ID: 1170813906

View in Genome Browser
Species Human (GRCh38)
Location 20:19696924-19696946
Sequence GTGGCAATGGGGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1204
Summary {0: 1, 1: 1, 2: 11, 3: 107, 4: 1084}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170813894_1170813906 9 Left 1170813894 20:19696892-19696914 CCTCATTGTGGCCAGACAAGGTG 0: 1
1: 1
2: 5
3: 42
4: 208
Right 1170813906 20:19696924-19696946 GTGGCAATGGGGAAGGAGGGAGG 0: 1
1: 1
2: 11
3: 107
4: 1084
1170813890_1170813906 26 Left 1170813890 20:19696875-19696897 CCTGACTGCATGGCCAGCCTCAT 0: 1
1: 2
2: 1
3: 30
4: 212
Right 1170813906 20:19696924-19696946 GTGGCAATGGGGAAGGAGGGAGG 0: 1
1: 1
2: 11
3: 107
4: 1084
1170813897_1170813906 -2 Left 1170813897 20:19696903-19696925 CCAGACAAGGTGGGACTTCCAGT 0: 1
1: 0
2: 0
3: 12
4: 250
Right 1170813906 20:19696924-19696946 GTGGCAATGGGGAAGGAGGGAGG 0: 1
1: 1
2: 11
3: 107
4: 1084
1170813892_1170813906 13 Left 1170813892 20:19696888-19696910 CCAGCCTCATTGTGGCCAGACAA 0: 1
1: 0
2: 2
3: 10
4: 119
Right 1170813906 20:19696924-19696946 GTGGCAATGGGGAAGGAGGGAGG 0: 1
1: 1
2: 11
3: 107
4: 1084

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170813906 Original CRISPR GTGGCAATGGGGAAGGAGGG AGG Intronic
900611562 1:3546634-3546656 GTGGCAATGGGCTGGGAAGGGGG + Intronic
900762790 1:4484013-4484035 GATGCAAGGGTGAAGGAGGGAGG + Intergenic
900781024 1:4617267-4617289 GAGGCAGTGGGGCAGGAAGGTGG + Intergenic
901197799 1:7449948-7449970 GTGGCTTGGGGGTAGGAGGGAGG + Intronic
901251525 1:7783751-7783773 CTGGAAATGGGGACGGATGGGGG - Intergenic
901462865 1:9401915-9401937 GGGGCGAAGGGGAGGGAGGGAGG + Intergenic
901564976 1:10106525-10106547 GTGGCACTGGGTGAGGCGGGTGG - Exonic
901659229 1:10788372-10788394 GAGGCAGGGGGGCAGGAGGGAGG - Intronic
901666260 1:10827986-10828008 GAGGGGATGGGGAAGAAGGGTGG + Intergenic
901731720 1:11284915-11284937 TTGGTAAGGGGGATGGAGGGTGG + Intronic
901741560 1:11345299-11345321 GAGGCCACGGGGAAGGAGGTGGG + Intergenic
901765333 1:11496468-11496490 GTGGCCATGGGGGTGGAGTGAGG - Intronic
901861187 1:12075618-12075640 ATGGCAAAGGGGAATCAGGGTGG - Intronic
902070245 1:13728494-13728516 GGGGCTGTGGGGAAGAAGGGAGG + Intronic
902079632 1:13812247-13812269 GTGGCAATGGGAGTGGAGAGAGG + Intronic
902465824 1:16617926-16617948 TTGGGGATGGGGAGGGAGGGAGG + Intergenic
903023662 1:20411791-20411813 GAGGCAGTGGGGATGGTGGGAGG - Intergenic
903240720 1:21980975-21980997 GTGATGATGGGGAAGGAGGGAGG + Intronic
903244460 1:22005598-22005620 GTGATGATGGGGAAGGAGGGAGG + Intronic
903313287 1:22477885-22477907 GTGGGAAAGGGGAAGAAGGAAGG - Intronic
903406770 1:23103896-23103918 GAGGGAGGGGGGAAGGAGGGAGG + Intronic
903406940 1:23105200-23105222 GTAGCAATGGGGTAAAAGGGTGG + Intronic
903858158 1:26349399-26349421 GTGGCCTGGGGGTAGGAGGGAGG - Intronic
904024470 1:27493531-27493553 GTGGCAGTGGGGAGGAAGGGTGG + Intergenic
904608066 1:31709503-31709525 GTGGCAATGGCCAGGGAAGGTGG + Intergenic
904772029 1:32886120-32886142 GTGGGTATGGGGAAGGAAGCGGG + Intronic
904873221 1:33634840-33634862 GTGGCCAAGGAGCAGGAGGGAGG - Intronic
904911355 1:33936674-33936696 CTGGCAATAAGGAGGGAGGGAGG + Intronic
905002849 1:34686699-34686721 GTGTAAGTGGTGAAGGAGGGGGG + Intergenic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905313572 1:37066870-37066892 ATGAAGATGGGGAAGGAGGGAGG - Intergenic
905790764 1:40788040-40788062 GTGGGAATGGGGAGGGGAGGAGG + Intronic
905826717 1:41031313-41031335 GTGGCGGTGGGGGAGGGGGGTGG - Intronic
905866838 1:41381374-41381396 GTGGGAGTGGGGAGGGATGGGGG + Intronic
905883841 1:41481271-41481293 GTGGGGATGGGGAAGGGGTGGGG - Intronic
906104684 1:43284793-43284815 GTGGCCAGGGAGCAGGAGGGTGG - Intronic
906141945 1:43539202-43539224 GTGGCAGTGAGGATGGAGGCAGG + Intronic
906264865 1:44420995-44421017 ATGGCAATGTGGAAAGAGGGAGG + Intronic
906414393 1:45608956-45608978 GTTGCCTTGGGGAAGGTGGGGGG - Intronic
906703520 1:47877194-47877216 TTGGCAATGGGGCTGGGGGGTGG + Intronic
906716789 1:47975980-47976002 GGGGCAATGGAAAAGGAGGTTGG + Intronic
907325897 1:53638520-53638542 GGGGCAGTGGGGAACAAGGGAGG - Intronic
907697082 1:56742054-56742076 GTGGCAGTGGGGCTGGGGGGCGG + Intronic
908358472 1:63344908-63344930 GAGGAAAGGGGGAAAGAGGGAGG + Intergenic
908927449 1:69273373-69273395 GTGGCAATGGGAATGGAAGAGGG + Intergenic
909037453 1:70610188-70610210 GTGGGATTGGGGGAGGGGGGAGG - Intergenic
909324741 1:74336492-74336514 GTGGCATGGGGGGAGGGGGGAGG - Intronic
909350460 1:74646937-74646959 GAGGCATTGGGGAGGCAGGGAGG + Intronic
910876922 1:91886322-91886344 GAGGCAAAGGGGGAGGAGAGAGG - Intronic
910985686 1:93002667-93002689 GTGGGAATGGGAATAGAGGGAGG - Intergenic
911070105 1:93825639-93825661 TTGGCCCTGGGGAAGGAGGGTGG - Intronic
911087152 1:93988596-93988618 GTGGCAATGGGTGTGGGGGGGGG + Intergenic
911090628 1:94014317-94014339 GAGGGACGGGGGAAGGAGGGAGG + Intronic
911112999 1:94211896-94211918 GTGGGGTTGGGGGAGGAGGGAGG - Intronic
911781986 1:101892569-101892591 GTGGCAATGGGAGAGGAGGAAGG - Intronic
911924353 1:103809305-103809327 TTGCCAATGGTAAAGGAGGGAGG + Intergenic
912383604 1:109260572-109260594 GTGGGAAGGAGGGAGGAGGGAGG + Intronic
912415685 1:109507130-109507152 ATGGGAATGAGGAAGGAGTGAGG - Exonic
912432280 1:109635003-109635025 GGGGTGAGGGGGAAGGAGGGTGG + Intergenic
912432972 1:109639220-109639242 GGGGCAAGGTGGAAGGAGGAGGG + Intergenic
912699865 1:111869409-111869431 GTGGCACTGGGGATGGAAGAAGG - Intronic
912949935 1:114113685-114113707 GTGGCACTGGAGATGGAGAGAGG - Intronic
913173118 1:116249997-116250019 CTGGCTATGGTCAAGGAGGGGGG + Intergenic
913260005 1:116989268-116989290 GTGGACATGGGGCAGGTGGGTGG - Exonic
913301874 1:117379637-117379659 GAGGCTAGGGGGAAGCAGGGAGG - Intronic
913963675 1:143357556-143357578 GTGGGAAGGGGGAAGGGAGGGGG - Intergenic
913995756 1:143651147-143651169 TTGGGGGTGGGGAAGGAGGGAGG + Intergenic
914058034 1:144183145-144183167 GTGGGAAGGGGGAAGGGAGGGGG - Intergenic
914121111 1:144783220-144783242 GTGGGAAGGGGGAAGGGAGGGGG + Intergenic
914441646 1:147712872-147712894 GTGGCACTGGGGGAGGTTGGTGG - Intergenic
915117683 1:153610831-153610853 GGGGGAATGGGGCAGGCGGGAGG - Intronic
915128480 1:153681359-153681381 CTGGGAATAGGGAAGGATGGAGG - Intronic
915135311 1:153727785-153727807 GAGGCGATGAGGAAGGAGAGAGG - Intergenic
915254376 1:154614804-154614826 GAGGCAAAGGGGTAGGATGGAGG + Intronic
915254653 1:154617240-154617262 GTGGCAATGAGGGATGAGGTAGG - Intronic
915274014 1:154775717-154775739 GCTGCACTGGGGAAGGAGGAGGG - Intronic
915459154 1:156059482-156059504 ATGGCACTGGGGAAGGGGGCTGG - Intergenic
915483676 1:156204992-156205014 GTGGCCAGGGAGAAGTAGGGAGG - Intronic
915523282 1:156460950-156460972 TTGGAAACGGGGAAGGTGGGGGG + Intergenic
915531546 1:156505119-156505141 GGGGCAAGAGAGAAGGAGGGAGG - Intergenic
915594306 1:156887659-156887681 GGGGTACTGGGGAGGGAGGGAGG - Intergenic
915793524 1:158701940-158701962 GTGGCAATGAAGACAGAGGGAGG - Intergenic
916314005 1:163427499-163427521 GGGGCAGTGGGGAAGGACCGAGG - Intergenic
916344102 1:163769068-163769090 ATTGCAATGGTGAAGGAGGCAGG + Intergenic
916611360 1:166395148-166395170 GGGGGAAAGGGGAAGGAGGAGGG + Intergenic
916811037 1:168306060-168306082 GTGTCACTGAGGAAGGAAGGAGG - Intronic
916817565 1:168368479-168368501 GAGATAATGGGGAAGGAAGGAGG + Intergenic
918339140 1:183552880-183552902 ATGGAGATGGGGCAGGAGGGTGG - Intronic
919799960 1:201348067-201348089 GTGGAAATGGGGAGAGAGTGTGG + Intergenic
919887401 1:201944797-201944819 GTAGCAATGGGAAAGAAGGGAGG - Intronic
920069535 1:203292287-203292309 CTGGAAGTGGGGATGGAGGGTGG + Intergenic
920244025 1:204574752-204574774 GGGGAATTGGGGAAGGAGGGAGG - Intergenic
920417130 1:205806323-205806345 GTGGCCTTGGGGAAGTAGAGTGG - Intronic
921165345 1:212503059-212503081 GTGGACATGGGGCAGGAGGCTGG - Intergenic
921511749 1:216039984-216040006 GTGGGCAGGGGGAAAGAGGGAGG - Intronic
921806583 1:219462165-219462187 GAGGCAAGGGGAAAGGAGGGAGG + Intergenic
922020663 1:221700973-221700995 GTGACAATGGGGTGGGGGGGTGG + Intergenic
922020783 1:221702351-221702373 GAGACAATGAGGAAGGAGGATGG - Exonic
922226848 1:223652871-223652893 CTGCCAATGGAGAAGGAGGCTGG - Intronic
922427706 1:225514805-225514827 GGGGCCCTGGGGGAGGAGGGAGG + Exonic
922764275 1:228149426-228149448 GGAGCACTGGGGAAGGAGGGAGG - Intergenic
922845766 1:228682766-228682788 GTGGCAATGACGATGGATGGTGG - Intergenic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
923052151 1:230396405-230396427 GTGGGGATGGGGGAGGAGGGTGG - Intronic
923596007 1:235361318-235361340 GTTGCAAGAGGGAAGGAGTGGGG - Intergenic
924673624 1:246153398-246153420 CTGGAGATAGGGAAGGAGGGAGG + Intronic
1062972568 10:1660135-1660157 GGGGCGATGGAGGAGGAGGGTGG - Intronic
1063370389 10:5518111-5518133 GGGGATATGGGGAAGAAGGGAGG - Intergenic
1063753324 10:8977012-8977034 CTGGGGATGTGGAAGGAGGGGGG + Intergenic
1064227822 10:13503172-13503194 GTGGCAATGAGGGAGGAAGGTGG + Intronic
1064354793 10:14606700-14606722 GGGACAGAGGGGAAGGAGGGAGG - Intronic
1065391771 10:25189635-25189657 GTGGGGTTGGGGGAGGAGGGAGG + Intronic
1065915971 10:30355311-30355333 GTGGAAATGGGGCAGGAGAGAGG + Intronic
1066032445 10:31442407-31442429 GTGGCATGGGGGTAGGGGGGAGG + Intronic
1066342739 10:34551743-34551765 GTGGCCATGGGGAAGGAGAGAGG + Intronic
1067005796 10:42660648-42660670 GTGGCAATGAGTGAGGAGGCTGG + Intergenic
1067256500 10:44647532-44647554 GGGGCACTGGGGAAGAGGGGAGG - Intergenic
1067455953 10:46419363-46419385 GTGGGGGTGGGGAAGGAGAGTGG + Intergenic
1067631247 10:47965276-47965298 GTGGGGGTGGGGAAGGAGAGTGG - Intergenic
1067667259 10:48289034-48289056 GTGGGAAGGAGCAAGGAGGGTGG - Intergenic
1067684063 10:48456824-48456846 ACTGCAGTGGGGAAGGAGGGAGG - Intronic
1067757730 10:49017710-49017732 GTGCCAAATGGGAAGGAGAGGGG - Exonic
1068023209 10:51610267-51610289 GTGGCAGTGGGGATGAAGAGAGG - Intronic
1068169812 10:53378693-53378715 GTGACAATGGGAACGGAGAGTGG + Intergenic
1068688251 10:59890873-59890895 GTGGGGTTGGGGGAGGAGGGAGG - Intronic
1068958781 10:62845416-62845438 GGGGGAATGGGGAGGAAGGGTGG + Intronic
1069721091 10:70549789-70549811 TTGGCATTGGAGAAGGAAGGTGG + Intronic
1069933787 10:71901177-71901199 ATGGGAATGGGGAGGGAGAGAGG - Intergenic
1069959352 10:72070462-72070484 GTGACAATGAGGAAGGAGCAGGG + Intronic
1070209641 10:74302689-74302711 GTGGCACTGAGGTAGGAGGTTGG + Intronic
1070702465 10:78613557-78613579 GAGGAAAGGGGGAAGGAGGAAGG + Intergenic
1070836747 10:79452251-79452273 GTGGGAATGGAGGAGAAGGGAGG - Intergenic
1070909285 10:80103330-80103352 GAGGCAAAGGGGAAGAAGAGAGG + Intergenic
1071629224 10:87204403-87204425 GTGGGAGGGGGGAAGGTGGGGGG + Intergenic
1071703971 10:87976656-87976678 GTGGCCATGGAGTATGAGGGTGG + Intergenic
1071718454 10:88120025-88120047 GGGGGAAGCGGGAAGGAGGGGGG + Intergenic
1071984825 10:91039723-91039745 AGAGCAATGGGGAAGGAGGTGGG + Intergenic
