ID: 1170838929

View in Genome Browser
Species Human (GRCh38)
Location 20:19908105-19908127
Sequence CCCTGCAGACAGATGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 318}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170838929_1170838934 14 Left 1170838929 20:19908105-19908127 CCATGCTCCATCTGTCTGCAGGG 0: 1
1: 1
2: 1
3: 31
4: 318
Right 1170838934 20:19908142-19908164 CCAAAAAAGACTCATCCAAGAGG 0: 1
1: 0
2: 0
3: 7
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170838929 Original CRISPR CCCTGCAGACAGATGGAGCA TGG (reversed) Intronic
900429910 1:2596560-2596582 CCCTGGAGACAGCAAGAGCATGG - Exonic
900466705 1:2829168-2829190 CGCGGCAGGCAGATGGAGGATGG - Intergenic
901148422 1:7084274-7084296 TCTTGAAGACAGATGGAGGACGG + Intronic
901414383 1:9106579-9106601 CCCTGGGGACAGATGGAGACGGG - Intronic
901649808 1:10737096-10737118 CCCAGCAGCTGGATGGAGCAGGG - Intronic
901681189 1:10913800-10913822 CCATGCAGACAGGTTGTGCATGG - Intergenic
901738071 1:11324845-11324867 CCCTGCATACTGATGAAGCCGGG - Intergenic
902334370 1:15746708-15746730 CCCTGCAGATACTCGGAGCAGGG + Intronic
902873602 1:19328347-19328369 GCTTGGAGACAGATGGAGCTTGG + Intronic
904029913 1:27527657-27527679 CGCTGGAGGCAGATGGCGCAGGG + Intergenic
904913501 1:33953084-33953106 CCCTGCAGTTAGGTGGACCATGG + Intronic
905024159 1:34838361-34838383 CACTGGACACAGATGGAGTAAGG + Intronic
905037087 1:34925388-34925410 CCCTGCAGACAGATGTGGTGGGG + Intronic
905289228 1:36910235-36910257 CCCTGAGGACAAATGGAGCCTGG - Intronic
905473076 1:38207567-38207589 CTCAGCAGACAGATGGACCTGGG + Intergenic
905518637 1:38580543-38580565 CCCAGCAGACAGGAGGAGGATGG - Intergenic
905631015 1:39518618-39518640 CCCTGCAGCCAGCTGGAGCCAGG + Intronic
905666745 1:39767558-39767580 CCCTGCAGCCAGCTGGAGCCAGG - Intronic
905947571 1:41916883-41916905 CCCTGGAGACAGTTGGACCCAGG - Intronic
906696009 1:47823935-47823957 CCTTCCAAACAGAGGGAGCAAGG - Intronic
907299318 1:53476697-53476719 CCCTGCACACAGAGGGACCCGGG + Intergenic
907333149 1:53684391-53684413 CCCAGGAGTCAGAGGGAGCAGGG - Intronic
909082250 1:71126688-71126710 CCCTGAGGACAGACTGAGCAAGG - Intergenic
909481927 1:76135209-76135231 CCCTCCATACAAATGTAGCATGG + Intronic
909532366 1:76695053-76695075 CCTTGCAGTCAGAAGAAGCAGGG - Intergenic
909619944 1:77656391-77656413 TTCTTAAGACAGATGGAGCATGG - Intronic
912649014 1:111421782-111421804 CCCCACAGGCAGAAGGAGCAGGG - Intronic
914863427 1:151405576-151405598 CCCTGCAGACAGTGGGCACAGGG - Exonic
914999387 1:152574186-152574208 CCCTGCAGAGAGAAGGGGGATGG + Intronic
915334568 1:155133594-155133616 CCCAGCATAGAGATGGAGGAAGG - Intronic
915580265 1:156809140-156809162 CCCTGCAGGTAGATGGGGGAAGG - Intronic
916626651 1:166565335-166565357 CTATGGAGAAAGATGGAGCAGGG - Intergenic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
923600416 1:235397996-235398018 CAAAGCAGACAGAAGGAGCAAGG - Intronic
923956972 1:239033111-239033133 CCCTCCTGGGAGATGGAGCAAGG - Intergenic
924072378 1:240294717-240294739 CTCAGCAGCCAGAGGGAGCAGGG - Intronic
924622287 1:245672548-245672570 ACATGCAGCCTGATGGAGCAAGG + Intronic
924780287 1:247141296-247141318 CACTGCAGACAGCGGTAGCAAGG + Intronic
