ID: 1170819410

View in Genome Browser
Species Human (GRCh38)
Location 20:19743658-19743680
Sequence CTGAATATATAAAGGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170819407_1170819410 -6 Left 1170819407 20:19743641-19743663 CCTAGGGAGCTGCAAGTCTGAAT No data
Right 1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170819410 Original CRISPR CTGAATATATAAAGGGACAA TGG Intergenic
No off target data available for this crispr