1072306730 10:94114909-94114931 GTGGGATGGGGGAAGGGGGGAGG - Intronic
1072311419 10:94159760-94159782 GTGGGGAGGGGGAAGGAGGGAGG - Intronic
1072405986 10:95153367-95153389 GTGGGTTGGGGGAAGGAGGGAGG + Intergenic
1072440937 10:95454525-95454547 GTGGCAAAGTGGAAGGAGCCTGG - Intronic
1072526824 10:96279232-96279254 TTGGCAATGAGGTAGGAGGTGGG + Intergenic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1072910211 10:99494121-99494143 GTGGGGTTGGGGGAGGAGGGAGG + Intergenic
1073043691 10:100623853-100623875 GGGGTAAGGGGGAGGGAGGGAGG + Intergenic
1073047801 10:100651060-100651082 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047843 10:100651186-100651208 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047903 10:100651366-100651388 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047915 10:100651402-100651424 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047938 10:100651474-100651496 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073047957 10:100651528-100651550 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048005 10:100651675-100651697 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048022 10:100651720-100651742 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048039 10:100651765-100651787 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048056 10:100651810-100651832 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048073 10:100651855-100651877 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048090 10:100651900-100651922 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073048107 10:100651945-100651967 GTGGGAGTGGGGAAGGTGGTGGG - Intergenic
1073297506 10:102450124-102450146 GTGGGGAGGAGGAAGGAGGGAGG + Exonic
1073378079 10:103054175-103054197 GATGCCACGGGGAAGGAGGGAGG - Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073999690 10:109358140-109358162 ATGGAAATAGGGGAGGAGGGTGG - Intergenic
1074417590 10:113280772-113280794 GTGGTAGTAGGGGAGGAGGGAGG + Intergenic
1074418245 10:113286200-113286222 GTGTCATGGGGGAAGGAGGAAGG - Intergenic
1074568866 10:114606618-114606640 GGTGCAGTGGGGAAGGAAGGGGG - Intronic
1074774169 10:116754155-116754177 CTGGCAATGTGGTGGGAGGGAGG + Intergenic
1074959944 10:118434477-118434499 GTGGGGATGGGGGAGGGGGGAGG + Intergenic
1075122690 10:119675850-119675872 GGGGCAAGGGGGAAGGGGGCAGG - Intronic
1075161669 10:120029655-120029677 AGGGGAAGGGGGAAGGAGGGGGG + Intergenic
1075209375 10:120478080-120478102 GTGGCAAAGGGCAATGCGGGAGG - Intronic
1075656241 10:124163001-124163023 GAGGGAAGGGGGAAGGAGGGAGG + Intergenic
1076534636 10:131168771-131168793 GTGGCAATGACGGAGGAGGCCGG - Intronic
1076581794 10:131516987-131517009 GTGGCAATGGGAAGGGTGGTTGG - Intergenic
1077009605 11:374335-374357 GTGGCTGTGGGGATGGACGGGGG + Intronic
1077172782 11:1175424-1175446 GCAGCAAGGGGGAAGAAGGGAGG + Intronic
1077269378 11:1668058-1668080 GGGGGAGAGGGGAAGGAGGGAGG - Intergenic
1077282654 11:1752691-1752713 CTTGGGATGGGGAAGGAGGGTGG - Intronic
1077337226 11:2010832-2010854 GTGCACATGGGGAGGGAGGGAGG - Intergenic
1077484236 11:2831624-2831646 GGGGCAATGTGGAAGGAAGCGGG - Intronic
1077779259 11:5307641-5307663 GGGGGAAGGGGGAGGGAGGGAGG - Intronic
1077887022 11:6394082-6394104 GTGGGATAGGGGAAGGAGGTTGG + Intronic
1077999787 11:7484538-7484560 GTGGCCATATGGAAGAAGGGTGG + Intergenic
1078104856 11:8352021-8352043 GTTGCAATGGGGAAGGTGATGGG - Intergenic
1078120853 11:8507537-8507559 GTGGTAAAGGTGAAGGAGGAAGG + Intronic
1078375945 11:10793101-10793123 GTGACAGTGTTGAAGGAGGGAGG + Intergenic
1078426302 11:11253796-11253818 GACTCAATGGGAAAGGAGGGTGG + Intergenic
1078563116 11:12390295-12390317 GTGGGGATGGGGAAGGAGAGAGG + Intronic
1078742263 11:14077977-14077999 GTAGAAATGGGGAGAGAGGGCGG + Intronic
1079415193 11:20228156-20228178 TGGGCAAGGGGGCAGGAGGGTGG - Intergenic
1080019442 11:27544706-27544728 ATGGCAATGGGAGAGGAGGGAGG - Intergenic
1080392396 11:31860568-31860590 GTGGCAGAGGGGAAGGAGAGAGG + Intronic
1080466708 11:32504132-32504154 GGGGCATGGGGGAGGGAGGGAGG + Intergenic
1081067124 11:38557685-38557707 GTGGGAATTGAGAAGGAGGGTGG - Intergenic
1081747610 11:45483912-45483934 GAGGCATTGGGAAAGGTGGGAGG + Intergenic
1081761056 11:45576649-45576671 GCGGCCATGGGCAGGGAGGGAGG + Intergenic
1081776524 11:45679265-45679287 GAGGCGGTGGGGAGGGAGGGAGG + Intergenic
1081782609 11:45723573-45723595 GTGAGCATGGGTAAGGAGGGCGG + Intergenic
1081844740 11:46231833-46231855 GTTGCAGTGGGGAGAGAGGGAGG + Intergenic
1081979458 11:47257549-47257571 GAGGCAAGGGAGGAGGAGGGAGG + Intronic
1082132366 11:48506224-48506246 GAGGGAAGGGGGAAGGAAGGGGG - Intergenic
1082311474 11:50654457-50654479 GTGGGATTGGGGGAGGGGGGAGG + Intergenic
1082565829 11:54676844-54676866 GAGGGAAGGGGGAAGGAAGGGGG - Intergenic
1082598202 11:55111713-55111735 GTGGGATTGGGGGAGGGGGGAGG + Intergenic
1083737110 11:64687643-64687665 GTGGCAAGGAGGAGGGAAGGAGG + Intronic
1083913044 11:65721016-65721038 GGGGGGAGGGGGAAGGAGGGGGG - Intergenic
1084088357 11:66865052-66865074 TTGGAAGTGGGGATGGAGGGAGG + Intronic
1084148117 11:67275666-67275688 GGGCCAATGGGGCAGGAGAGAGG - Intronic
1084171587 11:67403785-67403807 GGGGCCATGGGGAAGGTGGGAGG + Intronic
1084192077 11:67503958-67503980 GTGGGAATGGGGAAGGACTGTGG - Intronic
1084922107 11:72479513-72479535 GTGGCCATGGTGATGGAGGCAGG + Intergenic
1084966968 11:72750094-72750116 TAGGAAATGGGGAAGGAAGGAGG - Intronic
1086263918 11:84975099-84975121 GTGAGAATGGGTAAGGAGGAGGG + Intronic
1086496616 11:87410605-87410627 GTGGCTATGGGGAGGGAGGGAGG - Intergenic
1086719906 11:90106900-90106922 GTGGCATGGAGGGAGGAGGGAGG + Intergenic
1086815275 11:91362676-91362698 GTGGCAGTTAGGATGGAGGGGGG - Intergenic
1087340761 11:96903972-96903994 GTGGGGTTGGGGGAGGAGGGAGG - Intergenic
1087963986 11:104389784-104389806 GAGACAAGGGGGAGGGAGGGAGG - Intergenic
1088369955 11:109078222-109078244 GTGGGGTTGGGGGAGGAGGGAGG - Intergenic
1088483505 11:110319313-110319335 GTGGAAAGGGTGAAGGAAGGAGG + Intergenic
1088641946 11:111881063-111881085 TTGGCAATGGGAATGGAGGGTGG + Intronic
1089033046 11:115353757-115353779 CTTGCATTGGGAAAGGAGGGTGG + Intronic
1089304838 11:117520051-117520073 GTGGCAATGAAGGAGGAGGTGGG + Intronic
1089357908 11:117867332-117867354 GTGGAGATGGGGAAGGAGAGAGG - Intronic
1089386030 11:118068627-118068649 GGGGCAAGGATGAAGGAGGGAGG + Intergenic
1090064106 11:123488668-123488690 GTGGCAACGGGGGAGGAGGAGGG - Intergenic
1090065457 11:123499486-123499508 GTGGCAAGGAGAAAGGTGGGTGG + Intergenic
1090271731 11:125390742-125390764 GTGGTACCGAGGAAGGAGGGTGG - Intronic
1090355046 11:126134686-126134708 GTGGAAATGGGGAAGGACATAGG - Intergenic
1090357071 11:126147236-126147258 GGGGCAGTAGGGAGGGAGGGAGG - Intergenic
1090383937 11:126345642-126345664 GTGGGATTGGGGGAGGAGTGGGG + Exonic
1091304878 11:134530549-134530571 GTGGCGGTGGGGGAGGAGGGTGG - Intergenic
1202820210 11_KI270721v1_random:66014-66036 GTGCACATGGGGAGGGAGGGAGG - Intergenic
1091566935 12:1655663-1655685 GTGGCAGTGGGGACAGAGGTGGG + Intergenic
1091651321 12:2312317-2312339 GTGGCAGTGGGGCAGGCGTGCGG + Intronic
1091912728 12:4244931-4244953 GGGGTGATGGGGAAGGAGGAGGG - Intergenic
1092044301 12:5418175-5418197 GTGGGGATGGGGCAGGAGTGAGG - Intergenic
1092210261 12:6641305-6641327 GTGCCCATGGGGGAGGAAGGAGG - Intronic
1092245003 12:6859073-6859095 GTAGCACTTGGGGAGGAGGGGGG + Intronic
1092696058 12:11172380-11172402 GTGGGAATGTTGAAGGAGGGCGG + Intergenic
1093151653 12:15628078-15628100 GGGGAAAAGGGGAGGGAGGGAGG + Intronic
1094291583 12:28856373-28856395 GAGGAATTGGGGAAGGGGGGTGG + Intergenic
1094730271 12:33166657-33166679 GTGGGGTTGGGGGAGGAGGGAGG - Intergenic
1095185105 12:39192415-39192437 GTGGGGTTGGGGAAGGGGGGAGG - Intergenic
1095218045 12:39573278-39573300 GTGGTGGTGGGGAAGGGGGGAGG - Intronic
1095250091 12:39968940-39968962 GTGGGGTGGGGGAAGGAGGGAGG - Intronic
1095362932 12:41365997-41366019 GTGGCAGTGGAGATGGAAGGAGG + Intronic
1095457275 12:42401501-42401523 GTGGCCATGGGGAGGGGGGAGGG + Intronic
1095886427 12:47193404-47193426 GTGGAAAGGGGGAAGGGGGCAGG - Intronic
1095954374 12:47798002-47798024 GTGGCAACTGGGGAGGAAGGAGG + Intronic
1095987803 12:48011036-48011058 GGGGGAATGGGACAGGAGGGAGG - Intergenic
1096010802 12:48212745-48212767 TGAGGAATGGGGAAGGAGGGTGG + Intergenic
1096110655 12:49027199-49027221 GTGCCAAGGGGGAAGGGGGCGGG + Exonic
1096146481 12:49282453-49282475 GTGGAAAGAGGGGAGGAGGGAGG - Intergenic
1096608619 12:52786296-52786318 GTGGGGTAGGGGAAGGAGGGAGG + Intergenic
1097171197 12:57114231-57114253 GTGAAAATGGCCAAGGAGGGAGG - Intronic
1097468242 12:59954134-59954156 GTGCCATGGGGGAAGGGGGGAGG + Intergenic
1097694683 12:62764823-62764845 GGGGCCATGGAGAAGGATGGAGG + Intronic
1097707480 12:62882902-62882924 GTGGCGGTGGGGGTGGAGGGTGG - Intronic
1098006933 12:66007518-66007540 GTGGGACAGGGGAAGGAGGGAGG - Intergenic
1098437313 12:70481668-70481690 GTGGCAGTGTGGAAGGTGGATGG + Intergenic
1098474997 12:70890398-70890420 GTGGCAATTGGGAATCAGGAAGG + Intronic
1099002854 12:77201321-77201343 GTGGCTAGGGAGAAGGAGGCAGG + Intergenic
1099072549 12:78064112-78064134 ATGGCAGTGGGGAAGGGGGCTGG + Intronic
1101006616 12:100406955-100406977 GTGGCAATGGAGATGGAGAGAGG + Intronic
1101438431 12:104684048-104684070 GTGGAAATGAGGGAGGAGCGAGG + Intronic
1101773335 12:107771828-107771850 GTGGCATTGGGGAGGAAGGGGGG - Intergenic
1102425083 12:112837867-112837889 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1102534248 12:113569092-113569114 CAGCCACTGGGGAAGGAGGGTGG - Intergenic
1102567342 12:113805270-113805292 GTGGGTGGGGGGAAGGAGGGGGG + Intergenic
1103344782 12:120241964-120241986 GTGGATATGGAGAAGGAGTGAGG + Intronic
1103425455 12:120830288-120830310 GAGGGGAGGGGGAAGGAGGGGGG + Intronic
1103501565 12:121407066-121407088 GGGGGGAGGGGGAAGGAGGGAGG - Intronic
1103800258 12:123533466-123533488 GTGGCCATGGAGGAGGAGCGGGG - Exonic
1103909948 12:124346658-124346680 GTGGCCACGGTGAAGGAGGCGGG - Exonic
1104172507 12:126295849-126295871 GAGGGAAGGGGGAAGGAGGGAGG + Intergenic
1104191080 12:126482449-126482471 GAGGAAGTGGGGAAGGAGGGAGG - Intergenic
1104191087 12:126482468-126482490 GAGGAAGTGGGGGAGGAGGGAGG - Intergenic
1104191097 12:126482491-126482513 GAGGGAGAGGGGAAGGAGGGAGG - Intergenic
1104191107 12:126482514-126482536 GAGGGAGGGGGGAAGGAGGGAGG - Intergenic
1104383811 12:128331171-128331193 GTAGAGATGGGGATGGAGGGAGG - Intronic
1104769932 12:131355045-131355067 GTGGCAGTGGAGATGGAGGGAGG + Intergenic
1104921221 12:132291781-132291803 GAGGGGATGGGGAAGCAGGGGGG - Intronic
1104962907 12:132496704-132496726 GGGGAAACAGGGAAGGAGGGAGG - Intronic
1104983728 12:132585378-132585400 GTGGCACTGGGGGAGGGGGCTGG - Intergenic
1104984152 12:132587227-132587249 GTGGCAGTGCGGCTGGAGGGAGG + Intergenic
