ID: 1170817494

View in Genome Browser
Species Human (GRCh38)
Location 20:19727090-19727112
Sequence CACTCTGCAGAGATGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170817492_1170817494 -1 Left 1170817492 20:19727068-19727090 CCAAAATTCTGTGTGGGATATTC No data
Right 1170817494 20:19727090-19727112 CACTCTGCAGAGATGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170817494 Original CRISPR CACTCTGCAGAGATGGAAGC AGG Intergenic
No off target data available for this crispr