1063362432 10:5469359-5469381 CCCTGCGGAGAGCAGGAGCAGGG - Intergenic
1065089626 10:22218914-22218936 CACTGGGGATAGATGGAGCATGG + Intergenic
1065142094 10:22727887-22727909 CACTGCACCCAGATGGAGGAAGG + Intergenic
1066056085 10:31681418-31681440 CCCTGCACAGAGAAGGAGAAGGG - Intergenic
1066113872 10:32222560-32222582 GCATGCAGACAGAGGGAGAACGG - Intergenic
1067432927 10:46255825-46255847 GCCAGCAGGCAGATGCAGCAGGG - Intergenic
1067440332 10:46305612-46305634 GCCAGCAGGCAGATGCAGCAGGG + Intronic
1067577830 10:47419222-47419244 AGCTGCAGACAGACAGAGCAGGG + Intergenic
1067682445 10:48449578-48449600 ACCTGCAGCCAGAGGGACCAAGG + Intronic
1068858885 10:61826509-61826531 CTCTGGAGACAGATGGAGACTGG + Intergenic
1069807105 10:71132873-71132895 CCCAGCAGACAGGTGGAGCTGGG - Intergenic
1070537973 10:77393562-77393584 CCCCTGAGACAGATGGAGCTGGG + Intronic
1070825149 10:79386457-79386479 CTCTGCAGAGAGAAGGAGGAAGG + Exonic
1070831060 10:79418399-79418421 CCTGGCAGGCAGAGGGAGCATGG - Intronic
1071601302 10:86959862-86959884 CCCTGGAGTCAGAGGGAGCAGGG + Intronic
1072460200 10:95611626-95611648 CCCTCAAGACAGTTGGAACAGGG + Intronic
1072625493 10:97108473-97108495 CACTGCAGACACACGGAGCCTGG - Intronic
1073046373 10:100641343-100641365 CCCTAAAGACTGAGGGAGCATGG - Intergenic
1074086603 10:110212596-110212618 CTTTGCAGTCACATGGAGCAGGG + Intronic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1075144090 10:119868709-119868731 TCCTGCAGTAACATGGAGCAGGG + Intronic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1077219203 11:1407971-1407993 CCCTGCAGCTAGAGGGGGCAGGG + Intronic
1077248274 11:1549479-1549501 CCCTGCAGGCAGCTGGGGCTCGG - Intergenic
1077259136 11:1606391-1606413 CCCAGCTGACAGAGGCAGCAGGG + Intergenic
1077305997 11:1868923-1868945 CCCTGAGGCCAGAGGGAGCATGG + Intronic
1077308043 11:1876612-1876634 CCCTGCAGACACTTGCAGAATGG - Intronic
1077443359 11:2578868-2578890 CCAGGCAGACAGCTGGACCAAGG - Intronic
1078740104 11:14058567-14058589 ACCTGCAAGCAGGTGGAGCAAGG + Intronic
1081195040 11:40151011-40151033 TCTTGCAGGCATATGGAGCATGG - Intronic
1081567903 11:44270969-44270991 CCCTGCAGCCCCCTGGAGCAGGG + Intronic
1081674134 11:44958538-44958560 CCCAGGGGACAGAAGGAGCACGG - Intergenic
1083727745 11:64637227-64637249 CCCAGCAGACAGAGGGGGCTTGG + Intronic
1084009779 11:66341045-66341067 CCCTGCAGAGAAAGGGAGGAGGG + Exonic
1084355336 11:68634650-68634672 CCCCGCAGAAAGGTGGAGAATGG - Intergenic
1084403713 11:68959414-68959436 CCCTGCACACAGCGGGAGCAGGG + Intergenic
1084613518 11:70219218-70219240 CCCTCCAGAAAGGTGGAGAAGGG + Intergenic
1085296987 11:75436905-75436927 CCCTGCAGACAGGTGGAGGCAGG - Intronic
1085454584 11:76658545-76658567 CCCTGGAGACAGAAGGATGAAGG + Exonic
1087626584 11:100603413-100603435 ACCTGCAGACAGATGCTGCTTGG - Intergenic
1089280995 11:117374423-117374445 TCCTCCAAACAGATGGAGGATGG - Intronic
1090077122 11:123586562-123586584 CACTGCACACTGAAGGAGCAGGG - Intronic
1090283381 11:125477774-125477796 CCCTGGAGGCAGAAGGAGCCAGG - Intronic
1091280767 11:134380354-134380376 CCCCGCAGTCAAGTGGAGCATGG - Intronic
1091684075 12:2549310-2549332 CCCTGCAGACATAAGGAGTGAGG - Intronic
