ID: 1170841131

View in Genome Browser
Species Human (GRCh38)
Location 20:19925042-19925064
Sequence GAGGAGGAGCACAAAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1043
Summary {0: 1, 1: 0, 2: 8, 3: 89, 4: 945}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170841131_1170841140 10 Left 1170841131 20:19925042-19925064 CCCACCTCTTTGTGCTCCTCCTC 0: 1
1: 0
2: 8
3: 89
4: 945
Right 1170841140 20:19925075-19925097 TCAGCCTTTGGGTAAATTTGTGG 0: 1
1: 0
2: 0
3: 11
4: 150
1170841131_1170841137 -1 Left 1170841131 20:19925042-19925064 CCCACCTCTTTGTGCTCCTCCTC 0: 1
1: 0
2: 8
3: 89
4: 945
Right 1170841137 20:19925064-19925086 CTCACCACTCCTCAGCCTTTGGG 0: 1
1: 0
2: 3
3: 59
4: 409
1170841131_1170841136 -2 Left 1170841131 20:19925042-19925064 CCCACCTCTTTGTGCTCCTCCTC 0: 1
1: 0
2: 8
3: 89
4: 945
Right 1170841136 20:19925063-19925085 TCTCACCACTCCTCAGCCTTTGG 0: 1
1: 0
2: 0
3: 40
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170841131 Original CRISPR GAGGAGGAGCACAAAGAGGT GGG (reversed) Intronic
900127639 1:1075551-1075573 GAGGAGGAGCACAGGGACTTGGG + Intergenic
900311952 1:2037767-2037789 GAGGAGGAGAACACAGAGGCAGG + Intergenic
900367525 1:2317360-2317382 CAGGAGGGGCACAGGGAGGTAGG + Intergenic
900367533 1:2317379-2317401 TAGGAGGGGCACAGGGAGGTGGG + Intergenic
900700790 1:4047525-4047547 GAAGAGGAGAACACAGAGATGGG + Intergenic
900943074 1:5813717-5813739 GAGGAGGAGGACGAGGAGGAGGG + Intergenic
901064197 1:6486926-6486948 GAGGAGGAGCAATTAGGGGTGGG - Intronic
901210173 1:7520197-7520219 GAGGAGGAGGAGGAGGAGGTCGG - Intronic
901305873 1:8232339-8232361 GAAGAGGAGGAAAAAGAGGGAGG + Intergenic
901650814 1:10742208-10742230 ACGGAGGAGGACAAAGAGCTGGG + Intronic
901736366 1:11314758-11314780 CAGGACGAGCACACAGAGGGAGG + Intergenic
901755986 1:11441879-11441901 GAGGAGGAGGAAAATGAGGGAGG + Intergenic
901873329 1:12151479-12151501 GAGGAGGAGAAAGATGAGGTTGG - Intergenic
902140119 1:14346484-14346506 GAGTAGGAGCACAAAGAAGGAGG + Intergenic
902170407 1:14605679-14605701 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG + Exonic
902828650 1:18995454-18995476 GAGGAGGAGGAGGAGGAGGTAGG - Intergenic
902903098 1:19533807-19533829 AAGGAGGAGCACCAAGTGCTGGG + Intergenic
903086144 1:20861213-20861235 GTGGAGGAGAAATAAGAGGTAGG + Intronic
903128605 1:21263872-21263894 GAGGAGGAAAAAGAAGAGGTGGG - Intronic
903849345 1:26296813-26296835 GAGGAGAGGCCCAGAGAGGTGGG + Intronic
903925316 1:26827252-26827274 GAGGAGGATCCCAAAGGGGCGGG - Intronic
904286026 1:29453798-29453820 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
904375847 1:30081986-30082008 GAGGAGGAGGAACAAGAGGAGGG - Intergenic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
904920148 1:34001013-34001035 GGGGAGGAGGAAAAAGAGGAGGG + Intronic
904920155 1:34001037-34001059 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905352795 1:37359153-37359175 GAGGAGAAACAGAGAGAGGTTGG + Intergenic
905401795 1:37708965-37708987 GAGGAGGAGGAGGAAGAGGAGGG - Exonic
905687307 1:39917798-39917820 GAGGAGGAGAAAAAAGATTTAGG + Intergenic
905909240 1:41642448-41642470 GAGGAGGAGGCCTATGAGGTGGG - Intronic
905948447 1:41924218-41924240 CACCAGGAGCAGAAAGAGGTAGG + Intronic
905961666 1:42047793-42047815 AAAGAGAAGCACAGAGAGGTTGG + Intergenic
906072842 1:43029640-43029662 GAGGAGGAGGACAGGGAGGAGGG - Intergenic
906083600 1:43110330-43110352 GAGGAAGAGAGCAAAGAGGGAGG + Intergenic
906192113 1:43905280-43905302 GAAGAGGAGCAGAAGGAGGCAGG - Intronic
906665639 1:47619872-47619894 GTAGACGAGCACAAGGAGGTTGG + Intergenic
906684096 1:47751864-47751886 GAGCAGGGGCCCAAAGAGGCAGG + Intergenic
906745005 1:48215402-48215424 GAGAAGGAGCACTAAGGGGTGGG + Intergenic
906862478 1:49376402-49376424 GAGCAGGAAAAGAAAGAGGTAGG + Intronic
906938263 1:50233687-50233709 AAGGAGGAGGACAAAAAGCTGGG + Intergenic
907578845 1:55553780-55553802 GAGGGGGAGAAAAAAGGGGTTGG - Intergenic
908390591 1:63679951-63679973 GAGGAGAAGCAAAAAGAGAAGGG - Intergenic
908783884 1:67716111-67716133 GAGGGGCTGCACAGAGAGGTGGG + Intronic
908947791 1:69521250-69521272 GAGGAGGAGGAAGAAGAGGAGGG + Intergenic
909948408 1:81690050-81690072 GAGTAGGAGGACAAAGAGAAAGG + Intronic
910017555 1:82546350-82546372 GAGGAGCATCAGAAAGAGGGAGG + Intergenic
910274803 1:85437429-85437451 GAGGAGGAGAAGGAAGAGGAGGG - Intronic
910457881 1:87417343-87417365 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
910484798 1:87701321-87701343 GAGGAGGAGGCAAAAGAGGCAGG + Intergenic
911474309 1:98357482-98357504 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
911602565 1:99862687-99862709 GAGGAAGAGAACAAAGTGGGAGG + Intronic
911676223 1:100661246-100661268 GAGATGGAGCACAAGGATGTAGG + Intergenic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
912759315 1:112352837-112352859 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
913163947 1:116168387-116168409 GAGGAGTAGAACAAAGAGGCGGG + Intergenic
913320409 1:117584146-117584168 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
913380085 1:118201161-118201183 GAGGAGGAGGAGAGAGAGGAGGG - Intergenic
913582741 1:120243060-120243082 GAGGAGCAGGAGAAAGAGGCAGG - Intergenic
913625432 1:120655300-120655322 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
913998873 1:143675404-143675426 GAGGAGGAGGGCAAGGAAGTCGG + Intergenic
914315148 1:146503820-146503842 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
914499206 1:148229556-148229578 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
914509507 1:148318472-148318494 GAGGAGGAGGGCAAGGAAGTCGG + Intergenic
914564671 1:148854554-148854576 GAGGAGCAGGAGAAAGAGGCAGG - Intronic
914608155 1:149275688-149275710 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
915163009 1:153932890-153932912 GAGCAGGGGCACAAAGGGGCAGG + Exonic
915345026 1:155193024-155193046 GGGGAGGAGGAGGAAGAGGTAGG - Intergenic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
915581268 1:156814626-156814648 GAGGAGGTGAACAAAGAGTTAGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915857016 1:159398836-159398858 GAGGAGGTAAAGAAAGAGGTAGG + Intergenic