1105283504 13:18984157-18984179 GTGGCAATGAGGCTGGAGGAGGG + Intergenic
1105330729 13:19412822-19412844 GTGGCATGGGGGAAGGGAGGGGG - Intergenic
1105683272 13:22751932-22751954 GTGGGAGGGGGGAATGAGGGTGG - Intergenic
1105843344 13:24274342-24274364 GTGGTAGTGGGGAAGGATGTTGG - Intronic
1105959034 13:25312073-25312095 GTGTCATTGGGGAAGTAAGGAGG + Intronic
1106480390 13:30133187-30133209 CTGGCTCTGGGGAAAGAGGGTGG - Intergenic
1106480913 13:30136145-30136167 GTGGGAATGGAGAAGGAGACAGG - Intergenic
1106574037 13:30957669-30957691 GTGGCAGTGCGGATGGAGGCAGG + Intronic
1106720752 13:32432376-32432398 GGGGGAAGGGGGAAGGAGGAAGG + Intergenic
1106917711 13:34532856-34532878 GTGGAAAGGGGGTAGGAGGAAGG - Intergenic
1106944432 13:34811099-34811121 GTGGAAAGTGGGAAGCAGGGGGG - Intergenic
1107153558 13:37140462-37140484 GTGGGGTGGGGGAAGGAGGGAGG - Intergenic
1107324403 13:39225788-39225810 GTAGCAAGGGTGAGGGAGGGTGG - Intergenic
1107534021 13:41311030-41311052 GGAGCAATGGTGAATGAGGGTGG + Intergenic
1107534090 13:41311339-41311361 GTGGCAATGGAGAAGGAAGGCGG - Exonic
1107742317 13:43464423-43464445 GGGGACCTGGGGAAGGAGGGAGG + Intronic
1107812095 13:44210325-44210347 GTGGGAATGGGAAATCAGGGAGG - Intergenic
1108082468 13:46750913-46750935 GTGGAAAGGATGAAGGAGGGTGG - Intronic
1108315716 13:49235147-49235169 GGGGGAAGGGGGAGGGAGGGAGG + Intergenic
1108346428 13:49551139-49551161 GGGGGAAGGGGGAAGCAGGGAGG + Intronic
1108437199 13:50412059-50412081 GTTGGAATGGGAAAGAAGGGAGG + Intronic
1108579881 13:51819214-51819236 GTGGCAAAGGTGAAGGGTGGTGG + Intergenic
1109400422 13:61820357-61820379 AGGGGAAGGGGGAAGGAGGGAGG + Intergenic
1110414888 13:75241294-75241316 GTGGCATGGGGGGAGGGGGGAGG - Intergenic
1110998228 13:82140597-82140619 GTGGGATGGGGGAAGGGGGGAGG + Intergenic
1111174281 13:84572715-84572737 GAGGCAATGGGAAAAGTGGGAGG + Intergenic
1111255143 13:85657958-85657980 GAGGGAGGGGGGAAGGAGGGAGG + Intergenic
1111567820 13:90039691-90039713 GTGTCAATTGGGAAAGAGGTAGG + Intergenic
1111935106 13:94549855-94549877 GTGGCAGCGTAGAAGGAGGGAGG - Intergenic
1111994441 13:95150490-95150512 CTGGCAGTGGGGAAGGGGGAGGG - Intronic
1112691700 13:101903620-101903642 GTGACTATAGGGAAGGAGGGAGG + Intronic
1113074389 13:106453452-106453474 GTGGCAACGGGGAAGGGAGAAGG + Intergenic
1113301595 13:109027524-109027546 GTGGCATAGTGGAAGGAGGGTGG + Intronic
1114461708 14:22890313-22890335 GTGGCAGTGGGAAAGGAAGGAGG + Intergenic
1114617203 14:24074625-24074647 GGGGCTATGGGGATGAAGGGAGG + Intronic
1114629741 14:24151449-24151471 GTGGCAAGGGGGAATGAAGTGGG - Intronic
1115088781 14:29549128-29549150 GTGGGGCTGGGGAGGGAGGGGGG + Intergenic
1115488290 14:33934181-33934203 CTGGGAATGGGGATGGTGGGAGG - Intronic
1115776792 14:36724322-36724344 AGGGGTATGGGGAAGGAGGGGGG - Intronic
1115788225 14:36850161-36850183 ATGGGAAAGGGGAAGGAGTGAGG + Intronic
1116042034 14:39697732-39697754 GTGGCGTGGGGGGAGGAGGGAGG - Intergenic
1116250404 14:42474512-42474534 GTGGCAATGCAGATTGAGGGTGG + Intergenic
1116610852 14:47070202-47070224 GTGGGATTGGGGGAGGAAGGTGG - Intronic
1116723009 14:48524848-48524870 GTGGAAAACGGGAAGAAGGGAGG + Intergenic
1116957856 14:50943289-50943311 GAGGCAGTGGGGAAGGACTGGGG - Intronic
1117173823 14:53128455-53128477 GTGGAAGTGGGGAAGGAGCAGGG + Intronic
1117721765 14:58635671-58635693 GTGGCATTTGGTGAGGAGGGGGG + Intronic
1117893666 14:60453751-60453773 GTGGGATTGGGGAAGGAGATTGG - Intronic
1117901069 14:60533892-60533914 GTGGGAATGGAGAATGAGTGTGG - Intergenic
1118076933 14:62309544-62309566 TTTGCTAAGGGGAAGGAGGGGGG + Intergenic
1118319859 14:64746727-64746749 GGGACAAAGGGGAAGGAGAGAGG + Exonic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118718252 14:68575583-68575605 GTGGCGTTGGGGAGGGAGAGGGG - Intronic
1118784885 14:69037710-69037732 ATGGCAATGGGGCGGGATGGTGG + Intergenic
1119265210 14:73260264-73260286 GAGGCAAGGTGAAAGGAGGGAGG - Intronic
1119480875 14:74956835-74956857 GTGGCTGTGGGGGAGGAGCGAGG + Intergenic
1119483468 14:74974097-74974119 GTGGCAGTGAGGAAGGGGAGGGG + Intergenic
1120583984 14:86287747-86287769 GTGGCAGTGGAGATGGAGAGAGG + Intergenic
1121001896 14:90456930-90456952 CCGGGGATGGGGAAGGAGGGAGG + Intergenic
1121624600 14:95374935-95374957 GAAGGAAGGGGGAAGGAGGGAGG - Intergenic
1121624631 14:95375038-95375060 GAAGGAAGGGGGAAGGAGGGAGG - Intergenic
1121695235 14:95907126-95907148 GTGGCAAAAAGGAAGGAGGAAGG - Intergenic
1122012359 14:98760664-98760686 CAGGCAATGGGGGAGGGGGGGGG - Intergenic
1122228285 14:100292252-100292274 GGAGCCCTGGGGAAGGAGGGCGG + Exonic
1122369368 14:101220823-101220845 GGGGCAGGTGGGAAGGAGGGAGG - Intergenic
1122770024 14:104093740-104093762 GTGGGAATGGGGAGTGTGGGTGG + Intronic
1122804749 14:104250647-104250669 GTGAAAAGGGGGAAGGAGGGAGG + Intergenic
1122827100 14:104375580-104375602 GCGGCAGTGGTGAAGGAGGTTGG + Intergenic
1122855760 14:104559424-104559446 CTGGAGATGGGGATGGAGGGAGG - Intronic
1122864907 14:104599309-104599331 TGGGCAATGGGGTGGGAGGGCGG + Intronic
1122901488 14:104784053-104784075 CCGGCCATGGGGCAGGAGGGTGG - Intronic
1122915906 14:104858889-104858911 GTGGAGATGGAGATGGAGGGTGG - Intergenic
1124140389 15:27072313-27072335 GTGTCCATGGAGAAGGAGGTAGG - Intronic
1124646924 15:31443828-31443850 TTGGCAATGGGACGGGAGGGAGG - Intergenic
1124820411 15:33039883-33039905 GCGGCAGTGGGGAAGTAGGAAGG - Intronic
1124885006 15:33677215-33677237 GGGGCCATGGGGATGGAGAGAGG + Intronic
1125600839 15:40915078-40915100 GTGGCAGTGGGGGAGGGGGAAGG + Intergenic
1126351962 15:47753110-47753132 GTAGCTGTGGGGCAGGAGGGAGG + Intronic
1126804977 15:52339090-52339112 ATGGGAATGAGGGAGGAGGGTGG - Intronic
1127292961 15:57586564-57586586 CTGGGTATGGGGATGGAGGGTGG - Intergenic
1127301167 15:57655205-57655227 GTGGAAAAGGGGATGGAGGGTGG + Intronic
1127566549 15:60194826-60194848 GTGGAAAGGGAAAAGGAGGGGGG - Intergenic
1128101058 15:65000322-65000344 GTGGGGATGGGGATGGGGGGAGG - Intergenic
1128200076 15:65797597-65797619 GTGGGAATGGGGATGAAGTGAGG - Intronic
1128371169 15:67040457-67040479 GAAGCAATGGGAAAGGAAGGTGG - Intergenic
1128690948 15:69724562-69724584 GTAGCATGGGGGAAAGAGGGAGG - Intergenic
1128704568 15:69829197-69829219 GTGGGAAGTGGGGAGGAGGGAGG - Intergenic
1128774590 15:70309856-70309878 GTGGCCATGGGGGAGTGGGGAGG + Intergenic
1128836532 15:70813323-70813345 GGGGCAATGGGGCGGGGGGGGGG + Intergenic
1129250177 15:74304408-74304430 GAGGGATGGGGGAAGGAGGGAGG - Intronic
1129506674 15:76087291-76087313 GTGGCAGTGGGGATGGAGAAAGG + Intronic
1129520485 15:76183026-76183048 GTTGCAATGGGGCAGGGTGGAGG + Intronic
1129661391 15:77554847-77554869 GGGGCAGTGGGGAGGGAGGAGGG + Intergenic
1129933123 15:79428493-79428515 GAGGGAAGGAGGAAGGAGGGAGG - Intergenic
1130148211 15:81291726-81291748 GGGCTAATGGGGAGGGAGGGAGG + Intronic
1130302477 15:82690395-82690417 GTGGCGTTGGGGGAGGAGGGAGG - Intronic
1130362833 15:83207246-83207268 GAGGCGATGGGGAAAGGGGGCGG + Intronic
1130990452 15:88872852-88872874 GTGGGAGTGGGGAAGGAGTAAGG - Intronic
1131283249 15:91038006-91038028 GTAGTAGAGGGGAAGGAGGGAGG + Intergenic
1131593571 15:93773989-93774011 GTGTGGATGGGGGAGGAGGGGGG - Intergenic
1132114268 15:99124328-99124350 GGGGCTGTGCGGAAGGAGGGTGG + Intronic
1132506669 16:313485-313507 GCCGCAGTGGGGATGGAGGGTGG + Intronic
1132630456 16:914766-914788 GTGGTCATGGGAAGGGAGGGAGG - Intronic
1132689087 16:1174505-1174527 GTGGCCATGGGGAGGGAGGGAGG + Intronic
1132855484 16:2042878-2042900 GGGGGAATGGGGGAGGAGGGTGG - Intronic
1132958915 16:2611631-2611653 GAGGCAGGAGGGAAGGAGGGCGG - Intergenic
1132970690 16:2687086-2687108 GCTGCAGTGGGGAAGGAGCGGGG - Intronic
1133319493 16:4904093-4904115 GTGGCAATGGGAGGGGTGGGAGG + Intronic
1133529163 16:6638208-6638230 TTGGCATTTGGGAAAGAGGGTGG + Intronic
1134353423 16:13459326-13459348 GTGACATGGGGGGAGGAGGGTGG + Intergenic
1134690818 16:16190114-16190136 GCAGCACTGGGGAAGGAGTGCGG - Intronic
1134898529 16:17912402-17912424 GTGGGGTTGGGGGAGGAGGGAGG + Intergenic
1135047609 16:19168198-19168220 ATGGGAATGGGGAAGGGGGTGGG - Intronic
1135698469 16:24610773-24610795 GTGGAAAGGGGGAAGGTGAGAGG - Intergenic
1135800393 16:25488918-25488940 GCAGCAATGGGGAAGGGGTGAGG + Intergenic
1136346424 16:29679103-29679125 GTGGGACTGTGGAGGGAGGGAGG - Exonic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137384580 16:48029775-48029797 GAGGCACGGGGGAAGGAGGAGGG + Intergenic
1137447758 16:48542219-48542241 GGTGGAAGGGGGAAGGAGGGTGG + Exonic
1137614620 16:49839067-49839089 GTGGCAGTTGGGGAGGAGGCGGG - Intronic
1137902118 16:52280038-52280060 TTGTCATGGGGGAAGGAGGGTGG - Intergenic
1138349490 16:56338901-56338923 GGGGAAATGGGGAAAAAGGGAGG - Intronic
1138486695 16:57349834-57349856 GAGGGAAGGGGGAAGGATGGTGG - Intergenic
1138532777 16:57643803-57643825 GTGGGAATGGGGGAGGGGAGTGG + Intronic
1138889566 16:61126157-61126179 TTGGCAAGGGGTTAGGAGGGAGG - Intergenic
1139504932 16:67393996-67394018 GGAGCAGTGGGGAAGAAGGGAGG + Intergenic
1139589530 16:67925866-67925888 GTGGCAGTGGGGAAGGGGGTAGG + Intronic
1139777271 16:69324323-69324345 TGGGCAATGGTGAAGGTGGGAGG + Exonic
1140188856 16:72797339-72797361 GGGGAAGTGAGGAAGGAGGGTGG + Exonic
1140323073 16:73972652-73972674 GTGCTAATGGGGAGGGAGGCTGG - Intergenic
1140814014 16:78604673-78604695 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814022 16:78604688-78604710 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814030 16:78604703-78604725 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814038 16:78604718-78604740 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814046 16:78604733-78604755 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814054 16:78604748-78604770 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814062 16:78604763-78604785 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814070 16:78604778-78604800 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140814092 16:78604828-78604850 GAGGGAGGGGGGAAGGAGGGAGG - Intronic
1140914687 16:79483137-79483159 GTGGAAGGGGGGAGGGAGGGAGG - Intergenic
1140948430 16:79793241-79793263 GAGGCGATGGGGGAGAAGGGGGG - Intergenic
1141061872 16:80880891-80880913 TTCACAATAGGGAAGGAGGGCGG + Intergenic
1141170645 16:81688800-81688822 GTGGGGTTGGGGGAGGAGGGAGG - Intronic
1141336509 16:83160434-83160456 ATGGCAATGGAGATGAAGGGTGG + Intronic
1141545714 16:84766944-84766966 GTGGCACCGGGGAAGAAAGGCGG - Intronic
1141635380 16:85311493-85311515 GGGACATTGGGGAGGGAGGGAGG + Intergenic
1142219416 16:88846337-88846359 GTGGCAATGGGGTCAGAGGCGGG + Intronic
1143165113 17:4893652-4893674 GTGGCAGTGGGGAAGAGGTGGGG + Intronic
1143467256 17:7145834-7145856 GTGGGGGTGGGGAAGGGGGGAGG - Intergenic
1143764174 17:9126854-9126876 TTGGCAATGGGGAACCAGGATGG + Intronic
1143781928 17:9233570-9233592 CTGGAACTGGGGAGGGAGGGAGG + Intronic