1091816344 12:3441582-3441604 CTCTGCAGGCATGTGGAGCACGG - Intronic
1093288954 12:17299436-17299458 CCCTTCTGCCAGATTGAGCAGGG - Intergenic
1095938341 12:47709237-47709259 GCCTGCAGATAGATGAAACAGGG - Intergenic
1096317968 12:50585371-50585393 CCTTGTAGACAGATGAAGCGTGG + Intronic
1097205364 12:57316529-57316551 CCCTGCCAACACATGGAGGATGG + Intronic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1102193468 12:111007020-111007042 CTCTGGAGACAGATGGAGAGAGG + Intergenic
1102450225 12:113036603-113036625 CCCTGCAGTGAGAAGCAGCAGGG - Intergenic
1103620190 12:122182853-122182875 CCCATCTGACAGATGGAGAAAGG - Intronic
1103688813 12:122753496-122753518 CCCTGTAGACCTGTGGAGCAAGG + Intronic
1104038737 12:125115811-125115833 GACTGCACACAGATGGAGGACGG + Intronic
1104322069 12:127761285-127761307 CCCTGAAGTCAGATGGCGCTGGG - Intergenic
1104713424 12:131001698-131001720 ACCGGAAGACAGATGGAGCCAGG - Intronic
1105306164 13:19170455-19170477 TCCTGCAGAGAGATGCAGCGAGG + Intergenic
1105594646 13:21825753-21825775 CACTGCAGATAGATGGCCCAGGG - Intergenic
1106107245 13:26743242-26743264 CCCGGCAGAGAGATGGAGAAGGG + Intergenic
1106117424 13:26829642-26829664 TCCTGCAGGCAGATGGTGGAGGG + Intergenic
1106201795 13:27544351-27544373 CCCTGCAGACGCAGAGAGCAGGG + Intergenic
1106916392 13:34520059-34520081 CCCTGGAGACAGAGGGATGAAGG + Intergenic
1110158102 13:72342606-72342628 CCCTGCTGACAGAGCAAGCAGGG + Intergenic
1110808414 13:79785650-79785672 CCTTGCAGACAGATGGACTCAGG + Intergenic
1112437333 13:99399712-99399734 CTCTGCAGGCAGTGGGAGCAAGG - Intergenic
1113630557 13:111880265-111880287 TCCCGCAGTCAGCTGGAGCAGGG + Intergenic
1113630600 13:111880443-111880465 TCCTGTAGGCAGATGGAGCGGGG + Intergenic
1113630615 13:111880501-111880523 TCCCGCAGGCAGATGGAGGAGGG + Intergenic
1115017410 14:28633840-28633862 CCCTGCTGACAGCTGGACCAGGG - Intergenic
1119885739 14:78139870-78139892 CCCAGCAGAAAGAAGGAGGAAGG + Intergenic
1122820678 14:104343291-104343313 CCCTGCAGACAGGAGCAGGAGGG - Intergenic
1122857220 14:104565714-104565736 CCCTGGAGACAGAACCAGCAGGG + Intronic
1123478626 15:20611416-20611438 CTCTGGAGACTGATGGAGGATGG - Intergenic
1123639387 15:22388969-22388991 CTCTGGAGACTGATGGAGGATGG + Intergenic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1124254559 15:28130301-28130323 CCCTGCACACAAAGGAAGCATGG + Exonic
1125686278 15:41565161-41565183 CCATGCAGCCAGAACGAGCATGG - Intronic
1126059721 15:44768625-44768647 TCCTGCAGATAGATAAAGCAGGG - Intergenic
1126506224 15:49406946-49406968 CCCTGCAAGCAGATGTGGCAAGG + Intronic
1126535085 15:49752556-49752578 CCCTGTAGACATATGCAGGAGGG + Intergenic
1126736726 15:51737895-51737917 CCCTGCAGAGCGAGGGAGCCGGG + Exonic
1127136494 15:55929071-55929093 CCTAGCAGACAGATGAAGCAGGG + Intronic
1127965564 15:63920362-63920384 CCATGCAGAAAGGGGGAGCAAGG - Intronic
1128159108 15:65411369-65411391 CCCTGCATAGAGGAGGAGCACGG + Exonic
1128177692 15:65570763-65570785 CCTTTCAGTCAGCTGGAGCAAGG + Intronic
1128770347 15:70277226-70277248 CCCTGCAGGCACCTGGAGCAGGG + Intergenic
1129194619 15:73956518-73956540 CCCTGAAGAGAGCTGGAGCCTGG + Intergenic
