTGGGGGTGGAGCTGG + Intergenic
1026168806 7:67934891-67934913 CTTGAGCCAGGGGGCGGAGGTGG + Intergenic
1027184784 7:75964386-75964408 CTGAAGCCGGGAGGCGGAGGTGG - Intronic
1028364657 7:90013353-90013375 CTGGAGCCAGGGTCAGGGGCTGG - Intergenic
1029191649 7:98776247-98776269 CTGAAGCCAGGGGCAGCTGTGGG - Intergenic
1029318994 7:99740620-99740642 ATGAAGCCAGGGCATGGAGCAGG + Intergenic
1029366834 7:100121967-100121989 GTGAACCCAGGAGGCGGAGCTGG + Intronic
1029486595 7:100846484-100846506 ATGAACCCAGGAGGCGGAGCTGG + Intronic
1029492878 7:100881875-100881897 CTGAAGCCAGGGAGCGGGTCAGG + Intronic
1029722801 7:102380991-102381013 ATGAACCCAGGGGGCAGAGCTGG - Intronic
1032214221 7:129944273-129944295 GTGAACCCAGGAGGCGGAGCTGG + Intronic
1032254393 7:130285472-130285494 TTGAAGCCAGGAGGCGGAGGTGG - Intronic
1033669952 7:143482072-143482094 CTGCAGCCAGGAGCTAGAGCTGG + Intergenic
1034274045 7:149816326-149816348 GTGAGGGCCGGGGCCGGAGCAGG + Intergenic
1034415566 7:150962760-150962782 CTGATGGCAGGGGCTGGGGCGGG + Intronic
1034418770 7:150978340-150978362 CGGGAGGCGGGGGCCGGAGCCGG - Intergenic
1034762303 7:153684378-153684400 ATGAAGGCAGGGGCCTCAGCTGG + Intergenic
1035983796 8:4402898-4402920 ATGAACCCAGGAGGCGGAGCTGG - Intronic
1036145896 8:6254297-6254319 GAGAAGCCAGGGTCCTGAGCGGG - Intergenic
1036772558 8:11589057-11589079 TTGAACCCAGGGGGCGGAGGTGG + Intergenic
1039585004 8:38699657-38699679 CTGAACCCAGGAGGCGGAGCTGG - Intergenic
1041151930 8:54944172-54944194 CAGGAGCCATGGGCTGGAGCAGG - Intergenic
1042582001 8:70290267-70290289 GTGAACCCAGGAGGCGGAGCTGG - Intronic
1044377611 8:91494858-91494880 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
1045124235 8:99072013-99072035 CAGAAGCCAGGGTCTGGAACTGG + Intronic
1045305154 8:100951715-100951737 CGGAAGCAAGGAGCCGGAGGCGG + Intronic
1045897177 8:107233616-107233638 CTGAAGGCAGGGGCCAGATCGGG - Intergenic
1046167159 8:110451733-110451755 TTGAACCCAGGAGCAGGAGCAGG + Intergenic
1046339268 8:112830865-112830887 ATGAACCCAGGAGGCGGAGCTGG - Intronic
1046354616 8:113065465-113065487 GTGAACCCAGGAGGCGGAGCTGG - Intronic
1047426997 8:124755525-124755547 TTGTAGCCAGGGCCCGAAGCTGG + Intergenic
1047749946 8:127872882-127872904 CTGAAGCAAGGGGCAGGCGTGGG - Intergenic
1047776967 8:128079803-128079825 TTGAACCCAGGAGGCGGAGCTGG - Intergenic
1048238460 8:132716188-132716210 GAGAGGCCAGGGGCAGGAGCAGG - Intronic
1049395598 8:142398737-142398759 CTGATGGCAGGGGCAGGGGCTGG + Intronic
1049592621 8:143469447-143469469 CTGAAGCCCTGGGCTGGCGCTGG + Intronic
1049720044 8:144111518-144111540 CTGACGGCTGGGGCCTGAGCCGG - Intronic
1049775502 8:144402021-144402043 TTGGACCCAGGGGCCGGGGCTGG - Intronic
1049787022 8:144455911-144455933 CTGTGGCCAGGGGCCGGCCCAGG - Intronic
1050008426 9:1159410-1159432 CTGAAGTGAGGGGAAGGAGCTGG + Intergenic
1050283348 9:4075493-4075515 GTGAACCCAGGAGGCGGAGCTGG + Intronic
1051287732 9:15513388-15513410 CTGAAGCAAGGGGAGGGGGCAGG + Intergenic
1052892838 9:33719989-33720011 CGGAAGCCAGGGGCAGGGGCTGG + Intergenic