915875140 1:159604276-159604298 GAGGTGGAGCCCATAGAGGCAGG - Intergenic
915940290 1:160114517-160114539 GATGAGGGGCACAGAGAGGAAGG - Intergenic
916199890 1:162260699-162260721 AAGGAGCAGCAAAAAAAGGTGGG - Intronic
916211726 1:162365217-162365239 GAGGAGGAGCCAAAAGGAGTGGG - Intronic
916412306 1:164558902-164558924 GAGGAGGAGCTGAAGGAGGCTGG + Intronic
916615785 1:166437977-166437999 AAGGAAGAGGCCAAAGAGGTTGG + Intergenic
916967215 1:169961666-169961688 GAGGAGGAGAAAGAAGAGGAGGG - Intronic
917216275 1:172681307-172681329 GAGAAGGAGAAGAAGGAGGTTGG + Intergenic
917390739 1:174533470-174533492 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
917547103 1:175982416-175982438 GAGAAGGAGGAGAAAGAAGTGGG - Intronic
917864854 1:179184579-179184601 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
918033254 1:180838307-180838329 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
918105967 1:181415489-181415511 GAGAAGGAGTAGAAGGAGGTGGG + Intronic
918581201 1:186132136-186132158 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
918761550 1:188417146-188417168 GAGGAGGAGGAACAAGAGGAAGG - Intergenic
918953574 1:191174388-191174410 GAGGAGGAGAACAAAGAGGAGGG + Intergenic
918999881 1:191816729-191816751 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
919003294 1:191861858-191861880 GAGGAGGTGGAGAAAGAGATAGG + Intergenic
919177007 1:194031687-194031709 GAGGAGGAGAAGAAAGAGATGGG - Intergenic
919535436 1:198781276-198781298 GAGGAGGATCACAAAAACGGAGG + Intergenic
919785127 1:201253904-201253926 GAGGTGGGGCACAAAGGAGTTGG + Intergenic
919846246 1:201644082-201644104 GGGGAGGTGCAGAAAGAGGCTGG - Intronic
919870837 1:201820054-201820076 GAGGAGGAGATGAAAGAGGAGGG + Exonic
920095529 1:203484056-203484078 CAGGTGGAGCACAAGCAGGTTGG - Exonic
920843836 1:209577003-209577025 GAGGAGCAGCACCTGGAGGTAGG + Intergenic
920857568 1:209675455-209675477 GAGGAGGAGAACGCTGAGGTCGG + Exonic
921021006 1:211235621-211235643 TTGGAGGATCACAATGAGGTTGG + Intergenic
921217798 1:212951657-212951679 GAGGAGGAGGACAAAGACGGCGG + Exonic
921542359 1:216431632-216431654 TGGGAGCAGGACAAAGAGGTGGG + Intergenic
922238994 1:223743226-223743248 AAGGATGGGCACAACGAGGTGGG - Intronic
922440625 1:225652957-225652979 GAGCAGGACCACGAGGAGGTGGG - Exonic
922564703 1:226594088-226594110 GAGGAGGAGGAAAACGAGGCAGG + Intronic
922595697 1:226811073-226811095 AAGGAGGAGAAGAGAGAGGTGGG - Intergenic
923152750 1:231248376-231248398 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
923212480 1:231816932-231816954 GAGGAGGAGGTGAAAGAGGGAGG - Intronic
923254621 1:232210976-232210998 GAGGAGAAGCACAGTGTGGTTGG + Intergenic
923442612 1:234035648-234035670 GAGTAAAAGCACAAAGAGGTAGG - Intronic
923474827 1:234322532-234322554 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
923498983 1:234549150-234549172 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
923567180 1:235084988-235085010 GAGGAGGTGGACAAGGAGGAGGG + Intergenic
923617641 1:235551030-235551052 GAGTAGGAGCCAAAAGAGGAGGG + Exonic
923658542 1:235939123-235939145 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
923774279 1:236964473-236964495 GAGGAGGAGAACAGAGAGTGAGG - Intergenic
923920679 1:238561133-238561155 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
923969693 1:239185871-239185893 GAGGTGGAGGAAGAAGAGGTAGG + Intergenic
924139430 1:241006805-241006827 GAGGAGGAGGATGAAGAGGAGGG - Intronic
924165959 1:241283715-241283737 AAGGAGGAAAATAAAGAGGTTGG - Intronic
924389634 1:243539211-243539233 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
924823188 1:247513807-247513829 GAGGGTGAGCAGAAAGAGGGTGG - Intronic
1063260166 10:4378860-4378882 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1064378727 10:14820946-14820968 GAGGAAGAGCGCAAAGGGGGAGG - Intronic
1065054944 10:21834872-21834894 GAGGTGGAGCCTACAGAGGTAGG - Intronic
1065139687 10:22708289-22708311 CAGGAGGAGAAAACAGAGGTCGG - Intronic
1065397791 10:25259088-25259110 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1065446302 10:25805113-25805135 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1066011574 10:31199145-31199167 GAGAAGGAGGAGAAAGAGGAAGG - Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066129736 10:32381298-32381320 GAGGAGGAGAAAGAAGAGGAGGG + Intergenic
1067095764 10:43298656-43298678 GAGGAGGAGGACATAGGGGAAGG - Intergenic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1068981799 10:63070470-63070492 GAGGAGGAGAAGGAGGAGGTGGG - Intergenic
1069049356 10:63776414-63776436 GAGGAGGAGGAGGAAGATGTGGG - Intergenic
1069340048 10:67399087-67399109 GAGGAGGAGGAGAAAGAGAAAGG + Intronic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1070166608 10:73903509-73903531 CCGGAGGAGAACACAGAGGTGGG - Intergenic
1070478357 10:76852749-76852771 GAGGAGGTAGAGAAAGAGGTAGG + Intergenic
1070599083 10:77853379-77853401 GAGGAGGACCAGAAGGAGATCGG - Exonic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1071014052 10:80973716-80973738 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1071805054 10:89109613-89109635 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1073329431 10:102661004-102661026 GAGGAGGCCCAGAAAGAGCTGGG + Intergenic
1073829793 10:107369680-107369702 AAGGAAGAACACAGAGAGGTTGG - Intergenic
1074753166 10:116606359-116606381 GGCAAGGAGAACAAAGAGGTTGG + Intronic
1074910226 10:117901778-117901800 GAGGAGGAGGAAGAAGAGGAGGG + Intergenic
1075093379 10:119455838-119455860 AAGGAAGAGCAGACAGAGGTGGG - Intronic
1075389123 10:122079639-122079661 GAGGAGCAGGACAGAGAGGCTGG + Intronic
1075575134 10:123572518-123572540 GAGGAGGAGGACGAGGAGGAAGG + Intergenic
1075624438 10:123951441-123951463 GGGGAGAAGGACAGAGAGGTTGG + Intergenic
1076098924 10:127758193-127758215 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG + Intergenic
1076634727 10:131874892-131874914 GAGGAGGAGCTCGAGGAGGAGGG + Intergenic
1076809432 10:132878943-132878965 GAGGAGCAGGACAAGGAGGGGGG + Intronic
1077037486 11:502465-502487 GAGGAGGTGCCCACAGAGGCTGG - Exonic
1077392507 11:2306729-2306751 GAGGAGGAGGACGAAGAAGGAGG + Intronic
1077531305 11:3096925-3096947 GAGGAGGAGAGGAAAGAGGGAGG + Intronic