1129968447 15:79757181-79757203 CCCAGGAGGCAGAAGGAGCAGGG + Intergenic
1130660478 15:85827888-85827910 CCACGCAGACAGCTGGAGTAGGG + Intergenic
1131966843 15:97853270-97853292 CCCTGCAGAGAGCTGTGGCATGG - Intergenic
1132379289 15:101355495-101355517 CCCTGCAGGCAGTTTGACCAGGG - Intronic
1132653067 16:1030345-1030367 CCCTGCGCACAGACGCAGCACGG + Intergenic
1132665255 16:1078553-1078575 CCCTGCACCCAGATGGCGCCTGG - Intergenic
1133031692 16:3014140-3014162 CCCTGCAGCCAGGTGTAGCTTGG - Exonic
1133468988 16:6055736-6055758 CCCAGCACAAAGCTGGAGCAAGG + Intronic
1133828748 16:9302452-9302474 CCTGGCAGTCAGATGGGGCAGGG - Intergenic
1134277932 16:12793027-12793049 CCCTGTAGGCAGATGCAGCTTGG + Intronic
1136027903 16:27481760-27481782 CACAGCAGCCAGATGCAGCAGGG - Intronic
1136283214 16:29226344-29226366 TCCTGCAGGGAGATGGAGCAGGG + Intergenic
1137521660 16:49200379-49200401 TCCTTCAGACAGAGGGAGAAAGG - Intergenic
1137722941 16:50638460-50638482 CCCTGCACACATCTGGAGAAGGG - Exonic
1137814969 16:51389881-51389903 CCCTGCAGACAGCTTGATCTTGG - Intergenic
1138242307 16:55436760-55436782 CCCTGGAGACAGAGAGAGCAGGG + Intronic
1139214904 16:65118133-65118155 CCATGCAGACAGTTGGAGAAGGG + Intronic
1139236578 16:65345825-65345847 CCTTGAAGACAGAAGAAGCATGG - Intergenic
1139308826 16:66011196-66011218 CCCAGGAAACAGAGGGAGCATGG - Intergenic
1139347248 16:66311869-66311891 CCCTGCAGAGACAGGGAGCATGG - Intergenic
1140199920 16:72886813-72886835 CCCTACAGCCAGATGGCCCAGGG + Intronic
1142087595 16:88192241-88192263 TCCTGCAGGGAGATGGAGCAGGG + Intergenic
1143485544 17:7251797-7251819 GCCTGCAGAGCGAAGGAGCAGGG + Intronic
1143541400 17:7571691-7571713 CCCTGCAAACAGAGGAAGAAAGG - Exonic
1146006334 17:29162990-29163012 TCCTGCACACAGATGGGGCCAGG - Intronic
1147270244 17:39264386-39264408 CTCTGCAGCCAAATAGAGCAAGG + Exonic
1147675991 17:42206018-42206040 CCCTGAAGACAAATAAAGCAAGG - Intronic
1147953067 17:44117703-44117725 CCCTGGGGAGAGATGGAGCAGGG + Exonic
1148480579 17:47957297-47957319 CCCTGCAGAGGGATGGGGGAGGG - Intronic
1148867409 17:50635634-50635656 CCCTTCTCACAGATGGAGAAAGG + Intronic
1150043811 17:61891217-61891239 CCCGGCAGACAGAGGTTGCAGGG + Intronic
1150121653 17:62608465-62608487 CCCTGAATACAGATGAAGCTGGG - Intronic
1152920513 17:83064284-83064306 CCCTGGGGACAGATGGTGCAGGG - Intergenic
1153917726 18:9760636-9760658 CCCGACAGACAGAGGGAGAAGGG - Intronic
1155399202 18:25419713-25419735 TCCTGCACACAGAAGCAGCAGGG - Intergenic
1156399086 18:36724693-36724715 CACTGCAGGGAGAGGGAGCAGGG - Intronic
1156748506 18:40421510-40421532 CCCTGAAGGCTCATGGAGCAAGG - Intergenic
1157202628 18:45672006-45672028 CCCCAGAGATAGATGGAGCACGG + Intronic
1157275020 18:46304232-46304254 CCCTCCCCACAGCTGGAGCAAGG - Intergenic
1158696692 18:59709948-59709970 CACTCCATACAGATGAAGCAGGG + Intergenic
1160353243 18:78203355-78203377 CCCTGTGGACAGAGTGAGCAGGG - Intergenic
1161849790 19:6732372-6732394 CCCTTCAGCCTGAAGGAGCAGGG + Exonic
1162044300 19:7988460-7988482 CGCTAAAGACAGATGGGGCATGG + Intronic
1162311782 19:9912491-9912513 CCCCCCAAACAGATGGAACAGGG + Intronic
1162617465 19:11813924-11813946 CCGTGCAGAAGGAAGGAGCAGGG + Intergenic