1144080080 17:11756524-11756546 ATGCCAGTGAGGAAGGAGGGAGG - Intronic
1144191839 17:12853574-12853596 GAGGCACTGGGGCAGGAGCGAGG + Intronic
1144948133 17:18980263-18980285 CTGGCCATGGGGAAGGAGAAAGG - Intronic
1144949533 17:18986564-18986586 GAGGCAATGGGGCAGGTGGGGGG - Intronic
1145263272 17:21367172-21367194 GTGGGAACGGGGAAGAAGTGTGG - Intergenic
1145994450 17:29097403-29097425 GGGGCAGAGGGGAAGGAGGATGG + Intronic
1146683473 17:34824885-34824907 GTGGCAGTGGGGACTGAGGGAGG - Intergenic
1146709629 17:35029833-35029855 GTGGCGTTGGGGGAGGGGGGAGG - Intronic
1146725548 17:35152858-35152880 GAGGGAGTGGGGAAGGAGGCAGG - Intronic
1147134261 17:38426062-38426084 GAGGCCATGGGGGAGGAGGGAGG - Intergenic
1147162384 17:38575757-38575779 GTGGCCTTGGGGAACGAAGGGGG - Intronic
1147195202 17:38761858-38761880 GTGGCAGTGGGGAGGCAGGAAGG + Intronic
1147342053 17:39758514-39758536 GAGGGATTGGGGAAGGTGGGTGG + Intergenic
1147768321 17:42851447-42851469 GGGGCAATGGGGAAGCTGGCTGG - Exonic
1147914863 17:43880139-43880161 GTGCCAATGGGGAGAGTGGGGGG - Intronic
1148337456 17:46851390-46851412 GGGGCAATGGGGGAGGGGCGGGG + Intronic
1148346685 17:46908174-46908196 GGGGCGGTGGGGGAGGAGGGGGG - Intergenic
1148402148 17:47374168-47374190 TTGTCAATTGGGAAGGAGTGGGG + Intronic
1148495116 17:48048718-48048740 GGGGCCATCGGGACGGAGGGCGG + Intronic
1148552305 17:48557695-48557717 GGGGACATGGGGATGGAGGGTGG + Intronic
1148776078 17:50096318-50096340 GTGGCCCTGGGGCAGGAGGGAGG + Intronic
1148868868 17:50643812-50643834 GGAGCAATGGGAAAGGAGGTGGG + Intronic
1148904871 17:50905563-50905585 GTGGCAACAGGGAAGGGGGTGGG - Intergenic
1149814809 17:59713250-59713272 GTGGGTTGGGGGAAGGAGGGAGG + Intronic
1150293126 17:63993157-63993179 GAGGGAAGGGGGAGGGAGGGAGG + Intergenic
1150385944 17:64760113-64760135 GTGGCTGTGGGGATGGAAGGTGG + Intergenic
1150632164 17:66887410-66887432 GTGCCAGTGGAGAGGGAGGGGGG - Intergenic
1150656836 17:67044899-67044921 GTGGGGATCGGGACGGAGGGTGG - Intronic
1150751949 17:67872356-67872378 ATGGCACTGGGAAAGTAGGGAGG + Intronic
1150754330 17:67897550-67897572 GTGGCAGTGGGGATGGAAGGTGG - Intronic
1151107924 17:71639628-71639650 TTGGCAATGGAGAAGGAGCAAGG + Intergenic
1151144903 17:72031504-72031526 TTGGCAATGAGGGATGAGGGGGG - Intergenic
1151190355 17:72393618-72393640 GTGGCAATCTGGAAGGGAGGAGG + Intergenic
1151296808 17:73192336-73192358 GTGGCCATGGGGGAGGAGGGCGG - Intergenic
1151446220 17:74166084-74166106 GTGGGAGTGGGGTTGGAGGGTGG - Intergenic
1151693028 17:75698822-75698844 GTGGGGATGGGGAAGCAGGGAGG - Intronic
1151699376 17:75734837-75734859 GTGCCTCTGGGGAAGGAGGCAGG + Intronic
1151771346 17:76164115-76164137 GTGGCATTGGCAAGGGAGGGTGG - Intronic
1151902278 17:77024301-77024323 GTGGCAGTGGGCAAGGAGGAAGG + Intergenic
1152061301 17:78077668-78077690 GTTGCCATGAGGAAAGAGGGTGG - Intronic
1152261670 17:79270530-79270552 GTGGCAAAGGGAAAGAAGAGAGG - Intronic
1152525280 17:80884835-80884857 GTGGCAACGGGGAAGGAGGTGGG - Intronic
1153178460 18:2405833-2405855 GAGGAAATGGGATAGGAGGGAGG + Intergenic
1153697853 18:7662573-7662595 GTGGTAGTGGGGAAAGAGGGAGG + Intronic
1153870626 18:9316170-9316192 GAGGGAGGGGGGAAGGAGGGAGG + Intergenic
1154110635 18:11565819-11565841 GGGACATTGGTGAAGGAGGGAGG + Intergenic
1155532730 18:26783579-26783601 CTTACAATGGGGCAGGAGGGTGG - Intergenic
1156004366 18:32422131-32422153 GTGGGGTTGGGGAAGGGGGGAGG - Intronic
1156043904 18:32856795-32856817 GTGGGGAGGGGGAAGGGGGGAGG - Intergenic
1157296919 18:46451983-46452005 TTGCCAGTGGGGAGGGAGGGAGG + Intronic
1157510106 18:48265005-48265027 GTGGAGATGGGGTAGGAGGAGGG + Intronic
1157534887 18:48450916-48450938 GTGGCATCTGGGAAGGAGGCAGG + Intergenic
1157641744 18:49221755-49221777 GTGGGGTGGGGGAAGGAGGGAGG + Intronic
1157654189 18:49369263-49369285 CAGGCAATGGGGAAGGAGGGTGG - Intronic
1157772855 18:50365121-50365143 GTGGGGTTGGGGGAGGAGGGAGG - Intergenic
1157946330 18:51984726-51984748 AAGGCAAAGGGGAAGCAGGGAGG + Intergenic
1158435491 18:57432973-57432995 GTGGGAGTGAGGGAGGAGGGAGG + Intergenic
1158643362 18:59221185-59221207 GAGGGAATGGGAAAGGAGCGAGG - Intronic
1158669937 18:59465358-59465380 GTGGAAAAGGGGAGGGATGGGGG - Intronic
1158746392 18:60204553-60204575 TTGGCAAGAGGGAAGGAGGAGGG - Intergenic
1159409238 18:68049542-68049564 GTGGCGTTGGGGGAGGTGGGAGG + Intergenic
1159849370 18:73508808-73508830 GTGGAAAGGGAGAAAGAGGGTGG - Intergenic
1160089183 18:75809983-75810005 GAGGCAATGGGGGAGGAGAGGGG - Intergenic
1160676392 19:393616-393638 GTGGTGATGGGGAAGGATGATGG + Intergenic
1160676437 19:393793-393815 GTGGTGATGGGGAAGGATGATGG + Intergenic
1160676471 19:393948-393970 GTGGTGATGGGGAAGGATGATGG + Intergenic
1160926057 19:1546419-1546441 GTCGAAATGGGGAAGGAGTTGGG + Intergenic
1160926068 19:1546459-1546481 GAGGCAGTGGGGTAGGAGCGAGG + Intergenic
1160967304 19:1752402-1752424 GAGGCAACGGGGAAGCAGGAAGG + Exonic
1161133326 19:2604683-2604705 GAGGGAGTGGGGAGGGAGGGAGG + Intronic
1161139618 19:2639763-2639785 GGGGGAAGGGGGAAGAAGGGAGG + Intronic
1161264418 19:3357842-3357864 GTGGGAGGGGGGAGGGAGGGGGG + Intergenic
1161306593 19:3572540-3572562 GTTGCCATGGGGACGGAGGTGGG - Intronic
1161335249 19:3709441-3709463 GGGGCAGAGGGGAAGGAGGAAGG + Intronic
1161433888 19:4250460-4250482 GGGGCAGTGGCGCAGGAGGGAGG + Intronic
1161756588 19:6138486-6138508 GGGGGAAGGGGGAGGGAGGGAGG + Intronic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1163106241 19:15124662-15124684 GAGTCACTGGGGAAGGAGGTAGG + Intronic
1163666578 19:18606505-18606527 CTGGCAGGGGGGAAGGAGTGGGG + Intronic
1164022586 19:21321631-21321653 GAGGGGAGGGGGAAGGAGGGAGG + Intronic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164306030 19:24004220-24004242 GTGCTAATGGAAAAGGAGGGGGG + Intergenic
1164635448 19:29787997-29788019 GTGGCACTGGGGAAGGTGGCAGG - Intergenic
1165262597 19:34633598-34633620 GTGGCAATGGGGTGCCAGGGAGG + Intronic
1165386683 19:35514135-35514157 GTGGCAATGCGGGAGGGGAGAGG - Intergenic
1165834244 19:38744505-38744527 GTGGGGCTGGGGAAGGAGGCGGG + Intronic
1165844271 19:38808262-38808284 GAGGGAAGGGGGAAGGAAGGAGG + Intronic
1166165268 19:40983236-40983258 GGGGCAATGGGAAGAGAGGGGGG + Intergenic
1166182333 19:41117677-41117699 ATGACAATGGGGAATGAAGGGGG - Intronic
1166297598 19:41896656-41896678 GGGGCAATGAGGAAGCAGGAGGG - Intronic
1166332716 19:42088171-42088193 TTGGGAAGGGGGTAGGAGGGAGG - Intronic
1166816084 19:45547065-45547087 TTTCCTATGGGGAAGGAGGGAGG + Intronic
1166844904 19:45721411-45721433 GTGGGGATGGGGAAGTGGGGTGG - Intronic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1167298120 19:48663709-48663731 GTGGCAAGTGGGAATGAGGATGG - Intronic
1167303838 19:48695871-48695893 CCGGCAATGGGGAGGGAGGAGGG + Intergenic
1167426066 19:49430352-49430374 GAGGCAATTGGGAAGGAAAGAGG + Exonic
1167470278 19:49671918-49671940 GCAGGAAGGGGGAAGGAGGGCGG - Intronic
1167596468 19:50430919-50430941 GTGGGAAGGGGGAGGGAGGAAGG + Exonic
1167636973 19:50660923-50660945 GGGGCAAGAGGGAAGGCGGGGGG + Intronic
1167674706 19:50877149-50877171 CAGGGAAGGGGGAAGGAGGGCGG - Intronic
1167877296 19:52424915-52424937 GTAGCAATGAGGAAGGAGAGTGG - Intergenic
1168077177 19:53987435-53987457 GAGTCAAAGGGGAAGGAAGGAGG + Exonic
1168486205 19:56764632-56764654 GTGGCCATGGGGATGGTGTGAGG - Intergenic
1202697518 1_KI270712v1_random:135813-135835 GTGGGAAGGGGGAAGGGAGGGGG - Intergenic
925069330 2:954198-954220 GTGGAAATGGAGAAGGAAGGAGG + Intronic
925189956 2:1874807-1874829 GTGGAAATGGGGCAGGAGGATGG - Intronic
925248970 2:2413044-2413066 GTGGGATGGGGGAAGGGGGGAGG - Intergenic
925264903 2:2560315-2560337 GTGGCAATGGGGAGGGCAGTAGG - Intergenic
925299430 2:2800133-2800155 GAGGGAAGGGGGAAGGAAGGAGG + Intergenic
925452217 2:3979358-3979380 GAGGCAATGGGACATGAGGGTGG + Intergenic
925903834 2:8527340-8527362 GTGACAAGGGGCAAGCAGGGTGG + Intergenic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
926238319 2:11066804-11066826 ATGGGATGGGGGAAGGAGGGAGG - Intergenic
926745602 2:16154543-16154565 ATGGAAATGGGGACAGAGGGTGG - Intergenic
926937465 2:18100762-18100784 GTGGTATTAGGGAGGGAGGGAGG + Intronic
927012918 2:18924620-18924642 GGGTCAGTGGGGCAGGAGGGAGG + Intergenic
927030975 2:19120114-19120136 ATGGCAATGGGGATGAAGGTGGG - Intergenic
927132631 2:20073343-20073365 GTGGCAGTGGAGATGGAGAGAGG - Intergenic
927749700 2:25656593-25656615 GTTGAAATGGGAAAAGAGGGTGG - Intronic
927809064 2:26172149-26172171 GTGGCGGTGGGGGAGGAAGGCGG + Intergenic
928022593 2:27715963-27715985 GTGGGCAGGGGGAGGGAGGGGGG - Intergenic
928113302 2:28527340-28527362 TACCCAATGGGGAAGGAGGGAGG + Intronic
928392195 2:30918617-30918639 GTGGCATCGGGCAGGGAGGGTGG + Intronic
928392201 2:30918636-30918658 GTGGCATTGGGCAGGGAGGATGG + Intronic
928392229 2:30918712-30918734 GTGGCATCGGGCAGGGAGGGGGG + Intronic
928392248 2:30918769-30918791 GTGGCATCGGGCAGGGAGGGTGG + Intronic
928392255 2:30918788-30918810 GTGGCATTGGGCAGGGAGGGTGG + Intronic
928392287 2:30918884-30918906 GTGGCATCGGGCAGGGAGGGTGG + Intronic
928602384 2:32916080-32916102 GAGGGAAGGGGGAGGGAGGGAGG - Intergenic
928602408 2:32916147-32916169 GAGGTAAGGGGGAGGGAGGGAGG - Intergenic
929234710 2:39593678-39593700 GGGGCCATGGGGAAGGAGGTGGG + Intergenic
929247111 2:39714222-39714244 GTGGGAAGGGGGATGGAGAGAGG + Intronic
930027862 2:47040332-47040354 CTGGGAAAGGGGAAGGAGCGTGG - Intronic
930158400 2:48128497-48128519 GAGGAAATGGGGGAGGAGGAAGG + Intergenic
930563288 2:52987809-52987831 GTGGGGTGGGGGAAGGAGGGAGG - Intergenic
931215183 2:60235462-60235484 GTGGGATGGGGGTAGGAGGGAGG - Intergenic
932369347 2:71174574-71174596 GCTGCAGAGGGGAAGGAGGGAGG + Intergenic
932504898 2:72219267-72219289 GGAGCAAGGGGGAAGGAGGAGGG + Intronic
932880856 2:75500733-75500755 GTTGAAAAGGGGAGGGAGGGAGG - Intronic
933381946 2:81559078-81559100 GTGGGGTTGGGGAAGGGGGGGGG + Intergenic
933566330 2:83954898-83954920 GTGGCACAGGGGTAGGAGGTGGG - Intergenic
933719699 2:85390052-85390074 GGGGAAATGGGGAAGGAAGGCGG + Intronic
933811668 2:86036503-86036525 GTGGCAGAGAGGAAGGAAGGGGG + Intronic
933943658 2:87266182-87266204 GTGGCTGTGGGAGAGGAGGGTGG + Intergenic
933975277 2:87504537-87504559 GTGGTCATGGGGAAGGCTGGGGG - Intergenic
934129628 2:88935702-88935724 GGGGCAATGAGGTAGGAGGTAGG - Intergenic
934475371 2:94589957-94589979 ATGGCCATGGGGGAGTAGGGTGG - Intronic
934908627 2:98229386-98229408 GGGGCAGTGGTGCAGGAGGGAGG + Intronic
934991543 2:98925114-98925136 GAGGCAAGAGGGAAGGAGGAGGG + Intronic
935854958 2:107263759-107263781 GTGGATGTGGGGGAGGAGGGTGG + Intergenic
936093139 2:109513701-109513723 GTGCCACAAGGGAAGGAGGGAGG + Intergenic
936318549 2:111446276-111446298 GTGGTCATGGGGAAGGCTGGGGG + Intergenic
936336562 2:111595397-111595419 GTGGCTGTGGGAGAGGAGGGTGG - Intergenic
936692150 2:114902958-114902980 CTGGGAATGAGGGAGGAGGGAGG - Intronic