1077628931 11:3797710-3797732 GAGGAGGGGCAGAAGGAGTTCGG + Exonic
1078031145 11:7752583-7752605 CAGGATGGGCACACAGAGGTTGG - Intergenic
1078112875 11:8413490-8413512 GAAGAGGAGGAAAAACAGGTAGG - Exonic
1078459998 11:11507449-11507471 TAGGAGGAAAAGAAAGAGGTGGG - Intronic
1079077985 11:17395532-17395554 GATCTGGAGCACAAAGAGGAGGG - Intronic
1079183714 11:18216840-18216862 GAGGAGGTACAGAAAGAGATGGG + Intronic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1079993846 11:27274649-27274671 GGGAAAGAGCACAAAGAGGTGGG - Intergenic
1080106109 11:28512961-28512983 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1080419042 11:32093964-32093986 GAGGGGGAGAAGAGAGAGGTAGG + Intronic
1080556795 11:33424865-33424887 GAGGAGGTGAAGAATGAGGTTGG + Intergenic
1080612925 11:33920619-33920641 GAAGAGGAGCAGCATGAGGTTGG + Intergenic
1080757536 11:35216495-35216517 ATGGAGGAGCACTAGGAGGTAGG + Intronic
1081584901 11:44377446-44377468 AGGAAGGAGCACAACGAGGTTGG - Intergenic
1081783373 11:45729047-45729069 GAGGAAGAACCCACAGAGGTAGG + Intergenic
1081831861 11:46121373-46121395 GAGGAGGAGGATGAAGAGTTGGG - Intergenic
1081989385 11:47329592-47329614 GAGGAAGGGCACAGAGAGGAAGG + Exonic
1082176283 11:49063802-49063824 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1083183120 11:61000946-61000968 GAATAGGAGAAGAAAGAGGTTGG - Intronic
1083571383 11:63763800-63763822 GAAGAGGAGGACGAAGAGGACGG - Exonic
1083743780 11:64724026-64724048 GAGGAGGAGAACAGAGAAGGGGG - Intergenic
1083832838 11:65243950-65243972 GTGGAGCAGCACGCAGAGGTAGG - Intergenic
1083966822 11:66048609-66048631 GGGGAGGAGGAAAAAGAGGGAGG - Intronic
1084231163 11:67754306-67754328 GAAGAGGAGCTCAGAGAGGAAGG + Intergenic
1084287299 11:68140589-68140611 AAGGAGGAGCTCAAGGAGGCAGG + Intergenic
1084591471 11:70093022-70093044 GAGGAGGAGGACAGAGAGAAAGG - Intronic
1085197615 11:74682034-74682056 GAGGAGGAGAACAAGGCGGGAGG - Intergenic
1085582536 11:77667365-77667387 GAGGAGGAGGAGGAAGAGGAAGG - Exonic
1085636142 11:78160848-78160870 GATCAGGAGCACTAGGAGGTTGG + Intergenic
1085871877 11:80359766-80359788 GAGGAGGAGGAAAAAGAGAAGGG + Intergenic
1085937327 11:81163927-81163949 GAAGAGGAGAACAAAGAAGGAGG + Intergenic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086689435 11:89772064-89772086 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
1086716422 11:90067890-90067912 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1086722514 11:90138277-90138299 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1086775519 11:90827330-90827352 GAGGAGGAATACAAAGAGGATGG - Intergenic
1086998900 11:93392926-93392948 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1086998921 11:93392994-93393016 GAGGAGGAGGAGAAAGAAGGAGG - Intronic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1087414773 11:97840158-97840180 GAAGAGGAGGAGAAAGAAGTGGG + Intergenic
1088373910 11:109119826-109119848 GATGAGGGGCAGAAAGAGGCCGG - Intergenic
1088947923 11:114533831-114533853 GAGGTGGAGCCTAAAGAGGCAGG - Intronic
1089111118 11:116057491-116057513 GGGGAGGAGGAGAATGAGGTTGG + Intergenic
1089546990 11:119235524-119235546 GAGGAGGAGTAGGAAGAGGAGGG + Intronic
1090168717 11:124579373-124579395 GAGGAGGAGGAAGAAGAGGGAGG + Intergenic
1090387747 11:126366368-126366390 GAGGAGGAGGACTGAGAGCTGGG + Intronic
1090390316 11:126383553-126383575 GAGGAGGAGGACTGAGAAGTGGG + Intronic
1090503262 11:127282772-127282794 GGGGAGGCAAACAAAGAGGTGGG - Intergenic
1090627381 11:128618719-128618741 GAGGAGGAGCCCAGAGACGATGG + Intergenic
1090990020 11:131808743-131808765 GAGAAGCAGCACAAATAGGAGGG + Intronic
1091078918 11:132647680-132647702 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1091384176 12:81833-81855 GAGAAGGAGCACCCAGAGGGAGG + Intronic
1091696454 12:2631263-2631285 GAGGAGGAGGAGAGAGAGGAAGG - Intronic
1092024833 12:5231850-5231872 GAGGACAAGCACAAAGCTGTGGG - Intergenic
1092111991 12:5970557-5970579 GAGCAGAAGCACTAAAAGGTGGG + Intronic
1092843334 12:12562934-12562956 GAGGAGGAGGAGGGAGAGGTGGG - Intergenic
1092932775 12:13332675-13332697 GAGGAGGAGGAAGAAGAGGACGG - Intergenic
1092989455 12:13881116-13881138 GAGGAATAGAACAAAGAGGATGG - Intronic
1093144599 12:15550358-15550380 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1093561974 12:20552514-20552536 GAGGAGGAGCAGCAGGAGGGGGG + Intronic
1093760767 12:22906850-22906872 GAGGAGGAGAAATAAGAGGAGGG + Intergenic
1094213757 12:27919478-27919500 CAGCAGGAACCCAAAGAGGTAGG + Intergenic
1094218632 12:27970721-27970743 GAGGAGGAGGCCAAGGAGCTGGG + Intronic
1094257148 12:28445297-28445319 GGGGAGGGGGACTAAGAGGTAGG - Intronic
1094582460 12:31746651-31746673 GATGAGGAGAAAAAAGAGGCAGG + Intergenic
1095255304 12:40028306-40028328 GAAGAGGAGGAAAAAGAGGTTGG - Exonic
1095416090 12:41978782-41978804 GAGGTGGAGCCTAAAGAGGCAGG + Intergenic
1095610421 12:44121413-44121435 GAGGAGGAGGAATAAGAGGAGGG - Intronic
1095716963 12:45356664-45356686 GAGGAGGAGGAAAAAGAGTAGGG + Intronic
1097278822 12:57831816-57831838 GAGGAGGAAGACAATGTGGTAGG + Intronic
1097334380 12:58365884-58365906 GAGGTGGAGCACAGAGAAGGAGG + Intergenic
1097907127 12:64931879-64931901 GTGGAGGGGCACAACCAGGTGGG + Intergenic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1099146393 12:79050306-79050328 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1099536207 12:83848183-83848205 GAGGAGGAGAAGACAGAAGTAGG - Intergenic
1099643391 12:85319524-85319546 GAGGAGGAGGACAAAGAGGAGGG - Intergenic
1099724652 12:86410931-86410953 GAGGAGGAGAGCAAAGTGGGAGG - Intronic
1099767671 12:87009423-87009445 GAGGAGGAGAAAAAAGATGGGGG + Intergenic
1099773796 12:87098932-87098954 GAGGTGGAGCCCACAGAGGCAGG - Intergenic
1100003139 12:89861366-89861388 GAAGAGGAGGAGAAAGAGGAGGG + Intergenic
1100694399 12:97075852-97075874 TCGGAGGATCACCAAGAGGTGGG - Intergenic
1101314073 12:103613282-103613304 GAGGTGGAGTATACAGAGGTAGG + Intronic
1102219044 12:111182025-111182047 GGGGAGGCGCACAGGGAGGTGGG + Intronic
1102983285 12:117259176-117259198 GATGAGGAGAGAAAAGAGGTGGG + Intronic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1103214968 12:119194958-119194980 GAAGAGGAGCAAAAAGAAGGTGG + Intronic