1162626253 19:11887521-11887543 CCATGCAGAACGAAGGAGCAGGG + Intergenic
1162857827 19:13482620-13482642 CCCTGCAGTCAGATGGACCATGG + Intronic
1164424057 19:28124528-28124550 CTGTCCAGACAGATGCAGCAAGG - Intergenic
1165017107 19:32889357-32889379 CCCTGGTGACAGGTGGAGCCAGG + Intronic
1165045099 19:33098311-33098333 GCCTGCAGCAAGATGGAGCTGGG + Intronic
1165164255 19:33840395-33840417 CCCTACAGAAAGATGGGGAATGG - Intergenic
1165334063 19:35156823-35156845 ACCTGCAGCCAGAGGGAGCCTGG - Intronic
1165372411 19:35417491-35417513 TCCTGCAGAGAGATGGAGCGTGG + Intergenic
1167758072 19:51425912-51425934 CTCTGCAGATGGCTGGAGCAAGG - Intergenic
925001031 2:402990-403012 TCCTGCAGACAGAGAGAGCTAGG - Intergenic
925010346 2:480420-480442 CCCTGCTCCCAGGTGGAGCAAGG + Intergenic
925841487 2:7996025-7996047 CCCTGCTGACAGCAGGAGCTGGG - Intergenic
929956786 2:46464295-46464317 CCCAGCAGGCAGGTGCAGCATGG - Intronic
931016130 2:57982641-57982663 CCCTGCAAGCAGGTGCAGCAAGG + Intronic
931196198 2:60054225-60054247 CACTGCAGAGAGAAGGAGAAAGG - Intergenic
934765888 2:96879802-96879824 CCCGGCAGGCAGAGGGAGCTGGG - Intronic
935639862 2:105280471-105280493 CTCTGCATACAGTTTGAGCAAGG + Exonic
937096690 2:119240360-119240382 CCCTGCAGCCAGATGGAGTGGGG - Intronic
938377377 2:130817163-130817185 CCCTGCAGACAGATGCTACGTGG - Intergenic
939023028 2:136980873-136980895 CCCAGGAGCCACATGGAGCAAGG - Intronic
940019974 2:149146395-149146417 CTCTGCGGAAGGATGGAGCATGG + Intronic
941110402 2:161414745-161414767 CCCGGGAGACTGAAGGAGCAAGG - Intergenic
941965308 2:171294900-171294922 CCCTACAGCCAGTGGGAGCAAGG + Intergenic
941975809 2:171403956-171403978 CCCTGCAGACAGGATGAGGAGGG - Intronic
946478459 2:220031304-220031326 CCCTGAAACCAGATGGATCATGG + Intergenic
946989593 2:225313246-225313268 CCTTGAAGACAGGTGGAGAATGG + Intergenic
947377365 2:229510319-229510341 CCCTGCAGCCACGTGGAGAATGG + Intronic
947420882 2:229940768-229940790 CCCTTCAGAAGGAAGGAGCATGG + Intronic
947623616 2:231605758-231605780 CCCTGGAGACAGATCGTGAAGGG - Intergenic
947846570 2:233249193-233249215 CCCTGCAACGAGAGGGAGCACGG + Intronic
948720661 2:239898087-239898109 CCCAGCTCACAGATGGAGCAAGG + Intronic
1168919414 20:1518560-1518582 CTCAGCAGACAGATGGACCTGGG + Intergenic
1169500815 20:6158700-6158722 CCCTCCAGAAAGATGGACCAAGG + Intergenic
1169620922 20:7505880-7505902 CCCTGGAGACAGATGATCCAGGG + Intergenic
1169986222 20:11447873-11447895 CCCTGCTGGCAGATGGTGCCAGG - Intergenic
1170347859 20:15406942-15406964 CCTTGGAGAAAGATTGAGCAAGG + Intronic
1170838929 20:19908105-19908127 CCCTGCAGACAGATGGAGCATGG - Intronic
1170892669 20:20389239-20389261 CCCTGGAGAGAGACGGAGCAAGG + Intergenic
1171250318 20:23641219-23641241 CCCTGCAGGCACATGCTGCAGGG + Intergenic
1172435461 20:34926030-34926052 CCATGGGTACAGATGGAGCATGG + Intronic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174540597 20:51286255-51286277 CCCTGCAGACTGTTGGTGGAAGG - Intergenic
1175258868 20:57662772-57662794 CCCTGGAGACAGCTGGGGAAGGG - Intronic
1175405004 20:58720172-58720194 CCCTGCAGGAAGCTGGAGGAGGG + Intergenic
1175466335 20:59192995-59193017 CTCTGCAGAAAGAGGCAGCAGGG + Exonic