936984212 2:118292674-118292696 GAGGCAAAGAGGAGGGAGGGTGG - Intergenic
937075441 2:119101692-119101714 GTGGGGTTGGGGGAGGAGGGAGG + Intergenic
937100217 2:119262955-119262977 CTGGCGGAGGGGAAGGAGGGTGG - Intronic
937209983 2:120262255-120262277 GTGACATTGGGGAGGGAGGAAGG + Intronic
937382712 2:121395052-121395074 TTGACAATGAGGAAGGAAGGAGG + Intronic
938054387 2:128203108-128203130 GTGGCACTGAGGAGGGAGGATGG - Intergenic
938319148 2:130351499-130351521 GTGGCAAGGAGAAAGGAGGGAGG - Intergenic
938567724 2:132534838-132534860 GTGGGGTTGGGGGAGGAGGGAGG + Intronic
940755563 2:157677763-157677785 GTGGGATTGGGGGAGCAGGGAGG + Intergenic
940767054 2:157800897-157800919 GAGGCAATGGGGTTGGAGAGGGG - Intronic
940822551 2:158372989-158373011 GTGGCAAAGGGGAATTAAGGTGG + Intronic
941775960 2:169394047-169394069 GTGGAGTTGGGGGAGGAGGGAGG - Intergenic
941880833 2:170478489-170478511 GTGGCCATGGAGAAGGTGTGTGG + Intronic
942534849 2:176952084-176952106 GTGGGATTGGGGGAGGGGGGAGG + Intergenic
942538309 2:176988816-176988838 TTGGCCTTGGGGAGGGAGGGGGG + Intergenic
943181336 2:184546039-184546061 GTGACAATGGAGAATGAGGTTGG - Intergenic
944327081 2:198418821-198418843 GTGGGATGGGGGGAGGAGGGAGG - Intronic
944661392 2:201924577-201924599 GAGGCCATGGGGGAGGAGAGGGG - Intergenic
945044082 2:205766574-205766596 GTGGTGATGGCGGAGGAGGGGGG - Intronic
945094062 2:206202685-206202707 GTGGGGATGGGGGAGGTGGGTGG + Intronic
945231233 2:207592552-207592574 GTGGGGATGGGGGAGGAAGGAGG - Intronic
945381851 2:209149821-209149843 GAGGCTATGGGGAAGGAGTGAGG + Intergenic
945905595 2:215589129-215589151 GTGGCATTGGGGGAGGGGGGAGG + Intergenic
945947324 2:216006850-216006872 GTGCCAGTGGGAAAGAAGGGTGG - Intronic
946507847 2:220320737-220320759 ATGGAAACGGGGAAGGAGGGAGG + Intergenic
946807207 2:223482816-223482838 GTGGGGTAGGGGAAGGAGGGAGG + Intergenic
946944725 2:224808877-224808899 GTAGCAATGGGGGAGGGAGGGGG + Intronic
946961845 2:224993699-224993721 GTGGGCTTGGGGATGGAGGGAGG - Intronic
947030131 2:225783270-225783292 GTGGAAAGGGGAAAGGAAGGAGG - Intergenic
947407522 2:229795178-229795200 GTGGAAATGGGACAGGAGGCAGG - Exonic
947744136 2:232498964-232498986 GGGGCAAGGGGGAAGGAAAGTGG + Intergenic
947895389 2:233666791-233666813 GTGGGATTGGGGGAGGGGGGAGG - Intronic
948015563 2:234687944-234687966 GTGGTAATGGGGTAGCATGGTGG - Intergenic
948091881 2:235302039-235302061 GAGAGAAGGGGGAAGGAGGGAGG - Intergenic
948355713 2:237375324-237375346 CTGGCAATGAGGATGGAGGATGG + Intronic
948486620 2:238285342-238285364 GTGGGGGTGGGGAAGGAGTGGGG + Intronic
948542466 2:238700397-238700419 GTGGCACAGGAGAATGAGGGGGG + Intergenic
948826116 2:240574132-240574154 GCCACGATGGGGAAGGAGGGTGG - Exonic
948864651 2:240769161-240769183 GTGGCCATGAGGGAGGATGGCGG - Exonic
948934166 2:241151368-241151390 GTGGAGCTGGGGAAGGAGGGCGG + Intronic
948990629 2:241552108-241552130 GTGGCAATGGCGAAGCAGCCAGG + Intergenic
1168857168 20:1016787-1016809 GGGGAAGTGGGGAAGGAGGCTGG - Intergenic
1169150631 20:3286697-3286719 GTGGTACTGAGGAAGGAGGCAGG - Intronic
1169252857 20:4073514-4073536 GTGGCATAGGGGAAGGACTGGGG - Intronic
1169286147 20:4308891-4308913 GTGGCAGTGGAGAAGGTGAGAGG - Intergenic
1169324069 20:4661158-4661180 GGGGGACTGGGGAGGGAGGGAGG + Intergenic
1169344532 20:4820066-4820088 GAGGCACCAGGGAAGGAGGGTGG - Intronic
1169394900 20:5220514-5220536 GAAGCAATGGGAAGGGAGGGTGG - Intergenic
1169484260 20:6013428-6013450 GGGGAGATGGGGAAGAAGGGAGG + Intronic
1169864525 20:10185673-10185695 GTGGTAAGGTGGAAGGAGGAAGG + Intergenic
1170713887 20:18815922-18815944 GGGGAAATGAGGAAGGATGGGGG + Intronic
1170783831 20:19450433-19450455 GTGGCAGAGGGGAGGGAGGTTGG + Intronic
1170792686 20:19520981-19521003 GGAGTACTGGGGAAGGAGGGAGG + Intronic
1170813906 20:19696924-19696946 GTGGCAATGGGGAAGGAGGGAGG + Intronic
1170826711 20:19802515-19802537 GTGGCAAGGGGAAGGGAGGGAGG - Intergenic
1171284491 20:23925944-23925966 GTGGGGAGGGAGAAGGAGGGAGG - Intergenic
1171388012 20:24783159-24783181 CTGGGCAGGGGGAAGGAGGGAGG - Intergenic
1171395777 20:24832248-24832270 GCTGCCATGGGGAAGGTGGGAGG - Intergenic
1171455536 20:25269915-25269937 CTGGCCATGGAGAAGGATGGAGG - Intronic
1171913858 20:30993593-30993615 GTGGGAAGGGGGGAGGGGGGAGG + Intergenic
1172033147 20:31995544-31995566 CTGGCAACGGGGAAGGGAGGAGG - Intronic
1172167792 20:32909485-32909507 GGGGCAAGGGGGAGGCAGGGAGG + Intronic
1172323137 20:34012694-34012716 GTGGGAATGGAGAAGAAGAGGGG - Intronic
1172452632 20:35038618-35038640 ATGGGACGGGGGAAGGAGGGAGG - Intronic
1172570170 20:35964084-35964106 GTGGTTATGAGGAAGGAGGCTGG - Intronic
1172808886 20:37633133-37633155 GAGGAGATGGGGAGGGAGGGGGG + Intergenic
1172842430 20:37909920-37909942 GTGGCAGTGGGGAGGCAGAGAGG + Intronic
1173006335 20:39142448-39142470 GTGGTGAGGGGGAGGGAGGGGGG + Intergenic
1173217961 20:41104395-41104417 ATGGCAATGGGGATGGAGAGAGG + Intronic
1173408192 20:42785792-42785814 GAGACAAAGGGGAAGGAGGAAGG - Intronic
1173868611 20:46328527-46328549 GCGGCAGCGGGGAAGGTGGGTGG - Intergenic
1173966356 20:47115667-47115689 GAGGCAGAGGGGAAGCAGGGAGG - Intronic
1174547903 20:51339907-51339929 GTGGGAATGGGGAAAAAGTGGGG - Intergenic
1175168061 20:57060276-57060298 GAGGCAATGGGGAAGTGGGTGGG + Intergenic
1175270758 20:57732270-57732292 GGGGGTGTGGGGAAGGAGGGAGG - Intergenic
1175451791 20:59075772-59075794 GTGGGAATAGGGATGGAGGGAGG + Intergenic
1175552979 20:59828920-59828942 GTGGCCTTGGGGATGGAGAGAGG + Intronic
1175717136 20:61262759-61262781 GAGGGAAGGAGGAAGGAGGGTGG - Intronic
1175910137 20:62401325-62401347 GTGTCAAGGGAGAACGAGGGAGG + Intronic
1176057143 20:63154840-63154862 GAGGGAAAGGGGGAGGAGGGTGG - Intergenic
1176099117 20:63356953-63356975 GTGGGGATGTGGAAGGAGGTGGG - Intronic
1176241453 20:64077593-64077615 GAGGCAGTGGGCAAGGAGGGAGG - Intronic
1176546533 21:8204703-8204725 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176554427 21:8248894-8248916 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176565484 21:8387750-8387772 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176573349 21:8431918-8431940 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1177059633 21:16354682-16354704 GTGGAAGTGGGGAAGGAGGTTGG - Intergenic
1177183533 21:17768894-17768916 GAGGCAGTGAGGAAGGAGGGAGG - Intergenic
1177659810 21:24068008-24068030 GTAGCCATAGGGAGGGAGGGAGG + Intergenic
1177861706 21:26462250-26462272 GTGGCAAGGGATGAGGAGGGTGG + Intergenic
1178038747 21:28615316-28615338 GGGGAAAAGGGGAAGGAGGGAGG - Intergenic
1178138076 21:29650800-29650822 GTGGCTGTGGGGAAGGTGGCTGG - Intronic
1178794031 21:35727005-35727027 GTGGCTGTGGGCAAGGAGGAGGG - Intronic
1178797468 21:35758118-35758140 ATGACCCTGGGGAAGGAGGGAGG - Intronic
1179215916 21:39366937-39366959 GGGGAAAGGGGGAAGGAGGAGGG - Intergenic
1179466936 21:41581995-41582017 GTGGCAGTGGGGAAGTGAGGTGG + Intergenic
1179598343 21:42458606-42458628 GTGGCTATGTGGAAGGAGCATGG - Intergenic
1179629222 21:42666349-42666371 GAGGCTGTGGGGAAGGAGGGAGG + Intronic
1179941116 21:44639247-44639269 GTGGCATCTGGGACGGAGGGTGG - Intronic
1180012143 21:45058450-45058472 GTGGCGTGGAGGAAGGAGGGTGG + Intergenic
1180089593 21:45527226-45527248 GTGGCAATTGGGGGGGAGGGGGG + Intronic
1181044597 22:20208590-20208612 GTGGCTGTGGGGACGGAGGTGGG + Intergenic
1181060444 22:20279687-20279709 GCCGCAATGGGGTAGGTGGGAGG + Intronic
1181474312 22:23159049-23159071 GGAGCCATGGGGAGGGAGGGAGG + Intronic
1181528484 22:23502875-23502897 GAGGGATTGGGGATGGAGGGTGG - Intergenic
1182080713 22:27526896-27526918 GTGGCAGTGGGTGGGGAGGGGGG - Intergenic
1182091712 22:27600186-27600208 GTGGCTATGGGGGAGTATGGAGG + Intergenic
1182123465 22:27800893-27800915 GGGGGAATGGGGAGGGAAGGGGG + Exonic
1182200057 22:28559499-28559521 GTGGCAGTTGGGATGGAGTGTGG - Intronic
1182280252 22:29214301-29214323 GTGGAGATGGGAAAGGATGGAGG + Intronic
1182301771 22:29340994-29341016 ATGGGAATGGGGAAGAAGTGGGG - Intronic
1182421563 22:30251020-30251042 GAGGGGATGGGGAAGGAAGGAGG - Intergenic
1182624489 22:31635831-31635853 GTGGCACTGGGGCAGGCAGGAGG + Intronic
1182660108 22:31919122-31919144 GGGGCACTGTGGAAGGTGGGAGG - Intergenic
1182786919 22:32915677-32915699 GTGGGTAAGGGGCAGGAGGGTGG + Intronic
1182845966 22:33431124-33431146 GTGGCAATGAGGATGGAGGAGGG + Intronic
1183029859 22:35095473-35095495 CTGGCAATGGAGAAGGAGGTTGG + Intergenic
1183121903 22:35736535-35736557 GTGGCAATGTGGAGGAAGGCAGG + Intergenic
1183188211 22:36304624-36304646 CTGGGAGTGGGGAGGGAGGGAGG + Intronic
1183385027 22:37509695-37509717 GTGGCCATGGGGGTTGAGGGGGG - Intronic
1183429710 22:37758121-37758143 GAGGCACTGGAGAAGGAGGTAGG + Exonic
1183733484 22:39630966-39630988 GTGGCAGGGAGGATGGAGGGAGG + Intronic
1183779325 22:39988714-39988736 GTGGCAGCAGGGAAGGAGGGAGG + Intergenic
1184073398 22:42161118-42161140 GTGACAATGTGGGGGGAGGGGGG - Exonic
1184383616 22:44161828-44161850 CTGGCAATGGGGGAGGAGTGAGG - Intronic
1184468037 22:44680395-44680417 GGGGGGATGGGGAAGGATGGGGG + Intronic
1184479309 22:44737636-44737658 GTGGCCATGGGGATGGAAGGGGG + Exonic
1184523322 22:45008192-45008214 GCGGCCATGGGGGCGGAGGGGGG - Intronic
1184527631 22:45034933-45034955 GAGGAAATGAGAAAGGAGGGAGG + Intergenic
1184596606 22:45517763-45517785 GGAGCAAAGGGGCAGGAGGGGGG - Intronic
1184671141 22:46012885-46012907 GGGGCCATGGGACAGGAGGGAGG - Intergenic
1184785445 22:46669373-46669395 CTGGCGGCGGGGAAGGAGGGTGG + Intronic
1184932319 22:47690539-47690561 GTGGAGCTGGGGAGGGAGGGAGG - Intergenic
1185031363 22:48444896-48444918 GGGGTAAGAGGGAAGGAGGGAGG + Intergenic
1185175423 22:49323848-49323870 GCTGCACTGGGGAGGGAGGGTGG - Intergenic
1185230304 22:49676920-49676942 CTGGCATTGGGGAGGGAGGCTGG - Intergenic
1185272557 22:49935746-49935768 GGGGCAAAGGGGAGGGTGGGGGG + Intergenic
1203251396 22_KI270733v1_random:120965-120987 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203259442 22_KI270733v1_random:166039-166061 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
949423855 3:3895099-3895121 GTGGCATGGGGGGAGGGGGGAGG - Intronic
949490499 3:4584469-4584491 GTGGGAACGGGGAAGCGGGGAGG + Intronic
949815203 3:8050876-8050898 CTGTAAATGGTGAAGGAGGGTGG + Intergenic
950085551 3:10254991-10255013 GTGGGAAGTGGGAAGGAGGAAGG - Intronic
950432177 3:12957163-12957185 GTGGCAGAGTGGAAGGAAGGAGG - Intronic
950548295 3:13652063-13652085 GTGGCAATGGGGAGTCATGGTGG - Intergenic
950572390 3:13809467-13809489 ATGGCAGAGGGGAAGGAGGTGGG + Intergenic
950647429 3:14385623-14385645 GTGGGAATCAGGAGGGAGGGAGG - Intergenic
950743643 3:15069433-15069455 AGGGCAATGGGGAATGAGGTTGG - Intergenic
952405863 3:33004720-33004742 GTGGCAGTAGGGAGGGAGGGCGG - Intronic
952554541 3:34517402-34517424 ACTGCAGTGGGGAAGGAGGGAGG + Intergenic
952569235 3:34694471-34694493 GGGGGAAGGGAGAAGGAGGGAGG - Intergenic
952613516 3:35240711-35240733 GTGGGGTGGGGGAAGGAGGGAGG + Intergenic
952786194 3:37157560-37157582 GGGGAAAAGAGGAAGGAGGGAGG + Intronic
953139079 3:40210819-40210841 CTGACAATGGGGAGGGAGTGTGG - Intronic
953496309 3:43390276-43390298 AGGGCAGTGGGGAAGGAGGAGGG - Intronic
953849653 3:46455933-46455955 GTGGCTGTGGTGAAGAAGGGCGG - Exonic
954321254 3:49833417-49833439 GTGGATATGGGGAGTGAGGGAGG - Intronic
954460826 3:50625921-50625943 GTGGGGGTGGGGAAGGAAGGAGG + Intronic
954636131 3:52071793-52071815 GTGCCAGTGGGGATGGTGGGGGG - Intergenic
955096994 3:55808527-55808549 GAGGCACTGGGAGAGGAGGGAGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955750752 3:62183811-62183833 GTGGGGATGGGGAAGGATGAAGG + Intronic
955771281 3:62387141-62387163 GTGGTTATGAGCAAGGAGGGGGG - Intergenic
955845561 3:63159405-63159427 GTGGCATTGGGGAAGGTGGGTGG - Intergenic
955865535 3:63379829-63379851 GTGGGGTTGGGGGAGGAGGGAGG - Intronic
955909356 3:63844197-63844219 GTGGCTAGGGAGAAGGAGGTTGG + Intronic
956054461 3:65283917-65283939 GTGGTAAAGAGGAAGGAGGCAGG - Intergenic
956055182 3:65291082-65291104 AAGGCCATGGTGAAGGAGGGGGG - Intergenic
956197569 3:66668607-66668629 GTGGTAATGAGGTAGGAGGTGGG + Intergenic
956532099 3:70231999-70232021 ATGGCTAAGGGGAAGAAGGGTGG - Intergenic
956539621 3:70321249-70321271 CTGGGAATGGGGATGGAGGGAGG - Intergenic
956551653 3:70467550-70467572 GTAGGGATGGGGAAAGAGGGTGG - Intergenic
956879968 3:73500425-73500447 GTGGAAATGGGGTTGGAGAGGGG - Intronic
956947371 3:74238484-74238506 GGGGGAAGGGGGAAGGGGGGAGG - Intergenic
956963628 3:74433030-74433052 GAGGCAGTGGGGAAGGAAAGGGG + Intronic
957321906 3:78642363-78642385 GCGGAAATGGTGAAGGAGGCTGG + Intronic
957381458 3:79435062-79435084 GTGGGGTTGGGGGAGGAGGGAGG + Intronic
957632855 3:82740554-82740576 GTGGCCATGGAGAAGCAGAGAGG + Intergenic
958015385 3:87934347-87934369 GTTGGAATGGGGACAGAGGGTGG - Intergenic
958030337 3:88101078-88101100 CTAGCAATGGGTAAGGAGTGGGG - Intronic
959504188 3:107139936-107139958 GTGGCAGTGGGGGTGGGGGGTGG - Intergenic
959539742 3:107524810-107524832 GGGGCGAAGGGGAAGGTGGGTGG + Intronic
959894602 3:111592074-111592096 TTGGGAATGGGGATGGAGTGGGG - Intronic
959944193 3:112110400-112110422 GTGGCAGTGGAGAAGAAAGGAGG - Intronic
960253816 3:115488793-115488815 GTGGCAGTGGGGATGAAGGGTGG - Intergenic
961055653 3:123786520-123786542 GTGGGGGTGGGGGAGGAGGGGGG + Intronic
961160836 3:124723406-124723428 TGGGGGATGGGGAAGGAGGGAGG + Intronic
961173563 3:124816110-124816132 GTGGGAAGGGGGAAGAAAGGGGG + Intronic
961522751 3:127476697-127476719 GAGGGAATGGGAAAGGAGGAAGG + Intergenic
962411450 3:135144654-135144676 GTGCCAAAGGGGAATGTGGGGGG - Intronic
962430650 3:135316114-135316136 GTGGCAAGGGATAAGGAGGTTGG - Intergenic
962441924 3:135427894-135427916 GTGGGGTTGGGGAAGGGGGGAGG + Intergenic
962630355 3:137269556-137269578 GTGGTGATGGGGGTGGAGGGAGG + Intergenic
963254436 3:143130798-143130820 GAGGGATTGGGGAGGGAGGGAGG - Intergenic
963305973 3:143653394-143653416 TTGCCAAGGGGGAAAGAGGGAGG + Intronic
963415751 3:144993793-144993815 GTGGGGTTGGGGAAGGGGGGAGG - Intergenic
963502549 3:146146488-146146510 GTGGGAACTGGGGAGGAGGGCGG + Intronic
963599006 3:147361135-147361157 GAGGAAAGGAGGAAGGAGGGGGG - Intergenic
963630937 3:147729137-147729159 GTGGGATGGGGGAAGGGGGGAGG + Intergenic
964406973 3:156359414-156359436 GTGGCAATGGGTTATGGGGGAGG - Intronic
964779127 3:160315687-160315709 ATGGCAAAGGGAAAAGAGGGTGG - Intronic
964907352 3:161733754-161733776 CTGGGACTGGGCAAGGAGGGTGG - Intergenic
964920748 3:161892567-161892589 GTGGAAAAGGGGAAGGAGAAAGG + Intergenic
965505374 3:169509504-169509526 GAGGAAATGGGGGAGGAGGCAGG - Intronic
966279994 3:178215005-178215027 GTGGGGAGGGGGAAGGAAGGAGG - Intergenic
966623631 3:181993062-181993084 GTGGCAAGGGGGAGGGGGAGGGG + Intergenic
966635591 3:182129792-182129814 ATGTAAATGGGGAAGGAGCGGGG + Intergenic
966830253 3:184002054-184002076 ATGGCAATGGGGCAGGAGTAAGG + Intronic
966881122 3:184351908-184351930 AGGCCAGTGGGGAAGGAGGGAGG - Intronic
967035739 3:185647223-185647245 GTGGAGCAGGGGAAGGAGGGGGG + Intronic
967298717 3:187991065-187991087 GTGGCGATGGAGAAGGAGAAAGG - Intergenic
967899495 3:194434994-194435016 TTCTCAATGGGGAAGGAGGAGGG + Intronic
968005198 3:195237966-195237988 GGGGCAGTGGGGAAGGTAGGAGG - Intronic
968020812 3:195387104-195387126 TTGGCAATGAAGAGGGAGGGAGG + Intronic
968251668 3:197222260-197222282 GTGGAAAGGGGAAAGGAGTGTGG - Intronic
968481115 4:833489-833511 GGGGAAAGGAGGAAGGAGGGAGG + Intergenic
968673256 4:1863640-1863662 GGGGCTATGGGGGAGGAAGGAGG + Intergenic
968902788 4:3439173-3439195 GCTGCAGTGGGGAAGCAGGGTGG + Intronic
969032204 4:4224390-4224412 GAGGGAATAGGGAGGGAGGGAGG + Intronic
969180371 4:5436049-5436071 GTGGCCATGGGCAAGCAGGGCGG + Intronic
969213747 4:5707632-5707654 GTGGCAGTGGGGAGTGAGGAGGG + Intronic
969457159 4:7306650-7306672 CTGGTCCTGGGGAAGGAGGGTGG + Intronic
969483935 4:7461307-7461329 AAGGCAGAGGGGAAGGAGGGCGG - Intronic
969506564 4:7591693-7591715 GGGGCGATGGGGAAGGATTGGGG - Intronic
970719203 4:18966401-18966423 GTGGGGTTGGGGAAGGGGGGAGG + Intergenic
971707706 4:30068338-30068360 ATGGCATGGGGGAAGGAGAGGGG + Intergenic
972032249 4:34476473-34476495 GTGGCATAGGGGGAGGGGGGAGG - Intergenic
973242173 4:47968782-47968804 GTGGAAATGGGGCAGGAGAAAGG + Intronic
973595006 4:52479020-52479042 GTGGCAATAGGGAAAGAGGAAGG - Intergenic
973612461 4:52649114-52649136 GTGACATTGGGGAAGGAAGTTGG - Intronic
973614664 4:52666353-52666375 GAGGAAAAAGGGAAGGAGGGAGG + Intergenic
973721110 4:53724532-53724554 GTGGGGAGGAGGAAGGAGGGAGG - Intronic
973817127 4:54629579-54629601 GTGCCAATGGAGAGGAAGGGGGG + Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
974937568 4:68426173-68426195 GTGGGGTTGGGGAAGCAGGGAGG + Intergenic
976245517 4:83002449-83002471 GAGGGAAGGAGGAAGGAGGGAGG + Intronic
977057993 4:92217674-92217696 GAGGCAATGGAGATGGAGTGGGG + Intergenic
977376857 4:96216669-96216691 GTGGCGATGTGGTAGGAGAGAGG - Intergenic
978297281 4:107220566-107220588 GGGAGAGTGGGGAAGGAGGGAGG + Intronic
978340513 4:107717738-107717760 GTGGAAATTGGGAAGTAGGTTGG - Intronic
978819065 4:112944580-112944602 GTCCCAATGGGGAAGGGGGGTGG - Intronic
979532447 4:121783456-121783478 GTGGGAGTGAGGAAGGAAGGAGG - Intergenic
979759093 4:124377562-124377584 GAGGCAAAGGGGAGAGAGGGAGG - Intergenic
979903282 4:126251190-126251212 GTGGGATGGGGGAAGGAGGGAGG - Intergenic
980022135 4:127722782-127722804 CTGGAAGTGGGGAAGGAGAGGGG - Exonic
980079966 4:128333807-128333829 ATGGCAGTGGGGGAGGTGGGTGG + Intergenic
980165011 4:129215243-129215265 GTGGCTGTGGGAAAGGAGGGTGG + Intergenic
981157280 4:141453922-141453944 ATGGCAAAAGGGAGGGAGGGAGG - Intergenic
981585850 4:146301389-146301411 GTGGCACTGGAGAAGCAGGTTGG + Intronic
981783027 4:148446208-148446230 GTGGGAATGTGGAAGGAGAAAGG - Intergenic
981865477 4:149412902-149412924 GTGGCAAGGAGGTAGGAGAGTGG + Intergenic
982152132 4:152471504-152471526 AAGGGAATGGGGAGGGAGGGAGG + Intronic
982316527 4:154037546-154037568 ATGGCAAAGGAGAAGGAGGTTGG - Intergenic
982354110 4:154448108-154448130 GAGGGAATGCGGAAGCAGGGAGG - Intronic
982740784 4:159054813-159054835 GTGGCAAGGGGCAGGGTGGGAGG - Intergenic
983580649 4:169306400-169306422 TTGGAAGAGGGGAAGGAGGGAGG + Intergenic
983769955 4:171536822-171536844 CTGGCAAGGGGGAAAGGGGGAGG - Intergenic
984863122 4:184257326-184257348 CAGGCAGTGGGGAGGGAGGGAGG + Intergenic
984863145 4:184257402-184257424 CAGGCAGTGGGGAGGGAGGGAGG + Intergenic
984952388 4:185017183-185017205 GGGCCCAAGGGGAAGGAGGGGGG - Intergenic
985196917 4:187440991-187441013 GTGGCAGTGGAGATGGAGGGAGG + Intergenic
985704314 5:1391698-1391720 GTGACGATGGGGACGGTGGGAGG + Intergenic
985980377 5:3457513-3457535 GTGTCCATGTGGGAGGAGGGGGG + Intergenic
986313354 5:6571075-6571097 GAGGGAAGAGGGAAGGAGGGTGG + Intergenic
987050337 5:14143327-14143349 ATTTCAATGGGGAAGGAAGGAGG - Intergenic
987067817 5:14307200-14307222 GAGGCAGTGGGGAGAGAGGGTGG - Intronic
987651992 5:20753400-20753422 GTTGCCATGGGGCAGGAGAGGGG + Intergenic
988358191 5:30202990-30203012 GAAGCTATGGGGAAGGAGAGAGG + Intergenic
988503493 5:31802210-31802232 GTGGTATTGGGGTGGGAGGGAGG + Intronic
988623638 5:32848441-32848463 GGGGAAGGGGGGAAGGAGGGAGG - Intergenic
988743570 5:34108076-34108098 GTTGCCATGGGGCAGGAGAGGGG - Intronic
988789290 5:34592495-34592517 TTGGCAGTGGGGAAGGGGGAAGG - Intergenic
988875983 5:35446123-35446145 GTGGCATGGGGGGAGGGGGGAGG + Intergenic
989077199 5:37576125-37576147 GAGGGAGGGGGGAAGGAGGGCGG - Intronic
989189392 5:38655314-38655336 GAAGGAATGGGGAAGGAGAGAGG - Intergenic
990213202 5:53502645-53502667 GTGGTAATGGGGGGTGAGGGGGG + Intergenic
990334568 5:54759513-54759535 GAGGAAAGGAGGAAGGAGGGTGG - Intergenic
991501518 5:67281992-67282014 GGGGGAAGGGGGAAGGAGGAAGG - Intergenic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
992108561 5:73471037-73471059 GTGGCAATGGTAAAGGAAGTGGG - Intergenic
992333004 5:75737130-75737152 GGGGCAATGGGGAAACAGAGTGG - Intergenic
992427519 5:76672904-76672926 GTGGGATTGGGGGAGGGGGGAGG + Intronic
992442392 5:76808368-76808390 GTGGGAATGTGGAAGAAGGAGGG - Intergenic
993538530 5:89119022-89119044 GGGGAAATGGGGAAGATGGGAGG + Intergenic
993633645 5:90317943-90317965 CTGTCACTGGGGAAGGGGGGTGG + Intergenic
994933960 5:106227480-106227502 GTGGTAGTGGTGAAGGAGGCAGG - Intergenic
995494258 5:112724814-112724836 GTGGCGGTGGGTAAGGATGGAGG + Intronic
995582452 5:113616201-113616223 GTGGGGTGGGGGAAGGAGGGAGG - Intergenic
995951671 5:117721580-117721602 GTGGGGTTGGGGGAGGAGGGAGG + Intergenic
996038804 5:118787717-118787739 TTGACAGTGTGGAAGGAGGGTGG + Intergenic
996533825 5:124555288-124555310 ATGGCAAAGGCTAAGGAGGGAGG - Intergenic
996765609 5:127031468-127031490 CTTGCGAAGGGGAAGGAGGGCGG - Intergenic
996766500 5:127039598-127039620 CTGGGGATGGGGAAGGATGGAGG + Intergenic
996964931 5:129297006-129297028 GTGGGATGGGGGAAGGGGGGAGG - Intergenic
996984148 5:129537775-129537797 GTGGGATGGGGGAAGGGGGGAGG + Intronic
997272288 5:132550938-132550960 GTGATAATGTGGAAGGTGGGGGG + Intronic
997642770 5:135460369-135460391 GTGGCAAGGGGGAAGGAGGCTGG - Intergenic
997963261 5:138338363-138338385 GGGGAAAGAGGGAAGGAGGGAGG - Intronic
998258160 5:140606072-140606094 GGGGGAAGGGGGAGGGAGGGAGG - Intergenic
998270921 5:140705864-140705886 GTGTCAATGGGGAGGGATAGAGG + Exonic
998445140 5:142192672-142192694 GTGGCAGTGGGGGAGGGGGCTGG - Intergenic
998851619 5:146356383-146356405 GAGGAAATGGGGAAGAAAGGAGG - Intergenic
998920795 5:147065627-147065649 GTGGCAATGGGGTTGGAGCGAGG + Intronic
999349625 5:150857073-150857095 GTGGGGTTGGGGGAGGAGGGAGG - Intronic
999727559 5:154449004-154449026 GTGGGGTTGGGGCAGGAGGGTGG - Intronic
999728514 5:154457308-154457330 GAGGGTATGGGGTAGGAGGGTGG + Exonic