1053314228 9:37037851-37037873 CGAAAGCCTGTGGCCGGAGCTGG + Intergenic
1054450902 9:65403226-65403248 CTGAAGACATGGGCCCCAGCCGG + Intergenic
1056961087 9:91123868-91123890 GTGAACCCAGGAGGCGGAGCTGG + Intergenic
1057168146 9:92944368-92944390 GTGAACCCAGGAGGCGGAGCTGG - Intergenic
1057353803 9:94319636-94319658 CCTAAGCCAGGAGCTGGAGCAGG - Exonic
1057653948 9:96937956-96937978 CCTAAGCCAGGAGCTGGAGCAGG + Exonic
1059438468 9:114289897-114289919 TGGAAGCCTGGGGCCAGAGCTGG - Intronic
1060521664 9:124297541-124297563 CTAAAGCCAGGAACCTGAGCTGG + Intronic
1061043865 9:128153984-128154006 CTGAAGCCAGGGGCAGGGCCAGG + Intergenic
1061044231 9:128155944-128155966 CTGGAGCCACAGGCCAGAGCAGG + Intergenic
1061370329 9:130194102-130194124 CTGAAGCCAGCGCCGGGAGGGGG + Intronic
1061818323 9:133208934-133208956 CCGAGGCCCAGGGCCGGAGCAGG - Intronic
1062035358 9:134380362-134380384 CAGGAGCCAGGGGCCAGATCAGG + Intronic
1062242128 9:135546424-135546446 CCGAGGCCCAGGGCCGGAGCAGG + Intronic
1062347343 9:136121095-136121117 CTGCAGCCAGGGGCGGATGCAGG + Intergenic
1062428292 9:136516088-136516110 GTGAAGCCTGGGGCCGGGGAGGG + Exonic
1185596908 X:1312791-1312813 CTGAAGCAAGGGGCCGGCTGGGG - Intergenic
1186033012 X:5390813-5390835 TTGGAGTCATGGGCCGGAGCAGG - Intergenic
1186094401 X:6083891-6083913 CTGAAGCTAGTGGCCTGAGCTGG + Intronic
1186708560 X:12168704-12168726 GTGAACCCAGGAGGCGGAGCTGG - Intronic
1187314885 X:18183874-18183896 CAGAAACCAGGGCCTGGAGCTGG - Intronic
1187707035 X:22019399-22019421 TTGAAGCCAGGACCCAGAGCAGG - Intergenic
1188040598 X:25366686-25366708 CTGAAGTCAGGGCCTGGAACCGG + Intergenic
1189380588 X:40499891-40499913 CAGAACGCAGGGGCCTGAGCGGG - Intergenic
1190056866 X:47186199-47186221 CTGGAGCCCGGGGCCGGGGCCGG + Intronic
1190264484 X:48819622-48819644 ATGAACCCAGGAGGCGGAGCTGG - Intronic
1190389508 X:49918245-49918267 CTGAACCCAGGAGGCGGAGGTGG - Intergenic
1192260121 X:69501146-69501168 CTAAAGCCAGGGGATGGAGGCGG - Intergenic
1193589681 X:83373722-83373744 GTGATGCCAGGGGCTGGAGAGGG - Intergenic
1195104910 X:101594133-101594155 CTGAAACCAGGGGGCCAAGCAGG - Intergenic
1195614876 X:106904119-106904141 CTGAGGCCTGGGGCTGGGGCTGG - Intronic
1195747528 X:108133790-108133812 CTTAACCCAAGGGCTGGAGCTGG - Intronic
1196973674 X:121136335-121136357 CTGAACCCAGGAGGCGGAGCTGG + Intergenic
1197209016 X:123814165-123814187 GTGAACCCAGGAGGCGGAGCTGG + Intergenic
1197638799 X:128945603-128945625 ATGAATCCAGGAGCTGGAGCTGG - Intergenic
1199903330 X:152199283-152199305 GTGAACCCAGGAGGCGGAGCTGG + Intronic
1200039152 X:153353398-153353420 GAGAAGTCAGGGGCAGGAGCAGG + Intronic
1200061876 X:153487400-153487422 CTGAGGCCTGGGGCAGGGGCTGG + Intronic
1200103158 X:153698371-153698393 CTGGAGCCAGGGGAGGGACCTGG + Intergenic
1200415374 Y:2904389-2904411 ATGAACCCAGGAGGCGGAGCTGG + Intronic
1200691422 Y:6308497-6308519 CTCAAGGCAGGGGAGGGAGCTGG - Intergenic
1201043850 Y:9866219-9866241 CTCAAGGCAGGGGAGGGAGCTGG + Intergenic