ID: 1170831236

View in Genome Browser
Species Human (GRCh38)
Location 20:19842657-19842679
Sequence TCTCAGTTAGAACTCTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170831236_1170831239 6 Left 1170831236 20:19842657-19842679 CCACCCAAGAGTTCTAACTGAGA No data
Right 1170831239 20:19842686-19842708 AAGAGATTCGTGTTGTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170831236 Original CRISPR TCTCAGTTAGAACTCTTGGG TGG (reversed) Intergenic
No off target data available for this crispr