999807964 5:155101411-155101433 GTGGCTATCTGCAAGGAGGGAGG + Intergenic
1000113886 5:158135260-158135282 GAGGGGATGGGGAAGGAGAGAGG + Intergenic
1000181599 5:158817040-158817062 GTGGCAATTGCGAAGTGGGGAGG - Intronic
1000296686 5:159918258-159918280 GCGGCATTTGGGAAGCAGGGAGG + Intronic
1001173231 5:169441475-169441497 CTGCCATTGGGGCAGGAGGGAGG - Intergenic
1001209372 5:169795881-169795903 CTGGCAATGGGGAAGGGGCGGGG - Intronic
1001275311 5:170346486-170346508 CTGGCAATGGGCAAGCTGGGTGG + Intergenic
1001929481 5:175662589-175662611 GGGGCAGAGGGGAAGCAGGGAGG - Intronic
1002093012 5:176815806-176815828 GTGTCAATGGCGGGGGAGGGGGG - Intronic
1002307918 5:178294522-178294544 GGGGCACTGGGGAAGGAGCTCGG - Intronic
1002400497 5:178989190-178989212 GTGGGGAGGGGGAAGGCGGGAGG - Intronic
1002552965 5:180010730-180010752 TAGGGAAGGGGGAAGGAGGGAGG + Intronic
1002838301 6:884082-884104 AGGGCACTGGGGAAGGAGGGCGG + Intergenic
1002846359 6:948628-948650 GAGGCATTGAGAAAGGAGGGAGG + Intergenic
1002858510 6:1058929-1058951 GTGTCAAAAGGGAAGGAGGCCGG + Intergenic
1003360336 6:5419799-5419821 GTGGGCTTGGGGCAGGAGGGAGG - Intronic
1003381918 6:5632570-5632592 GGGGGAAGGGGGAAGGAGGAAGG - Intronic
1003730205 6:8813094-8813116 GTGGGGTTGGGGAAGGGGGGAGG + Intergenic
1003904459 6:10686399-10686421 AAGGGAATGGGGAAGGAGGAGGG + Intronic
1004448056 6:15719894-15719916 TTGGCAAAGGGGAAGAAAGGAGG - Intergenic
1004626884 6:17385157-17385179 GAGGGATGGGGGAAGGAGGGAGG + Intergenic
1005040648 6:21596618-21596640 GGGGCAAGGGGAAAAGAGGGAGG - Exonic
1005064844 6:21808025-21808047 GAAACACTGGGGAAGGAGGGTGG + Intergenic
1005109303 6:22262061-22262083 GTGGGATGGGGGAAGGGGGGAGG - Intergenic
1005233854 6:23736801-23736823 GCGCCAAGAGGGAAGGAGGGTGG - Intergenic
1005681199 6:28210237-28210259 GTGGCAATAGGAATGGAGAGAGG - Intergenic
1006029843 6:31170687-31170709 GTGGGACTGGGGAGGGAGAGAGG - Exonic
1006169233 6:32083604-32083626 GTGGCAGTGGGGCTGGATGGGGG - Intronic
1006187870 6:32190817-32190839 GCAGCAGTGGGGAGGGAGGGTGG + Exonic
1006242037 6:32691124-32691146 GTGGGGAGGGGGGAGGAGGGAGG - Intergenic
1006574468 6:35034409-35034431 GTGGCATTGGGGAAGGCAAGTGG + Intronic
1006745153 6:36336551-36336573 GAGGCAATGGGGGTGGAGGTGGG - Intronic
1007321634 6:41032339-41032361 GTGGCAGGTGGGAAGGAGAGGGG - Intronic
1007509162 6:42362349-42362371 GCGACAGTGGGGAAGGGGGGTGG - Intronic
1007941383 6:45784856-45784878 GTAGCCAGAGGGAAGGAGGGAGG - Intergenic
1008050967 6:46899802-46899824 ATGGCAATGGGGAGGGAAGGAGG + Intronic
1008221808 6:48863405-48863427 GGGGAAATGGTGAAGGAGGTTGG - Intergenic
1008331157 6:50246433-50246455 GTGGAATGGGAGAAGGAGGGAGG - Intergenic
1009462850 6:63934748-63934770 GTGGCAGAGGGGGAGGGGGGAGG + Intronic
1009463335 6:63940825-63940847 GTGGCAGAGGGGGAGGGGGGAGG - Intronic
1010307838 6:74345606-74345628 GTGGCAACTGTGAAGGAGGGTGG - Intergenic
1010361470 6:74999846-74999868 GTGGGATTGGGGGAGGGGGGAGG + Intergenic
1010681287 6:78802312-78802334 GTGGGGTGGGGGAAGGAGGGAGG - Intergenic
1010682941 6:78817943-78817965 GTGGCAATGGGGCTGGGGGAGGG + Intergenic
1011035282 6:82967457-82967479 GAGGCGATGGGGAAGGGAGGTGG - Intronic
1011247609 6:85336043-85336065 GTGGGGTTGGGGGAGGAGGGAGG + Intergenic
1011740097 6:90350871-90350893 GTGGCAGAGGAGAGGGAGGGAGG - Intergenic
1012167131 6:95971353-95971375 GTGGGGTTGGGGGAGGAGGGAGG - Intergenic
1012555412 6:100505551-100505573 GTGGCAGTGGGGAAGGTGGCTGG + Intergenic
1013212924 6:108002809-108002831 CTCCCTATGGGGAAGGAGGGAGG - Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1014591514 6:123277495-123277517 GTGGTCATGGGGCAGTAGGGTGG + Intronic
1015279930 6:131422147-131422169 GTGGCAGTGAAGATGGAGGGAGG + Intergenic
1015591459 6:134826697-134826719 GAGGGAAGGGGGAAAGAGGGGGG + Intergenic
1015827018 6:137324914-137324936 GTGGCAAAGGGTAAGCAGCGAGG + Intergenic
1015836192 6:137422667-137422689 TTGGCAATTGGGAAGTGGGGAGG + Intergenic
1016074415 6:139778717-139778739 GTGGCATTGGGGGTGGGGGGAGG + Intergenic
1016154190 6:140783282-140783304 GTAACAAGAGGGAAGGAGGGAGG + Intergenic
1016386170 6:143532898-143532920 GTGGCAATGGAATAGCAGGGAGG + Intergenic
1016395238 6:143617138-143617160 GTGGCAGTGGGGAAGGGGAGAGG + Intronic
1016950838 6:149578000-149578022 GCAGGAATGGGGAAAGAGGGTGG - Intronic
1016995411 6:149959173-149959195 ATGGAAATGGGAAAGGAAGGGGG - Intergenic
1017408670 6:154146881-154146903 GGGGCATTGGGAAAGGAGGGTGG + Intronic
1017754545 6:157518375-157518397 GGGGCAATAGGGAAGGGGTGGGG + Intronic
1017931912 6:158963406-158963428 AAGGGAAGGGGGAAGGAGGGGGG - Intergenic
1018176715 6:161183848-161183870 GGGGACATGGGGAAGCAGGGAGG + Intronic
1018542889 6:164902128-164902150 ATGGCAAAGTGGAAAGAGGGTGG + Intergenic
1018873393 6:167799846-167799868 GGGGCCACGAGGAAGGAGGGAGG + Intergenic
1018907772 6:168085340-168085362 GTGGCCATGTGGAGGGAGGCTGG - Intergenic
1018956744 6:168415502-168415524 GTAGGAAGGGGGAATGAGGGTGG + Intergenic
1018985883 6:168636915-168636937 GTGGGGAGGGGGGAGGAGGGAGG - Intronic
1019266793 7:121611-121633 GAGGCAGGAGGGAAGGAGGGGGG + Intergenic
1019360639 7:602591-602613 CTGGCGCTGGGGCAGGAGGGTGG + Intronic
1019523942 7:1472397-1472419 GTGGCAGTGCTGCAGGAGGGCGG + Intronic
1019549163 7:1593703-1593725 CTGGCCAAGGGGAAGGAAGGAGG + Intergenic
1019609486 7:1929741-1929763 GTGGCAGTGGGGACGGGGCGAGG - Intronic
1019609496 7:1929768-1929790 GTGGCAGTGGGGACGGGGCGAGG - Intronic
1019609506 7:1929795-1929817 GTGGCAGTGGGGACGGGGCGAGG - Intronic
1019609561 7:1929958-1929980 GTGGCAGTGGGGACGGGGCGAGG - Intronic
1019609595 7:1930067-1930089 GTGGCAGTGGGGACGGGGCGAGG - Intronic
1019609639 7:1930203-1930225 GTGGCAGTGGGGACGGGGCGAGG - Intronic
1019609649 7:1930230-1930252 GTGGCAGTGGGGACGGGGCGAGG - Intronic
1019609708 7:1930395-1930417 GTGGCAGTGGGGACGGGGCGAGG - Intronic
1019609718 7:1930422-1930444 GTGGCAGTGGGGACGGGGCGAGG - Intronic
1019609750 7:1930505-1930527 GTGGCAGTGGGGACGGGGCGAGG - Intronic
1020856197 7:13427396-13427418 GAGGGAAGTGGGAAGGAGGGAGG + Intergenic
1021317988 7:19174276-19174298 ATAGCAATGGGGAAGGAGTAGGG - Intergenic
1021320477 7:19204179-19204201 CTGGCTATGGGGAAGGAGGTGGG - Intergenic
1021697121 7:23286335-23286357 GGGGAGAGGGGGAAGGAGGGAGG - Intergenic
1021745028 7:23731585-23731607 CTGGAAAAGGGGAAGGAAGGAGG - Intronic
1022033267 7:26511820-26511842 GTGGAAATCTGGAAGGAGAGGGG - Intergenic
1022331736 7:29385614-29385636 GTGGCACTGGGGAACCAGTGGGG + Intronic
1022819981 7:33950213-33950235 CTGGCCATGGTGGAGGAGGGTGG + Intronic
1022820189 7:33951825-33951847 CTGGCCATGGTGGAGGAGGGTGG + Intronic
1022977196 7:35569600-35569622 TTGGCAATTGGGAAGGCAGGTGG + Intergenic
1023003721 7:35840138-35840160 GGGGGAAGGGGGAAGGAGGAAGG - Intronic
1023175608 7:37432733-37432755 CAGGCACTGGGGAGGGAGGGAGG + Intronic
1023203504 7:37723474-37723496 GTGGACATGGTGAGGGAGGGAGG + Intronic
1023256592 7:38318645-38318667 GTGGCCATGGGGAAGGTGGGTGG - Intergenic
1023354302 7:39351761-39351783 GTGGTACTGGGGCAGGAGGGTGG - Intronic
1023761122 7:43466036-43466058 GAAGGAAGGGGGAAGGAGGGAGG + Intronic
1023892972 7:44406770-44406792 GTGAAAATGGGGGAAGAGGGAGG + Intronic
1024168011 7:46754146-46754168 GGGGCAATGGGGACAGAGGAAGG + Intronic
1024198757 7:47085924-47085946 GTGGCAATCAGGAAGGACTGAGG - Intergenic
1024257549 7:47549925-47549947 GTGGGGATGGGGTGGGAGGGCGG - Intronic
1024893547 7:54230272-54230294 GTGGAGTTGGGGGAGGAGGGAGG - Intergenic
1024900371 7:54312115-54312137 GTGGAGTTGGGGGAGGAGGGAGG + Intergenic
1024936049 7:54713184-54713206 GAGGCAAGCGGGAAAGAGGGAGG + Intergenic
1025639104 7:63350551-63350573 GTGGCAGTGGTGAGGGAGTGAGG + Intergenic
1025643595 7:63397541-63397563 GTGGCAGTGGTGAGGGAGTGAGG - Intergenic
1025838667 7:65123019-65123041 GTGGAAATGGGGTAGAAGGCCGG - Intergenic
1025884405 7:65572963-65572985 GTGGAAATGGGGTAGAAGGCCGG + Intergenic
1026638797 7:72106647-72106669 GGGGGAAAAGGGAAGGAGGGAGG + Intronic
1027250562 7:76396155-76396177 TGGGGAATGGGGCAGGAGGGAGG + Intronic
1027270421 7:76515639-76515661 GTGGGATGGGGGACGGAGGGTGG - Intronic
1027329181 7:77073498-77073520 GTGGGAGTGGGGAGGGAGGCAGG - Intergenic
1027839668 7:83292783-83292805 GTGGGATGGGGGAAGGGGGGAGG + Intergenic
1028050705 7:86181736-86181758 GTGGCAAAGGGGAAGAATGTGGG - Intergenic
1028526413 7:91791523-91791545 GTGGGGTTGGGGCAGGAGGGAGG - Intronic
1028651251 7:93152528-93152550 GTGGGGATTGGGAAGGGGGGGGG + Intergenic
1028872710 7:95786761-95786783 GGGGCCAAGGGGAAGGAGGATGG - Intronic
1028929054 7:96392663-96392685 GGCGGAATGGGGAGGGAGGGGGG - Intergenic
1029404692 7:100367450-100367472 TTGCCAATGGGGAACGAGTGTGG - Exonic
1029418034 7:100455952-100455974 GTGGCAATTTGGAAGGAGGTTGG - Intergenic
1029456338 7:100674241-100674263 GTGGCGGTGGGGAAAGGGGGCGG - Intronic
1029693290 7:102196695-102196717 GGGGCAACTGAGAAGGAGGGGGG - Exonic
1029786583 7:102797872-102797894 GTGGGAGTGGGGAGGGAGGCAGG + Intronic
1030022871 7:105293043-105293065 GAGGCCAAGGGGGAGGAGGGAGG + Intronic
1030782131 7:113614339-113614361 GTGGGAGTGGGGAAAGGGGGAGG + Intergenic
1031101567 7:117486854-117486876 GTGGCCATGGTGGAGGTGGGTGG + Intronic
1031310089 7:120185426-120185448 GAGGCAATTTGGAAGGTGGGAGG + Intergenic
1031443357 7:121821203-121821225 GTAGAGATTGGGAAGGAGGGAGG - Intergenic
1031604096 7:123748527-123748549 GTGGGAGTGGGGAAGGAGGCGGG - Intronic
1032083695 7:128872820-128872842 CTGGTGATGGGGGAGGAGGGAGG - Intronic
1032254562 7:130286684-130286706 GTGGCAGTGGGGACAGAGGATGG + Intronic
1032260439 7:130331770-130331792 GTGGCCCTGGCGCAGGAGGGAGG - Intergenic
1032283917 7:130526940-130526962 GTGGGAATGGGGGTGGGGGGAGG + Intronic
1032351518 7:131168310-131168332 GTGGCAAAGAGGAAGGAGTCAGG - Intronic
1032519444 7:132532852-132532874 GTAGAGATGGGGAAGGAAGGAGG - Intronic
1032799836 7:135309149-135309171 GGGAGAATAGGGAAGGAGGGAGG + Intergenic
1032879178 7:136070795-136070817 GTGAAAATGAGGCAGGAGGGTGG + Intergenic
1032991874 7:137402971-137402993 GAGGCAATGGGGTAGGCGTGGGG + Intronic
1033150185 7:138907668-138907690 GTGGCAGTTAGGAAGGACGGAGG - Intronic
1033263678 7:139865879-139865901 GAGGGAAGGAGGAAGGAGGGAGG + Intronic
1034193692 7:149229835-149229857 GGGGCAGAGGGAAAGGAGGGAGG + Intergenic
1034380895 7:150691410-150691432 AGGGAAATGGGGAAGGAGAGAGG + Intronic
1034859592 7:154584000-154584022 GTGGCAATGGGGAAGTGGAAGGG - Intronic
1034975483 7:155446868-155446890 AAGGAAAAGGGGAAGGAGGGAGG + Intergenic
1035177037 7:157058843-157058865 GTGCCCATGGGGAAGGCGTGGGG + Intergenic
1035295728 7:157865979-157866001 GCGGCAGCGGGGAAGGAGGCCGG - Intronic
1035564881 8:634945-634967 GTGCCTCTGGGGAAGGAAGGAGG + Intronic
1035642193 8:1192569-1192591 GTGGGAGTGGAGAGGGAGGGCGG - Intergenic
1035826885 8:2654205-2654227 GTGTCAAAGGGGATTGAGGGAGG - Intergenic
1035919624 8:3662838-3662860 GTGGGTAGGGGGAAAGAGGGGGG + Intronic