1103345239 12:120244981-120245003 GAAGGGGAGCTCCAAGAGGTGGG + Intronic
1103964968 12:124632801-124632823 GAGGAGGAGGACGCAGAGGCTGG + Intergenic
1104274074 12:127308881-127308903 GAGAAGCAGGACAAAGACGTCGG - Intergenic
1104361420 12:128136775-128136797 GAGGAGGAGGAACAAGAGGAGGG + Intergenic
1104506747 12:129339315-129339337 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
1104620449 12:130307996-130308018 GAGCAGGAGCAGAGACAGGTCGG + Intergenic
1105231904 13:18504000-18504022 GAGGTGGAGCCTAAAGAGGCAGG - Intergenic
1105671782 13:22626696-22626718 GGAGAGAAGTACAAAGAGGTAGG + Intergenic
1105675417 13:22666309-22666331 GAGGAGGAGGAAGAGGAGGTTGG - Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1106172418 13:27299425-27299447 GGGGAGGAGCACAAATTGGGTGG - Intergenic
1106189746 13:27441080-27441102 GAGGAGGAGGAGCAAGAGGAGGG + Intronic
1106200746 13:27534902-27534924 GAGGACAGGCACAGAGAGGTTGG - Intergenic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106243105 13:27925544-27925566 GAGGAGGAGGAGGAAGAGGACGG - Exonic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106423620 13:29604798-29604820 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1106555085 13:30802659-30802681 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1106774719 13:32997799-32997821 GATGAGGAGGAAAAGGAGGTTGG - Intergenic
1106985779 13:35347666-35347688 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1108216255 13:48187689-48187711 GAGGGGGACCACAAAGAGGAAGG + Intergenic
1108744963 13:53384025-53384047 GAGGAGGAGGAGAAAGATGGAGG - Intergenic
1108744972 13:53384111-53384133 GAGGAGGAGGAGAAAGATGCAGG - Intergenic
1108791294 13:53972236-53972258 GTGGAGGGGCACAACCAGGTGGG - Intergenic
1108828043 13:54440201-54440223 GAAGAGGAGGAGAAAGAGGGAGG - Intergenic
1109279352 13:60338289-60338311 GAGGAGGAGGAGGAAGAGGATGG - Intergenic
1109287365 13:60425753-60425775 GAGGAGGAGGAAGAAGAGGAGGG - Intronic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1110154268 13:72294816-72294838 GAGAAGGACCACACAGAGGCAGG - Intergenic
1110590114 13:77246602-77246624 GAGGAGGAGAAGAAAGAAGAAGG + Intronic
1110627412 13:77666873-77666895 GAGGAGGAGCAGAAGGAAGTTGG + Intergenic
1110666159 13:78119493-78119515 GAGGAGGAGGACAAGGAGGGAGG - Intergenic
1110945574 13:81411406-81411428 GAGGAGGAGGAGAAAGAAGAAGG - Intergenic
1111005185 13:82238593-82238615 GAGGAAGATGAGAAAGAGGTAGG - Intergenic
1112453183 13:99531464-99531486 GAGGAGGAAAACTAAGGGGTAGG - Intronic
1112607082 13:100917077-100917099 TAGGAGCAGCACGAAGAGGGTGG + Intergenic
1112839128 13:103553724-103553746 GAGGAGGAGAAAGAAGAGGAGGG - Intergenic
1113441801 13:110334956-110334978 GAGGAGGAAGATAAAGAGCTGGG + Intronic
1113538963 13:111092070-111092092 GAGGAGGAACAGGAGGAGGTGGG + Intergenic
1113909859 13:113836660-113836682 GAGGAGGGGGAAAAAGAGGAGGG + Intronic
1114262365 14:21046933-21046955 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1114403687 14:22434028-22434050 TGGGAGGAGAACTAAGAGGTGGG - Intergenic
1114552998 14:23544865-23544887 GAGGAGCAGAAAAAAAAGGTGGG - Intronic
1115123457 14:29965410-29965432 GAGGAGGAAGACAACGGGGTTGG - Intronic
1115303107 14:31906406-31906428 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1115401558 14:32967141-32967163 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1115976617 14:39004037-39004059 AGGGAGGAGAACACAGAGGTTGG + Intergenic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116110777 14:40577889-40577911 GAGGAGGAGGAGAGAGAGGGTGG + Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1117609458 14:57467112-57467134 AGGGAGGGGCACAAAGAGCTGGG + Intergenic
1118168955 14:63366374-63366396 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1118638460 14:67769745-67769767 CAGGAGGAGAAGAAAGAGGGAGG + Intronic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1118922973 14:70166933-70166955 GAGGAGGAGCAGCCAGAGGAGGG - Exonic
1119067367 14:71542508-71542530 GAGGAGGAGGAGGAAGAGGAAGG - Intronic
1119263796 14:73252855-73252877 TAGGTGTAGAACAAAGAGGTGGG + Intronic
1119895938 14:78220155-78220177 GAGGAGGAAAACAATGAGTTTGG + Intergenic
1119969381 14:78952388-78952410 GAAGAGGAGGACAGAGAAGTAGG - Intronic
1120161359 14:81148725-81148747 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1120262834 14:82209261-82209283 GAGGAGGAGGAGAAAGAGGTGGG + Intergenic
1120613594 14:86674106-86674128 GAGGAGGAGCCAAATGTGGTTGG - Intergenic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1121006379 14:90493207-90493229 GAGGAGGAGGAAAAAGAGGAGGG - Intergenic
1121109700 14:91303707-91303729 GAGCTGGAGCACAAGGAGCTCGG - Exonic
1121144207 14:91569434-91569456 AAGGAGGAGGAAAAAGAGGAAGG - Intergenic
1121174290 14:91879212-91879234 GAAGAGGACCACAAACAGCTGGG + Intronic
1121303449 14:92890065-92890087 GAGGAGCAGTCAAAAGAGGTGGG + Intergenic
1121304935 14:92900213-92900235 GAGAAGGAGCGCCAAGAGGAAGG + Intergenic
1121376131 14:93412333-93412355 GAGGAGGTGGAGAAAGAGATAGG + Intronic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121641566 14:95487909-95487931 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122293910 14:100694348-100694370 GAGGAGGAGAAGAAAGAGATGGG - Intergenic
1122305561 14:100764089-100764111 GAGGAGGAGGAGGAAGAGGTGGG + Intergenic
1122347066 14:101067341-101067363 GAGGAGGAGGACAAGGGGGAGGG - Intergenic
1122357836 14:101134637-101134659 GTGCAGGAGCACAGTGAGGTGGG + Intergenic
1122927714 14:104915231-104915253 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1202871950 14_GL000225v1_random:173003-173025 GGGGGGGAGCAGAAAGAGGCTGG + Intergenic
1123927217 15:25128094-25128116 GAGGAGGAGGAAGAAGAGGAGGG + Intergenic
1124109404 15:26772783-26772805 GACGGGGAGCACAAAGAGCGGGG + Intronic
1124161668 15:27275872-27275894 GACAATGAGCACAAGGAGGTGGG + Intronic
1124403487 15:29372211-29372233 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1124406782 15:29399913-29399935 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1124833044 15:33167871-33167893 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1124844091 15:33273935-33273957 GAGGAGGTAGATAAAGAGGTAGG - Intergenic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1125086393 15:35735118-35735140 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
1125789044 15:42349166-42349188 TAAGAGGAGCACAAAGAGTTAGG - Intronic
1126254957 15:46614833-46614855 GAGGTGGAGCCTACAGAGGTAGG - Intergenic
1126294830 15:47128352-47128374 GAGGAGGTGGAGAAAGAGATAGG - Intergenic
1126716882 15:51526937-51526959 GAGGAGGTAAAGAAAGAGGTAGG + Intronic
1126817589 15:52469480-52469502 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1127122065 15:55780375-55780397 GAGGAGGAGAAGAAAGAAGGTGG + Intergenic
1127400661 15:58582186-58582208 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1128014132 15:64327190-64327212 GAGGTGGAGCCTAAAGAGGCAGG - Intronic
1128704575 15:69829215-69829237 GAGGAGGAGGGGAAGGAGGTGGG - Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129131572 15:73502612-73502634 GAGGAGGAGGAGTAAGAGGAGGG + Intronic
1129327672 15:74809713-74809735 GAGGAGGAGCAGATGGAGGCAGG + Intergenic
1129834407 15:78692930-78692952 GAGGAGGAGCAAGAGGAGGAAGG + Intronic
1129957287 15:79650572-79650594 GTCGAGGATCACAAATAGGTGGG - Intergenic
1130927487 15:88396441-88396463 GAGGAGGAGCAGGAAAAGGAAGG - Intergenic
1131035880 15:89221778-89221800 GAGCAGGAGCACACAAAGGAGGG - Intergenic
1131339528 15:91584158-91584180 GAGGAGGAGAAGGAAGAGGAGGG - Intergenic
1131580397 15:93637248-93637270 GAGGAGGAGAAAAAAGAAGAGGG - Intergenic
1131879661 15:96849480-96849502 GTGGAAGATCACAAATAGGTTGG - Intergenic
1131929059 15:97418923-97418945 GAGGTGGAGCCCACAGAGGCAGG + Intergenic
1131930252 15:97433223-97433245 GAGGTGGAGCCCACAGAGGCAGG - Intergenic
1132102542 15:99034804-99034826 GAGTAGGAGAAGAGAGAGGTGGG + Intergenic
1132599703 16:768054-768076 GAGGAGGGGCACATGGAGGGGGG + Intronic
1132670966 16:1102197-1102219 GAAGGGGAGCCCAGAGAGGTGGG + Intergenic
1132906027 16:2283252-2283274 GAGGAAGAGCAGGATGAGGTAGG + Exonic
1132907801 16:2292191-2292213 GAGAAGAAGCAGAAAGAGCTGGG - Exonic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133392602 16:5422237-5422259 GAGGAGGAGCAGGGAGAGGGAGG + Intergenic
1133460662 16:5983888-5983910 GAGGAGGAGGAGAACGAGGAGGG - Intergenic
1133652113 16:7822327-7822349 AAGGAAGAGCAGAAAGAGCTGGG - Intergenic
1133922574 16:10166803-10166825 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1134064098 16:11215907-11215929 GAGCAGGAGCAAGAAGAGATGGG - Intergenic
1134111030 16:11515751-11515773 GAGGAGGAGGAGAAAAAGGGAGG + Intronic
1134289234 16:12890419-12890441 AAAGAGGAGCAGAAAGAGTTGGG - Intergenic
1134782947 16:16915335-16915357 GAGGAGGAACACAAATTGGGTGG + Intergenic
1135098370 16:19583846-19583868 CAAGGGGAGAACAAAGAGGTTGG - Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135475520 16:22771200-22771222 GAGGAGGATCACATAAAGTTGGG - Intergenic
1135686423 16:24501624-24501646 TAGGAGGAGGAGAGAGAGGTGGG - Intergenic
1135976775 16:27113634-27113656 GAGCAGGAGGAGAGAGAGGTGGG + Intergenic
1136157345 16:28392020-28392042 GAGGAGGAGGACAATGAAGGCGG - Exonic
1136205741 16:28723261-28723283 GAGGAGGAGGACAATGAAGGCGG + Exonic
1136629777 16:31483137-31483159 ATGGAGGAGCACACAGAGGCAGG + Exonic
1136658751 16:31734666-31734688 GGGGAGGAATAGAAAGAGGTTGG - Intronic
1137557109 16:49477458-49477480 GAGGAGGAGGAGAAAGAAGGAGG + Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1139830084 16:69790440-69790462 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
1139890808 16:70252192-70252214 GAGGTGGAGGCCAAATAGGTGGG - Intergenic
1140281953 16:73563105-73563127 GAGGAGGTGCTAAAGGAGGTGGG + Intergenic
1140324445 16:73987939-73987961 GAGGAAGAGAGCAAAGAGGGAGG + Intergenic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141353582 16:83322142-83322164 GGTCAGGAGCACAAAGAGGAGGG + Intronic
1141533104 16:84660224-84660246 CAGGAGGAGTTCAAAGAGATGGG + Intronic
1141650967 16:85392965-85392987 GAGGCCGAGCCCAAAGAGGCAGG - Intergenic
1141733107 16:85835332-85835354 GAGGCTGAGCACACAGAGGTGGG + Intergenic
1141737823 16:85866653-85866675 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1141798952 16:86294396-86294418 GGGCAGGAGCACACAGAGGGAGG + Intergenic
1141974649 16:87507464-87507486 GAGGATGACCACAAAGAGTGCGG - Intergenic
1142081095 16:88149215-88149237 CAGGAAGAGCACAAAGAAGCGGG - Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142990241 17:3725232-3725254 GAGGAGGAGTGCCAAGAGGACGG - Exonic
1143172951 17:4940593-4940615 GTGGCGGAGCTCAAGGAGGTGGG - Exonic
1143264205 17:5623570-5623592 GAGGAGGAGAACGGCGAGGTGGG + Intergenic
1143409967 17:6702886-6702908 GCAGAGGAGCAGAGAGAGGTGGG + Intronic
1143926324 17:10374451-10374473 GAGGAGGAGCAGGTAGAGATAGG + Intergenic
1143930449 17:10417818-10417840 GAGGGGGAGAATAAAGAGGAAGG - Intronic
1144193829 17:12871521-12871543 GAGGAAGAGAGCAAAGAGGGAGG + Intronic
1144229351 17:13184785-13184807 GAGGAGGGGGAGAAAGAGGAGGG + Intergenic
1144734530 17:17547646-17547668 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1145059962 17:19726685-19726707 GAGGAGGAGAACGAGGAGGAGGG + Intergenic
1146051870 17:29560613-29560635 GAGGAGGAGAAACAAGAAGTGGG + Exonic
1146339697 17:32007958-32007980 GAGGAGGAGGAGTAAGAGGAGGG + Intronic
1146987346 17:37232891-37232913 GAGGAGGAGGACAAGGGGGATGG - Intronic
1147178559 17:38671548-38671570 GAGGAGGAGGAAGAAGGGGTGGG - Intergenic
1147225196 17:38971149-38971171 GAGTTTTAGCACAAAGAGGTAGG - Intergenic
1147420824 17:40321429-40321451 GAGGAGGAGGAGGAAGAGGCAGG + Intronic
1147466477 17:40614945-40614967 GAGGAGGATCACAACAAGGCTGG + Intergenic
1148228545 17:45916558-45916580 AAGGAGGGGCCCAAAGAGGAAGG + Intronic
1148355401 17:46972306-46972328 GAGGAGGAGGAGAAAGAAGGGGG - Intronic
1149028472 17:52057311-52057333 GAGGAGGAGGGAAAAGAGGAAGG - Intronic
1149304499 17:55335049-55335071 GTGGAGGAGCACCAGGAGGCAGG - Intergenic
1149439768 17:56664383-56664405 GAAGATGAGCACCAGGAGGTGGG + Intergenic
1149507849 17:57210892-57210914 GATGGGGAGAACAAAGAGGTTGG + Intergenic
1150273747 17:63882800-63882822 GAGGAGGAGACAAAAGAGGAGGG - Intergenic
