ID: 1170831239

View in Genome Browser
Species Human (GRCh38)
Location 20:19842686-19842708
Sequence AAGAGATTCGTGTTGTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170831237_1170831239 3 Left 1170831237 20:19842660-19842682 CCCAAGAGTTCTAACTGAGATGT No data
Right 1170831239 20:19842686-19842708 AAGAGATTCGTGTTGTTTTCAGG No data
1170831238_1170831239 2 Left 1170831238 20:19842661-19842683 CCAAGAGTTCTAACTGAGATGTA No data
Right 1170831239 20:19842686-19842708 AAGAGATTCGTGTTGTTTTCAGG No data
1170831236_1170831239 6 Left 1170831236 20:19842657-19842679 CCACCCAAGAGTTCTAACTGAGA No data
Right 1170831239 20:19842686-19842708 AAGAGATTCGTGTTGTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170831239 Original CRISPR AAGAGATTCGTGTTGTTTTC AGG Intergenic
No off target data available for this crispr