1037166829 8:15840226-15840248 GTGGGGTGGGGGAAGGAGGGAGG + Intergenic
1037467700 8:19176064-19176086 GGGGAAATGGGGAAAGAGAGAGG - Intergenic
1037496113 8:19442569-19442591 GTGGCGTTGGGGGAGGGGGGAGG + Intronic
1037598393 8:20373584-20373606 GGGGAAGTGGGGAAGGAGGAGGG + Intergenic
1037776240 8:21837806-21837828 GTGGGCAGAGGGAAGGAGGGAGG - Intergenic
1037952593 8:23028672-23028694 GGGACACTGGGGAGGGAGGGTGG - Intronic
1038329773 8:26598861-26598883 GTGGCACTCGGGCAGGACGGGGG + Intronic
1038396769 8:27251952-27251974 GTGGAATGGGGGAAGGGGGGAGG - Intronic
1038531345 8:28320292-28320314 GGATGAATGGGGAAGGAGGGTGG - Intronic
1038703873 8:29876182-29876204 TTGCCAATGGTTAAGGAGGGAGG + Intergenic
1039245089 8:35599944-35599966 GTGGGGTTGGGGGAGGAGGGAGG - Intronic
1039911767 8:41832300-41832322 GTGGCAGTGGGGAGGGAGGTGGG - Intronic
1040293655 8:46138240-46138262 GTGAAAATGGGGCAGCAGGGTGG - Intergenic
1040338655 8:46428893-46428915 GTGAAAATGGGGATGCAGGGTGG + Intergenic
1042126668 8:65544825-65544847 GTGGCAATGGGTAAGAAGAGAGG - Intergenic
1042349054 8:67757710-67757732 GTGGGGTGGGGGAAGGAGGGAGG + Intergenic
1042351485 8:67781796-67781818 GGGACAATGCTGAAGGAGGGAGG - Intergenic
1042905258 8:73766048-73766070 GAGGAAAAGGGGAGGGAGGGAGG + Intronic
1043189581 8:77201838-77201860 GTGGCATGGGGGGAGGGGGGAGG - Intergenic
1045055625 8:98365637-98365659 GTTGCTCTGGGGAGGGAGGGAGG - Intergenic
1045609278 8:103816651-103816673 GTGGTAATGGAGAGGGAAGGTGG + Intronic
1045777401 8:105821876-105821898 GTGGCAGTGGCTAAGGAGTGAGG - Intergenic
1046269468 8:111874644-111874666 GTGGCATGGGGGGAGGGGGGAGG + Intergenic
1046683463 8:117197413-117197435 GTGGGATGGGGGAAGGGGGGAGG + Intergenic
1046870959 8:119205530-119205552 GTGGCAGTGGGGGAGGCGGGGGG + Intronic
1046980849 8:120335083-120335105 GAGGGAATGGGGAAGAAGGAAGG + Intronic
1047224070 8:122942166-122942188 GTGGCAATGGTGACGGGTGGGGG - Intronic
1047240131 8:123079787-123079809 GCTGCAATGGGGAAGGAGAAAGG - Intronic
1047418904 8:124689856-124689878 GTGGCAGTGGGGATGGGGTGGGG + Intronic
1047458725 8:125041241-125041263 CTGGCAAAGGGGAGTGAGGGAGG + Intronic
1047623773 8:126635046-126635068 GTGGCCATGTTGGAGGAGGGCGG - Intergenic
1047685581 8:127302028-127302050 ATGGCAATGGGGAGACAGGGTGG + Intergenic
1047907008 8:129483149-129483171 GGGGGAAGGGGGAAGGAGGAAGG + Intergenic
1048727024 8:137398169-137398191 GTGGCAAGGGGGAGGGGGAGGGG + Intergenic
1048780229 8:137991475-137991497 GAGTCAGTGGGGAAGGAGAGTGG - Intergenic
1049047660 8:140165579-140165601 AAGGGAAGGGGGAAGGAGGGAGG + Intronic
1049088476 8:140495722-140495744 TTGGCAATGGGGCAGGGGGCTGG - Intergenic
1049169215 8:141148237-141148259 GTGGAAAGGAGGGAGGAGGGAGG + Intronic
1049246554 8:141565812-141565834 GTGAGGGTGGGGAAGGAGGGGGG + Intergenic
1049337872 8:142096106-142096128 GGGGCAGTGGGGAAGAGGGGAGG + Intergenic
1049371963 8:142272265-142272287 GTGGCTAGGTGGAAGGAGGAAGG - Intronic
1049434315 8:142579427-142579449 GTGGGACCTGGGAAGGAGGGAGG + Intergenic
1049776477 8:144408188-144408210 GTGGTGGTGGGGATGGAGGGAGG - Intronic
1049925080 9:400472-400494 GTGGTGATGGTGAAGGAGGTGGG - Intronic
1049958339 9:713485-713507 CTGGGAATGAGGAAGGATGGGGG + Intronic
1050262597 9:3856338-3856360 ATGGCAGTGGGGAGGGAGAGAGG - Intronic
1051366737 9:16326627-16326649 ATGCCGGTGGGGAAGGAGGGTGG + Intergenic
1051717751 9:20002772-20002794 TGGGCAGTGGGCAAGGAGGGAGG - Intergenic
1052081790 9:24214934-24214956 GTGGGGAGGGGGAAGGGGGGAGG + Intergenic
1052854679 9:33399824-33399846 ATGGCCATGGGGGAGTAGGGTGG + Intronic
1053050545 9:34958023-34958045 GTGGGAATGCGGGAGGACGGCGG - Intronic
1053056138 9:34994031-34994053 GTGGCCATGGGGTGGGAGGCAGG + Intronic
1053066556 9:35073152-35073174 GTGACAATGGGGTAGGAGTGGGG - Exonic
1053152967 9:35754566-35754588 GTGGCAGTGGGGGAGAAAGGGGG - Exonic
1053453774 9:38214901-38214923 GTGGGAGTGGGGACGGGGGGCGG - Intergenic
1053682697 9:40496105-40496127 ATGGCCATGGGGGAGTAGGGTGG + Intergenic
1054281017 9:63128824-63128846 ATGGCCATGGGGGAGTAGGGTGG - Intergenic
1054295796 9:63331619-63331641 ATGGCCATGGGGGAGTAGGGTGG + Intergenic
1054428463 9:65141327-65141349 ATGGCCATGGGGGAGTAGGGTGG + Intergenic
1054501917 9:65880218-65880240 ATGGCCATGGGGGAGTAGGGTGG - Intronic
1054967555 9:71046617-71046639 GTGACAATAGGGAAGGAGGGTGG - Intronic
1055229489 9:74044614-74044636 GGGGCAATGTGGAAGCAGGGAGG + Intergenic
1055515013 9:77024740-77024762 GAAGCAATGAGGAAGGAGGGTGG + Intergenic
1055872650 9:80902085-80902107 GTGGGTCAGGGGAAGGAGGGAGG + Intergenic
1055892937 9:81142440-81142462 GATGCAGTGGTGAAGGAGGGAGG - Intergenic
1056103999 9:83328986-83329008 GTGGCCATGAAGAAGGAGAGAGG - Intronic
1056530475 9:87482519-87482541 AGGGGAAGGGGGAAGGAGGGAGG + Intergenic
1056602157 9:88054832-88054854 GTGGCCATGGGGCAGGATGTGGG + Intergenic
1056617010 9:88177474-88177496 GGAGCAATGAGGAAGGAAGGAGG + Intergenic
1057117709 9:92541401-92541423 GTGGGGAGGGGGAAGGGGGGTGG - Intronic
1058035974 9:100253556-100253578 GTGGGATGGGGGAAGCAGGGAGG - Intronic
1058743103 9:107964047-107964069 GTGGCAGTGGGGAAAGATGATGG + Intergenic
1059764375 9:117370041-117370063 GTGGCAGTGTGGAGGGAGGTGGG - Intronic
1060050346 9:120374293-120374315 CTGTCATTGGGGAAGGAGAGGGG - Intergenic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060735742 9:126065572-126065594 GAGGGAGGGGGGAAGGAGGGAGG - Intergenic
1061176568 9:129001258-129001280 GTGGCAGTGTGGGAGGTGGGAGG + Intronic
1061339219 9:129965790-129965812 GAGGGAGGGGGGAAGGAGGGAGG + Intronic
1061827720 9:133272117-133272139 GTGGGAATGGGGAATGACTGCGG + Intronic
1061907069 9:133704237-133704259 GTTGCCATGGGGATGGAAGGTGG + Intronic
1061911778 9:133728840-133728862 GTGGCTAGAGGGAGGGAGGGAGG + Intronic
1062120694 9:134832574-134832596 GTGCCCATGGGGCAGCAGGGGGG - Intronic
1062159514 9:135072410-135072432 GGGGCTAAGGGGAAGGAGGTTGG - Intergenic
1062166061 9:135107880-135107902 GTGGCAATGGTGAAGGAGGGAGG - Intronic
1062332542 9:136051020-136051042 GGAGCAGCGGGGAAGGAGGGAGG + Intronic
1062449154 9:136608295-136608317 GGAGGAAGGGGGAAGGAGGGAGG + Intergenic
1062588733 9:137263503-137263525 AGGGCCAGGGGGAAGGAGGGAGG - Intronic
1062628549 9:137453689-137453711 GAGGCTCTGGGGAAGGTGGGCGG + Intronic
1203467798 Un_GL000220v1:104116-104138 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203475623 Un_GL000220v1:148092-148114 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1185734314 X:2485653-2485675 GAGGGATGGGGGAAGGAGGGAGG + Intronic
1185928742 X:4176308-4176330 ATGGGAATGGGGGATGAGGGAGG + Intergenic
1185951134 X:4435511-4435533 CTGGGAATGGGGAAACAGGGTGG + Intergenic
1186062110 X:5720111-5720133 GTGGCGTGGGGGAAGGGGGGAGG - Intergenic
1186443940 X:9609691-9609713 GTGGCAGTGAGGAGGGACGGGGG + Intronic
1186508122 X:10110226-10110248 TTGACAAGGGGGAAGGAGTGAGG + Intronic
1186695300 X:12023933-12023955 GTGGCAGTGGTGAAGAAGGTAGG + Intergenic
1187527390 X:20066386-20066408 GTGGGAATGAGGAAGGGGGATGG + Intronic
1187673363 X:21690918-21690940 GTAGGAATGGGGAATGAGAGGGG + Intergenic
1188277291 X:28216014-28216036 GAGGGAGGGGGGAAGGAGGGAGG - Intergenic
1188951012 X:36375185-36375207 GTGGCAATGCGGAAAGATGGCGG + Intronic
1189198989 X:39175591-39175613 AAGGCAGTGGGGAAGGAGAGAGG + Intergenic
1189513362 X:41685895-41685917 GTGGGAGTGAGGAAGGAGAGGGG + Intronic
1189534423 X:41922816-41922838 GGGGAAGAGGGGAAGGAGGGAGG + Intronic
1190218081 X:48493353-48493375 GTGGCAGAGGAGCAGGAGGGTGG - Intergenic
1190260388 X:48793505-48793527 GAGGGAATGGAGAAGGAAGGAGG - Intronic
1190882279 X:54500339-54500361 GTGGCAGTGGAGATGGAGAGAGG + Intergenic
1190910168 X:54764401-54764423 GTGGGGAGGGGGAAGGGGGGAGG - Intronic
1191103988 X:56760905-56760927 GTTGCACTGGGGAAGGTGTGAGG + Intergenic
1191181531 X:57568784-57568806 GTGGCATGGGGGGAGGAGGGAGG + Intergenic
1191900447 X:66034771-66034793 GTGGGGGTGGGGAAGGAGGTGGG + Intronic
1191945038 X:66524424-66524446 GTGGGGTTGGGGGAGGAGGGAGG - Intergenic
1191956204 X:66644974-66644996 GTGGGGTGGGGGAAGGAGGGAGG - Intergenic
1191980948 X:66924992-66925014 GTGGGGATGGGGGAGGGGGGAGG - Intergenic
1192197472 X:69038236-69038258 GTGGGAATGGAGAAGGAGTTTGG - Intergenic
1192238928 X:69314478-69314500 CAGGCAAGGGGGAGGGAGGGTGG - Intergenic
1192332432 X:70187127-70187149 GTAGCAATGGGGACAGAGGCAGG + Intronic
1193002118 X:76574628-76574650 GTGGCATGGGGGGATGAGGGAGG - Intergenic
1193669227 X:84363864-84363886 GTGGCTGAGGTGAAGGAGGGAGG + Intronic
1193679631 X:84502297-84502319 GTGAGAAGGGCGAAGGAGGGAGG - Intronic
1193737272 X:85173914-85173936 GTGGGGATGGGGGAGGGGGGAGG - Intergenic
1193786570 X:85767033-85767055 GTGGGGTGGGGGAAGGAGGGAGG - Intergenic
1195026494 X:100882821-100882843 ATGGCAAAGGGGAATGAAGGTGG + Intergenic
1195248586 X:103020602-103020624 GTGGCATGGGGGGAGGGGGGAGG - Intergenic
1195267850 X:103200969-103200991 GTGGTAATGAGGTAGGAGGTAGG + Intergenic
1195394767 X:104398822-104398844 GTGGGAAGGGGGCAGGAGGCAGG + Intergenic
1195821342 X:108948098-108948120 GAGGAAGAGGGGAAGGAGGGAGG - Intergenic
1195833997 X:109092031-109092053 GTGGGATGGGGGGAGGAGGGAGG - Intergenic
1196002652 X:110803360-110803382 GTGGGGTTGGGGAAGGGGGGAGG - Intergenic
1196126298 X:112103418-112103440 TTGGCTATGGGGGTGGAGGGAGG + Intergenic
1196568319 X:117235025-117235047 GTGGGAGTGGGGAAAGAGGAAGG - Intergenic
1196679247 X:118453996-118454018 GTGGCAATGGGAGTGGAAGGTGG + Intergenic
1198045097 X:132893667-132893689 GTGGCAGTGGGGGAGGATGAGGG + Intronic
1198410606 X:136363253-136363275 GTGGGAAGGGGGAAGGGGAGTGG - Intronic
1198450944 X:136767033-136767055 ACGGCAGTGGGGAAGAAGGGCGG + Intronic
1199057807 X:143318795-143318817 GTGGGGGTGGGGAAGCAGGGAGG + Intergenic
1199325969 X:146498804-146498826 ATGGCAATGGGGAAGGAATTGGG - Intergenic
1199748053 X:150787744-150787766 GTGGGATTGGGGGAGGGGGGAGG + Intronic
1199894534 X:152117781-152117803 GTGGCAGTGGGGAGGGGGGAAGG + Intergenic
1199894959 X:152119375-152119397 ATGGAAATGGGGATGGAGTGGGG + Intergenic
1199954517 X:152733429-152733451 GTGGCACTGGGGGAGGGGTGTGG - Intronic
1199996980 X:153031646-153031668 GGGGCCCTCGGGAAGGAGGGAGG + Intergenic
1200044807 X:153395822-153395844 GGGGCCCTCGGGAAGGAGGGAGG - Intergenic
1200062102 X:153488295-153488317 GAGGCAGAGGGGAAGGAGAGGGG - Intronic
1200234672 X:154462491-154462513 CTGGCAATGGTGAGGGTGGGCGG - Intronic
1200912250 Y:8541253-8541275 GTGGGGTTGGGGGAGGAGGGAGG + Intergenic
1201145727 Y:11064440-11064462 GTGGCATTGGGGGAGAAGAGGGG + Intergenic
1201256346 Y:12111996-12112018 GAGGGAAGGGGGAAGGAGGGAGG - Intergenic
1201466603 Y:14288134-14288156 GTGGGGTTGGGGGAGGAGGGAGG + Intergenic
1201491592 Y:14547835-14547857 GAGGAAATGGGGAAGGAATGAGG + Intronic
1201546212 Y:15164857-15164879 GTGGGGTTGGGGGAGGAGGGAGG + Intergenic
1201702555 Y:16900472-16900494 GAGGGAAATGGGAAGGAGGGAGG - Intergenic