1150278042 17:63912149-63912171 GAGGAGGAGAAAAAAGAGGACGG - Intronic
1150279357 17:63920034-63920056 GAGGAGGAGAAAAAAGAGGAGGG - Intergenic
1151250680 17:72831978-72832000 GAAGAGGAGGAGAAGGAGGTTGG + Intronic
1151310583 17:73290330-73290352 GGGGAGGAGCACTCAGTGGTCGG - Intronic
1151320304 17:73348824-73348846 GAGGAGGAGCACAGGGTGGCAGG - Intronic
1151507166 17:74536985-74537007 GAGGAGGAGGACCAAGAGGTAGG + Intergenic
1152138844 17:78524734-78524756 GAGGAGGAGGAAAAAGACGAAGG + Intronic
1153185247 18:2478892-2478914 GAGGAGGAGGAAGAAGAGGGAGG + Intergenic
1153331306 18:3878460-3878482 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
1153794092 18:8607078-8607100 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1155064725 18:22258397-22258419 GAGGAGGAGGAAAAGGAGGAAGG - Intergenic
1155334849 18:24753075-24753097 GAAGATGAGCAGAAATAGGTAGG - Intergenic
1155512711 18:26593758-26593780 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155512724 18:26593816-26593838 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155545433 18:26909781-26909803 GAGGAGGAGGAGGAAGAGGAGGG + Exonic
1155660293 18:28240970-28240992 GAGGTGGAGCCTAAAGAGGCAGG - Intergenic
1155896682 18:31337880-31337902 AAGGAGGAGCAGAAACAGGGGGG + Intronic
1156019544 18:32583953-32583975 GGGGAGGAGCAGAAAGAGACAGG + Intergenic
1156619478 18:38832309-38832331 GTGAAGGATCACAAAGAGGCAGG - Intergenic
1156791742 18:40984020-40984042 GAGGAGGAGGAAGAAGAGGAAGG - Intergenic
1157232772 18:45934751-45934773 GAAGAGAAGCACAAAAAGATAGG + Intronic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157559923 18:48638833-48638855 GGGGAGGAGCCCAAGGAGGGTGG + Intronic
1158875151 18:61726478-61726500 GAGGAGGAGGAGGAAGAGGGGGG + Intergenic
1159848281 18:73493294-73493316 GAGGAGGAGAAGGAAGAGGACGG - Intergenic
1160077660 18:75693513-75693535 GGGGAGGAGCAGACAGAGGGAGG + Intergenic
1160845623 19:1164806-1164828 GAGGAGGAGCAGGAGGAGGGAGG + Intronic
1160866253 19:1257509-1257531 GAGGAGGAGGAGGAAGAGGAGGG - Exonic
1161370580 19:3908769-3908791 GAGGAGGAGAAGGAAGAGGGGGG - Intronic
1161557802 19:4954416-4954438 GAGGAGGAGCAGCAGGAGGGGGG + Exonic
1161635122 19:5383665-5383687 GAGGAGGAGGAAAAAGAAGAAGG - Intergenic
1161803532 19:6429462-6429484 GAGGAGGAGAGGAAAGAGGAGGG + Intronic
1162579968 19:11523155-11523177 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1162735199 19:12743169-12743191 GAGGAGGAAGATAAAGAGGGAGG + Intronic
1163104115 19:15113805-15113827 GAGGACGAGGACGAGGAGGTCGG + Exonic
1163611526 19:18304383-18304405 GAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1164245216 19:23422268-23422290 GAGAAGGAGCACAGGCAGGTGGG - Intergenic
1164308848 19:24029276-24029298 GAGAAGGAGCACAGGCAGGTGGG + Intergenic
1165768938 19:38367359-38367381 GAGGGAGAGCACAAAGTAGTGGG - Intronic
1165942625 19:39422834-39422856 GAGGAGGAGGAGGAAGAGGAAGG + Exonic
1166672452 19:44719035-44719057 GAAGAGGAGAAGAAAGAGGAAGG + Intergenic
1166738592 19:45100752-45100774 GAGGAGAAACAGAAACAGGTGGG + Intronic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1167098661 19:47390464-47390486 GGGGAGGAGCACAGGGAGGGAGG - Intergenic
1167194115 19:48015240-48015262 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167685734 19:50954881-50954903 GCCGTGGAGCACAAAGAGGCAGG + Intergenic
925249188 2:2416383-2416405 GAGGAGGAGGAGTAAGAGGATGG + Intergenic
925304721 2:2840006-2840028 GAGGGGGAACAGAAAGAGGGGGG + Intergenic
925314905 2:2913976-2913998 GAGCAGGGTCACTAAGAGGTGGG + Intergenic
925651427 2:6093687-6093709 GAAGAGGAGAAGAAAGAGGTTGG + Intergenic
926512324 2:13797781-13797803 GAGGAGGTAGAAAAAGAGGTAGG - Intergenic
926626116 2:15091361-15091383 GAGAAGGAGGAAAAAGAGGAGGG - Intergenic
926991203 2:18682424-18682446 CAGGAGGAACACAAAGAGACTGG + Intergenic
927131026 2:20060839-20060861 GAGGAGGAGCAAAAAGATATTGG + Intergenic
927271364 2:21214182-21214204 GAGGTGGAGCCCACAGAGGCAGG + Intergenic
927370934 2:22354539-22354561 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
927416727 2:22887841-22887863 GGGGAGGAGGAGGAAGAGGTGGG + Intergenic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927649376 2:24902647-24902669 GAGGAGGAGGAGAAAGAGAAGGG - Intronic
928262713 2:29782253-29782275 GAGGTGGATCAGAGAGAGGTAGG + Intronic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928416721 2:31098947-31098969 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
928612685 2:33005905-33005927 GAGTAGCAGCATAAAGTGGTAGG + Intronic
928822701 2:35381212-35381234 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
929357437 2:41042713-41042735 GAGGAGGAACACACAGATATAGG + Intergenic
929853916 2:45619584-45619606 GAGGAGGAGGAAGAAGAGGAGGG + Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930568591 2:53055485-53055507 GAGGAAGAGCAAGAAGAGGGAGG - Intergenic
931162610 2:59709840-59709862 GAGGAGGAGGAGAAAGAGAAAGG - Intergenic
931693242 2:64852955-64852977 GAGGAGGAAGAAAAAGAGGAAGG + Intergenic
931872985 2:66481546-66481568 GAGAAAGAGCAAAAAGAGGAGGG + Intronic
932127430 2:69156668-69156690 GAGGAAGAGAAGAACGAGGTGGG + Intronic
932218069 2:69979519-69979541 GAGGGGCAGGACACAGAGGTGGG + Intergenic
932591071 2:73068083-73068105 GAGGACGGGCAGAAAGAGGGTGG - Intronic
932593595 2:73081087-73081109 GAGGAGGAGGAGGAAGAGGTGGG - Intronic
932795353 2:74690410-74690432 GAGGAGGACGATGAAGAGGTGGG + Intergenic
932906110 2:75753996-75754018 GAGGAGGAGCATAAAGAAGGAGG - Intergenic
932921847 2:75924956-75924978 GAGGAAGAGGAGAAAGAGGAAGG + Intergenic
933018274 2:77159645-77159667 GAGGAGGAGGAGAAATAGGAGGG + Intronic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933767218 2:85718503-85718525 GAAGAGAAGCCCACAGAGGTAGG - Intergenic
934586167 2:95498051-95498073 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
935054358 2:99552700-99552722 GAGGAGGAGCAGGTAGGGGTAGG + Intronic
935612957 2:105044902-105044924 GAGGAGGAGCTCTATGAGATGGG + Intronic
935848989 2:107198310-107198332 GAGGAGGAAGAAAAAGAGGGAGG + Intergenic
935863425 2:107359252-107359274 GAGGAAGGGCACAAAGAGGCTGG - Intergenic
936531176 2:113277970-113277992 GAGGAAGAGGACTTAGAGGTCGG + Intronic
936778054 2:115997826-115997848 GAGGAGGTAAACAAAGAGATAGG - Intergenic
937582987 2:123512037-123512059 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
938380038 2:130831506-130831528 GAGCAGGGGCACAAGGAGGCAGG + Intergenic
938520776 2:132068472-132068494 GAGGTGGAGCCTAAAGAGGCAGG + Intergenic
939550033 2:143603753-143603775 GAGCAGCAGCACAGATAGGTGGG - Intronic
939756984 2:146126390-146126412 GAGGAGGAGAAAAGAGAGGTAGG - Intergenic
939825851 2:147014901-147014923 GAGGAGGAGGAGGAAGAGGTGGG - Intergenic
939866324 2:147476566-147476588 TAAGATGAGGACAAAGAGGTAGG - Intergenic
939938064 2:148316050-148316072 GAGGAAGAGAGCAAAGAGGCTGG + Intronic
940017975 2:149126570-149126592 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
940409357 2:153342678-153342700 GAAGAGGAGCAGGAAGAGGAGGG - Intergenic
940729102 2:157369065-157369087 GAGGTGGAGCCCACAGAGGCAGG - Intergenic
940741633 2:157515673-157515695 GAGGTGGAGCCTACAGAGGTAGG - Intergenic
941494966 2:166188539-166188561 GAGGAGGAGGAAACAGAAGTGGG - Intergenic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
942009323 2:171743290-171743312 GAGGAGGAAAAGAAAGAGGAAGG + Intronic
942208303 2:173645867-173645889 CAGGAGGAATACAAAGAAGTAGG + Intergenic
942810254 2:179991241-179991263 GAGGAGGTGCTGGAAGAGGTAGG + Intronic
944021500 2:195110736-195110758 GAGGAGGTAGACAAAGAGATAGG - Intergenic
944095178 2:195958217-195958239 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
944148583 2:196532812-196532834 GAGAAGGAGAGCAAAGAGGTGGG + Intronic
944357476 2:198808611-198808633 GAGGAGGAGCTAAAAGAGGTGGG - Intergenic
944495180 2:200300196-200300218 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
944981106 2:205120938-205120960 GAGGAAGAACACAAAGTGTTAGG + Intronic
946006133 2:216526552-216526574 GAGGAGGAGCACATTGGAGTAGG - Intronic
946054944 2:216892942-216892964 GAGGAGGAGCTCATAGAGGTGGG - Intergenic
946148809 2:217750326-217750348 GAGGAGGAGGAAGAAGAGGGGGG + Intronic
946369511 2:219272073-219272095 GAGAAGGATTACAAGGAGGTGGG + Intronic
946372713 2:219290422-219290444 GAGGAGGCGCAGAAGCAGGTGGG + Intronic
946539249 2:220665804-220665826 GAGGAGAGGGATAAAGAGGTTGG - Intergenic
947539323 2:230964317-230964339 GAGCAGGAGCCCACGGAGGTGGG + Intergenic
948520052 2:238530547-238530569 GAGGAAGAGAGCAAAGAGGGAGG - Intergenic
948571162 2:238917952-238917974 CACGAGGAGCAGAAACAGGTGGG + Intergenic
948819189 2:240529962-240529984 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
1168841473 20:912601-912623 GAGGAGGAGGAGAGAGAGGGAGG + Intronic
1168870122 20:1120407-1120429 GAAGAGCAGCACAAAGAGAAAGG - Intronic
1169285689 20:4305388-4305410 AAGGAGGCCAACAAAGAGGTGGG - Intergenic
1169472933 20:5903972-5903994 GAGGATGAGCACAGAGAGAAGGG + Intergenic
1170419327 20:16176933-16176955 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1170682260 20:18536964-18536986 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1170841131 20:19925042-19925064 GAGGAGGAGCACAAAGAGGTGGG - Intronic
1171060240 20:21949594-21949616 GAAGATGAGAGCAAAGAGGTAGG + Intergenic
1172037084 20:32018428-32018450 GTGGTGGAGCACTAAGAGGGTGG + Intronic
1172621293 20:36320065-36320087 GAGGAGGCGGACACAGAGGGAGG - Intronic
1172621339 20:36320200-36320222 GAGGAGGGGGACACAGAGGGAGG - Intronic
1172787016 20:37475154-37475176 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1173576276 20:44114802-44114824 CAGGAGGTGAACAAAGAGGATGG + Exonic
1174343935 20:49915644-49915666 GAGGCGGAGGACAAAGCGGAAGG + Intergenic
1174782867 20:53406236-53406258 GAGCAGGATCACAAAGATGGCGG + Intronic
1175298861 20:57928689-57928711 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1175308573 20:57995127-57995149 AAGGTGAGGCACAAAGAGGTTGG - Intergenic
1175371179 20:58494139-58494161 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1175464982 20:59184864-59184886 GGAGAGGGGAACAAAGAGGTGGG - Intergenic
1175661423 20:60816275-60816297 GAGGAGGAGGAAAAAGAAGAAGG - Intergenic
1176037868 20:63049159-63049181 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1176415340 21:6471480-6471502 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1176775878 21:13132301-13132323 GAGGTGGAGCCTAAAGAGGCAGG - Intergenic
1178225363 21:30710904-30710926 GAGGAGGAGAGGAAAGAGGAGGG + Intergenic
1178505256 21:33157401-33157423 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178505261 21:33157420-33157442 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178505266 21:33157439-33157461 AAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178748297 21:35274969-35274991 GAGGGAGAGCAGAAGGAGGTGGG - Intronic
1178777063 21:35561948-35561970 GAGGAGGAGGAGAGAGAGGAAGG + Intronic
1179233193 21:39523796-39523818 GTGGAGGGGCACAACCAGGTTGG + Intergenic
1179391505 21:40996434-40996456 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1179416703 21:41204004-41204026 GTGGAGGAGAACAGAGAGATAGG + Intronic
1179690840 21:43079813-43079835 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1179986215 21:44921595-44921617 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1180210987 21:46295479-46295501 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1180878670 22:19187976-19187998 GAGGAGGAGGACTATCAGGTGGG - Exonic
1181711861 22:24696182-24696204 GTGGAGGAGGAGAAAGGGGTGGG - Intergenic
1181755069 22:25018016-25018038 GAGGAGGAGGAGGAGGAGGTTGG - Intronic
1181761559 22:25062239-25062261 GAGGAGGAGAAAAGAGAGGAAGG - Intronic
1181919354 22:26308289-26308311 GAGGATGAGCACAAAGATGGAGG + Intronic
1181977211 22:26738473-26738495 AAGGAGGAGAACAAGGAGGAGGG - Intergenic
1182744266 22:32593605-32593627 GAGGAGGAGGAGAAGGAGGGAGG + Intronic
1182985872 22:34715760-34715782 GAGGAGGAAGAGAAAGAGGAGGG - Intergenic
1183572181 22:38661884-38661906 CAGGAGGAGCAGTGAGAGGTCGG + Intronic
1183645452 22:39123766-39123788 GCAGAGGAGCACAAGGAGGAAGG + Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184380209 22:44140646-44140668 GATGAGGAGCAGAGAGAGGAAGG - Intronic
1184769891 22:46590685-46590707 GAGGAGGAGCTCAGAGAGATTGG + Intronic