1175645865 20:60671105-60671127 CCGTGCAGGCAGATGGTGCCTGG + Intergenic
1176677129 21:9789621-9789643 GCCTGCAGAGAGGTGCAGCACGG + Intergenic
1178411384 21:32366352-32366374 CCCTGCTGTGTGATGGAGCAGGG + Intronic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1179561036 21:42216433-42216455 CCCTGCAGAAAGACTGGGCATGG - Intronic
1180706789 22:17815214-17815236 CCCAGCAGATACAAGGAGCAAGG - Intronic
1180965158 22:19784396-19784418 CCCTGCAGGCAGATTGGGCTTGG - Exonic
1181114362 22:20621800-20621822 CCCTGCAGAGAGAGGCAGCAAGG + Intergenic
1181805226 22:25370544-25370566 CCCTGGAGTTAGAGGGAGCAGGG - Intronic
1182288375 22:29260854-29260876 CCGGGCAGACAGATGCAGCTGGG - Exonic
1182318341 22:29462690-29462712 CACTGCAGACAGTGGGAGCATGG - Intergenic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1183831675 22:40421400-40421422 CCCAGCTGACTGATGGAGCTCGG + Intronic
1184693697 22:46128586-46128608 CCCTGCACATAGGTGGAGCCAGG - Intergenic
1184867216 22:47208385-47208407 CCCTGCAGAGAGAAGGACCGTGG + Intergenic
1185242505 22:49754250-49754272 CCTTGAAGACACATGGGGCAGGG + Intergenic
1185310311 22:50150618-50150640 CCCTGCAGCAAGAGTGAGCATGG + Intronic
1185320703 22:50199031-50199053 CCCTGCAGGCAGACGGTGCCAGG - Exonic
950184202 3:10935008-10935030 CCCTGCAGAGAGATGGGGGCAGG - Exonic
951056917 3:18157982-18158004 CACTGCAGGCAACTGGAGCATGG + Intronic
953046581 3:39298403-39298425 CACTGCAGGCATATGGAGCTGGG - Intergenic
955867657 3:63402107-63402129 CCCTGCAGCCAGAAGGAGGAAGG + Intronic
955905612 3:63804464-63804486 CCCTGTAGCAAGAAGGAGCATGG - Intergenic
956166464 3:66401614-66401636 CCCAGCAGACATATGGGGCTGGG + Intronic
956454970 3:69411518-69411540 CCCTGCTGAAGGATGGAGCCTGG - Intronic
959681552 3:109102147-109102169 GCCTGCAGACAGAATGATCAGGG + Intronic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
961031110 3:123604692-123604714 CCCTGCAGACACTTGCAGAATGG + Intergenic
961038908 3:123663382-123663404 CCCTGCAGACTAATGGGGCGTGG + Intronic
961360934 3:126366626-126366648 CTCTGCAGCCAGTTAGAGCAGGG - Intergenic
961458656 3:127036719-127036741 CCCTGCAGACACAGGGCCCATGG - Exonic
963359179 3:144248756-144248778 CCCATCAGACAGAAGGAGCCAGG + Intergenic
964353115 3:155822506-155822528 CCCAGCAGGCAGAGGGTGCAGGG + Exonic
967476592 3:189928372-189928394 CCCTGCAGCAAGATACAGCATGG - Intergenic
967540546 3:190662308-190662330 CTCTTCAGATAGATGGATCAAGG - Intergenic
967865543 3:194187073-194187095 CCCTGCACACAGGCGGAGCTGGG + Intergenic
1202737711 3_GL000221v1_random:22647-22669 GCCTGCAGACACATTGAGGAGGG + Intergenic
968447401 4:658610-658632 CCGTGCAGACAGAGGGACCTCGG - Intronic
968907511 4:3461563-3461585 CCCTGGAGCCGCATGGAGCAGGG + Intergenic
969091694 4:4698742-4698764 CCCTCCACACAGGTGGAGCTGGG + Intergenic
969484844 4:7466555-7466577 CACTGCAGCCAGAGGGAGAATGG - Intronic
969631477 4:8341160-8341182 GCCTGAAGACAGATGGGGCCTGG - Intergenic
972161706 4:36235547-36235569 CCGTGGAGACAGATAAAGCAAGG - Intronic
972772051 4:42206555-42206577 GTCTGCAGACAGCAGGAGCATGG + Intergenic
972987055 4:44777660-44777682 CCCTGCTGACAGAGGGACCGTGG - Intergenic
