ID: 1170829905

View in Genome Browser
Species Human (GRCh38)
Location 20:19830971-19830993
Sequence CTGTGGAATGGGAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170829905_1170829911 -7 Left 1170829905 20:19830971-19830993 CCTGCTTCCTTCCCATTCCACAG No data
Right 1170829911 20:19830987-19831009 TCCACAGGCACTGATCCCACGGG No data
1170829905_1170829910 -8 Left 1170829905 20:19830971-19830993 CCTGCTTCCTTCCCATTCCACAG No data
Right 1170829910 20:19830986-19831008 TTCCACAGGCACTGATCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170829905 Original CRISPR CTGTGGAATGGGAAGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr