ID: 1170827862

View in Genome Browser
Species Human (GRCh38)
Location 20:19811521-19811543
Sequence CAGTGGGTGTGGAGGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170827850_1170827862 10 Left 1170827850 20:19811488-19811510 CCTGCAGTGGGAAACCCTTGGCA No data
Right 1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG No data
1170827855_1170827862 -5 Left 1170827855 20:19811503-19811525 CCTTGGCATGGATGGGAACAGTG No data
Right 1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG No data
1170827854_1170827862 -4 Left 1170827854 20:19811502-19811524 CCCTTGGCATGGATGGGAACAGT No data
Right 1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170827862 Original CRISPR CAGTGGGTGTGGAGGGGACA AGG Intergenic
No off target data available for this crispr