ID: 1170817389

View in Genome Browser
Species Human (GRCh38)
Location 20:19725640-19725662
Sequence GTAAGCCATCTGAACAACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170817389_1170817390 -10 Left 1170817389 20:19725640-19725662 CCAAAGTTGTTCAGATGGCTTAC No data
Right 1170817390 20:19725653-19725675 GATGGCTTACTGTTACACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170817389 Original CRISPR GTAAGCCATCTGAACAACTT TGG (reversed) Intergenic
No off target data available for this crispr