982096317 4:151926673-151926695 CAATGCAGACAGAAAGAGCAGGG - Intergenic
984886535 4:184454939-184454961 CACTGCAGTTAGGTGGAGCACGG - Intronic
985549443 5:525529-525551 CCGTCCAAACAGAGGGAGCAGGG - Intergenic
985672892 5:1215145-1215167 CACTGCAGGCAGCTGGGGCAGGG + Intronic
985876929 5:2606994-2607016 CACACCAGGCAGATGGAGCAGGG - Intergenic
986353882 5:6905464-6905486 CACTGGAGACAGGTGGAGAATGG - Intergenic
986548229 5:8923573-8923595 CCCTGCTGAGGGATGGAGGAGGG - Intergenic
986728824 5:10619856-10619878 TCCGGCAGACAGATGGTGCTGGG - Intronic
987147481 5:15006281-15006303 CCCTGCAGTGAGAAGGAGCTTGG - Intergenic
987445847 5:18019072-18019094 CACTGCAGACAGATTGTGGAAGG + Intergenic
987466834 5:18282061-18282083 CTCTCCAGACAGAAGGAGGAGGG - Intergenic
992354245 5:75964446-75964468 CCCTGCACACAGAGGTGGCAAGG - Intergenic
993539990 5:89137358-89137380 CCTGGCAGTAAGATGGAGCACGG + Intergenic
995778098 5:115746728-115746750 CGCTGCTGCCAGAGGGAGCATGG + Intergenic
996920739 5:128765040-128765062 ACCTGCAGACAGAAGGAGTTCGG + Intronic
997199235 5:131999736-131999758 CCCTGCATGCAGATGGAGGTGGG - Intronic
997600279 5:135134216-135134238 CCCGCCAGACAGTTGGGGCAGGG + Intronic
999019972 5:148154376-148154398 CACTGCAAACAGATACAGCAAGG - Intergenic
999287332 5:150402019-150402041 CCCTGTTGACAGATGGAGATTGG + Intronic
1000101824 5:158023904-158023926 CCATGCAGGCAGATGCAGGATGG - Intergenic
1001139438 5:169131984-169132006 CCAGGCAGACAGAAGGAGCCTGG + Intronic
1001585669 5:172832559-172832581 CCTGGCAGCCAGATGGAGAAAGG + Intergenic
1001629119 5:173161406-173161428 CCTTGGAGAGAGAGGGAGCAAGG + Intronic
1002383749 5:178850277-178850299 CCTTACATACAGATTGAGCAGGG - Intergenic
1002503852 5:179665473-179665495 CCCTGCAGACAGAGGGGAAATGG - Intergenic
1004159555 6:13201367-13201389 CCCTGAAGAGAGAAGGAGCGTGG + Intronic
1004607503 6:17207534-17207556 AGCTGATGACAGATGGAGCAAGG + Intergenic
1006017562 6:31094440-31094462 CCCAGCAGAGAGCAGGAGCAGGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006688364 6:35857269-35857291 CCCTGCTGACATTTGGAGCACGG - Exonic
1006723130 6:36173320-36173342 CCCTGAAGACAGATTTACCAAGG + Intergenic
1009950662 6:70391916-70391938 CCCTGAAGAAATCTGGAGCATGG - Intergenic
1013978749 6:116105196-116105218 GCCTGCACACAGCTGGAGTAGGG - Intronic
1013996355 6:116312899-116312921 CCATGCAGAAAAATAGAGCAAGG + Intronic
1014400828 6:120987596-120987618 ATCAGGAGACAGATGGAGCAGGG - Intergenic
1017600644 6:156077101-156077123 GCTCGCAGACAGAAGGAGCAGGG + Intergenic
1017622926 6:156317588-156317610 CCCTCTAGATAGATAGAGCATGG + Intergenic
1018454735 6:163941642-163941664 TCCTGGAGACAGAAGGAGGAGGG + Intergenic
1019499075 7:1355434-1355456 CCCTGCAGCCAGATGGCCCCTGG + Intergenic
1019856462 7:3613274-3613296 CTCTGCAGATAGATGGGTCATGG + Intronic
1020240614 7:6391774-6391796 CCCTGCAGGCACAAGGAGGAAGG - Intronic
1020683899 7:11270040-11270062 CCCTCCAGATACATGGAGCCTGG - Intergenic
1023900273 7:44471508-44471530 CTCTGCTGACAGAATGAGCAGGG + Intronic
1024483402 7:49888956-49888978 CTCAGCAGACATATGGAGGATGG + Intronic
1025965282 7:66263980-66264002 CCCAGCTGACACATGGAACAGGG - Intronic
1027619090 7:80460670-80460692 CCCAGGAGGCAGATGTAGCAGGG + Intronic
1029152614 7:98491655-98491677 ACACCCAGACAGATGGAGCAGGG - Intergenic
1030007414 7:105132799-105132821 CCCTGCGGACATCTGGAGCACGG - Exonic
1030375097 7:108745291-108745313 GCCTGGAGACAGATAGGGCAAGG + Intergenic
1032486862 7:132294341-132294363 CCCTGCAGACTAGGGGAGCAGGG + Intronic
1032552466 7:132797196-132797218 CCCTGCACACAGCTGAAGCCTGG + Intronic
1032690333 7:134279728-134279750 CTCTGGAGACAAATGAAGCAGGG - Intergenic
1033522539 7:142175631-142175653 TCCTGCAGAAAGAAGCAGCAAGG - Intronic
1036103761 8:5817369-5817391 CCCTGAGCAAAGATGGAGCATGG - Intergenic
1036807364 8:11844819-11844841 CCCTGGAGATGGATGGATCACGG + Exonic
1037898299 8:22673009-22673031 GCCAGCAGACAGATGGAACCAGG + Intergenic
1038012181 8:23483900-23483922 CCCTCCAGCCAGATGCAGCCTGG + Intergenic
1039797197 8:40925531-40925553 CCCTGCAGCCAGCTTCAGCAGGG + Intergenic
1041890699 8:62864909-62864931 CCCTGCGGACATCTGGAGCGCGG + Intronic
1042092926 8:65178683-65178705 CCTTGCATTCAGAGGGAGCATGG - Intergenic
1042822986 8:72952275-72952297 TCCTGCAGACTGAATGAGCATGG - Intergenic
1043512882 8:80966996-80967018 CCCTGGAGAAATATGGAACAGGG + Intergenic
1045065945 8:98444404-98444426 ACATGCTGGCAGATGGAGCAGGG + Intronic
1045761447 8:105612735-105612757 CCCTGTAGAAAGAGAGAGCAAGG - Intronic
1048045545 8:130769089-130769111 CCCTGAAGATAGATGGGGAAGGG + Intergenic
1048588051 8:135793702-135793724 CCCTGCAAAAAAATGGAGCTGGG - Intergenic
1048822669 8:138394219-138394241 CCCTGCAGGCAGATTTTGCATGG - Intronic
1049230025 8:141477129-141477151 GCCTGAAGGCAGATGGAGCTGGG - Intergenic
1049372551 8:142274697-142274719 CCCTCCAGACAGACGGAGGGAGG + Intronic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1049665669 8:143841429-143841451 CCCTGCGGACACCTGGAGCCCGG + Intergenic
1049724565 8:144139612-144139634 GCCTGCAGACAGCTGCAGGAAGG - Exonic
1057872634 9:98729756-98729778 CCCTGGAGACAGCAGGTGCATGG - Intergenic
1058907238 9:109491806-109491828 CCCTGCAGCAGGAAGGAGCACGG + Intronic
1059169326 9:112110679-112110701 CCTTGTAGACAGGTGGGGCACGG - Intronic
1061251359 9:129428341-129428363 CCTTGCAGACTGATGGAGAAAGG + Intergenic
1062076503 9:134592805-134592827 CCCTGCAGCCTGCTGGAGCCGGG + Intergenic
1062141182 9:134959956-134959978 CCCTGCAGGCAGGAGGAGGACGG + Intergenic
1062549277 9:137078438-137078460 CCCTGCAGGCAGACGGGGCTCGG - Intronic
1203706438 Un_KI270742v1:53091-53113 GCCTGCAGACACATTGAGGAGGG + Intergenic
1185782140 X:2857945-2857967 CCCTGAACACAGATGGAGCTAGG + Intronic
1187255515 X:17638252-17638274 CCCTGCATTCAGAGGGAGCAAGG + Intronic
1188363314 X:29283580-29283602 CTTCGCAGACAGATAGAGCATGG + Intronic
1190330652 X:49233244-49233266 CCCTGCAGACCCTTGGAGCAAGG - Intronic
1192582417 X:72295719-72295741 CCCTGTAGACAGAACCAGCAAGG - Intronic
1193678218 X:84483310-84483332 CCCTGCAGACATTTGCTGCATGG - Intronic
1195247077 X:103004558-103004580 CCCAGCAGACAGATGGAGCATGG + Intergenic
1196462938 X:115948281-115948303 CCCTCCAGATACATGGAGAAGGG - Intergenic
1199308309 X:146293057-146293079 CCTGGGAGACACATGGAGCAAGG - Intergenic
1201544049 Y:15141091-15141113 CCCTTCAGAGAGAGAGAGCATGG + Intergenic