1184879337 22:47295149-47295171 GAGGAGGCTCTCAAGGAGGTGGG - Intergenic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1185075061 22:48678537-48678559 GAGCTGGAGCAGGAAGAGGTCGG + Intronic
1185203162 22:49520919-49520941 GGGCATGAGCACCAAGAGGTGGG + Intronic
950179625 3:10901815-10901837 GAGGAGGCTGAGAAAGAGGTGGG + Intronic
950665503 3:14492612-14492634 GAGGAAGAGGAGAAAGAGGGAGG - Exonic
950729987 3:14948243-14948265 GAGGAGGAGGATAAGGAGGAAGG - Intronic
950942185 3:16904077-16904099 AAGGAGGAGCACCTAGATGTTGG + Intronic
951033010 3:17903788-17903810 GAGGAGGAGGACAAAGAGGAAGG - Intronic
951834101 3:26961900-26961922 GAATAGGAGCAGGAAGAGGTAGG - Intergenic
952141795 3:30487492-30487514 GAGAAGGAGCAAGCAGAGGTGGG - Intergenic
953219801 3:40959474-40959496 GAGGTGGAGCCCACAGAGGCAGG + Intergenic
953230260 3:41058362-41058384 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
953405813 3:42659259-42659281 GAGGAGGAGGAGGAAGAGGGTGG + Exonic
953577974 3:44128472-44128494 GAGGAGGAGCTCAGACAGGTGGG - Intergenic
953694425 3:45146456-45146478 GAGGAGGAGGAGAGAGAGGAGGG - Intergenic
953713840 3:45298696-45298718 GAGTAGGAACTCAAAGAGCTTGG - Intergenic
954264492 3:49461850-49461872 GAGGAGGAGGAGAAGGAGGGTGG - Intergenic
954725298 3:52603516-52603538 GAGAAGAAGAAAAAAGAGGTTGG - Exonic
954839022 3:53495073-53495095 GAAGGGGATCACCAAGAGGTAGG - Exonic
955083943 3:55683878-55683900 GGGGAGGTGCACAGAGAGGAGGG + Intronic
955300221 3:57771191-57771213 GAGGAGGAGGAGAAAGAGAAGGG - Intronic
955371557 3:58356249-58356271 GAGGAGGGGCAGAAAGGAGTGGG + Intronic
955520655 3:59772520-59772542 GAAGCTGAGCACAGAGAGGTCGG + Intronic
955652709 3:61211545-61211567 GAGGTGGAGCCCACAGAGGCAGG - Intronic
955846184 3:63165178-63165200 GAGGAGGAGGAGGAAGAGGAAGG - Intergenic
955959616 3:64326841-64326863 GAGGAGGAGGAGGAAGAGGATGG + Intronic
956042874 3:65164033-65164055 GAGGAGGAGGGCAAAGGGGCAGG - Intergenic
956514003 3:70025940-70025962 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
956794532 3:72705742-72705764 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
957047710 3:75389190-75389212 GAAGAGGAGCTCAGAGAGGAAGG + Intergenic
957217265 3:77336488-77336510 GAGGAAGAGGAGAAAGAGATGGG - Intronic
957347856 3:78984926-78984948 TAGGAGGAGGAGAAAGAGGAGGG - Intronic
957501710 3:81066521-81066543 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
957813154 3:85254745-85254767 GAGGAGGAACACAAGAAGGTTGG + Intronic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
958154597 3:89740355-89740377 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
958527955 3:95287414-95287436 GAGGTGGAGCCTAAAGAGGCAGG + Intergenic
959651806 3:108757618-108757640 GAGAAGGAGAACAAAAAGGCAGG - Intergenic
959668434 3:108947346-108947368 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
959847461 3:111050825-111050847 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
960266384 3:115625140-115625162 GAGAAGGAGCAGGAAGAGGATGG + Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960563711 3:119112984-119113006 GAGGAAGAGAACAAAGGGGGAGG + Intronic
960760163 3:121064267-121064289 GAGGAGGAGCAGAAGCAGGGTGG - Intronic
960899661 3:122542219-122542241 GAGGAGGAGAAGAAAGGGGTAGG - Intronic
960918099 3:122717764-122717786 GAGGAGGAACACAATGAGCTGGG + Intronic
960936415 3:122906703-122906725 GGGGAGGAGGAAAAAGAGGAGGG + Intergenic
960936421 3:122906721-122906743 GAGGGGGAGGAAAAAGAGGAGGG + Intergenic
961348391 3:126279940-126279962 GAGGAGGAGGAGGAAGAGGAAGG - Intergenic
961879785 3:130053317-130053339 GAAGAGGAGCTCAGAGAGGAAGG + Intergenic
962498405 3:135965681-135965703 GAGGAGGAGGAGAAGGAGGTAGG + Exonic
963798933 3:149658142-149658164 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
965611400 3:170547625-170547647 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
965633848 3:170760863-170760885 GATGAAGAGAACAAAGAGGGAGG + Intronic
965659522 3:171026785-171026807 GAGGAGGAGCAAGGAGAGGGAGG + Intergenic
965806860 3:172550980-172551002 GAGGAGGAAAATGAAGAGGTGGG - Intergenic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966741627 3:183239811-183239833 TAGGAGGAAGACAAAGATGTGGG - Intronic
966760513 3:183413888-183413910 GAGGAGGAGGAAGAAGAGGAGGG + Intronic
967253476 3:187566630-187566652 GAGGAGGAGTGCAAAGAGAGTGG + Intergenic
967341708 3:188405910-188405932 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
967397303 3:189022703-189022725 GAGGTGGAGCCTAAAGAGGCAGG + Intronic
968230823 3:197003563-197003585 GGAAAGGAGCACAAAGAGGGAGG - Intronic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968991993 4:3920425-3920447 GAAGAGGAGCTCAGAGAGGAAGG + Intergenic
969107128 4:4815891-4815913 GAGGTGGAGCACACTGATGTTGG + Intergenic
969200902 4:5604940-5604962 GAGGAGGAGGAGTAAGAGGAAGG - Intronic
969264850 4:6057678-6057700 GAGGGGGTGCACACAGAGGTGGG - Intronic
969561805 4:7953137-7953159 GAGGAGGAGAAAGAAGAGGAGGG + Intergenic
969823349 4:9737253-9737275 GAAGAGGAGCTCAGAGAGGAAGG - Intergenic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970000556 4:11361524-11361546 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
970365212 4:15351262-15351284 GAGGAGGAGAAAACAGAGGAAGG - Intronic
970761286 4:19491604-19491626 CAGTAGGAACACAGAGAGGTGGG - Intergenic
970894782 4:21089283-21089305 GAGGAAGAGAGCAAAGAGGGAGG - Intronic
971436592 4:26632530-26632552 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
972319425 4:37959447-37959469 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
972645326 4:40962703-40962725 AAAGAGGAGGACAAAGAAGTGGG + Intronic
972666412 4:41169233-41169255 AAGGAAGAGCACAGAGAGGGAGG + Intronic
973064149 4:45766414-45766436 GAGGAGGAGGAGAAAGAAGTTGG - Intergenic
973265963 4:48210525-48210547 GAGGAGGAGGAGGAAGAGGGAGG + Intronic
973532074 4:51844055-51844077 GAGGAAGAGGAGAAAAAGGTGGG + Intronic
973932072 4:55803220-55803242 GAGAAGGGACACACAGAGGTTGG + Intergenic
974182449 4:58401363-58401385 GAGGTGGAGCCTAAAGAGGCAGG + Intergenic
975443927 4:74441043-74441065 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
975595402 4:76044854-76044876 GTGCAGGAACCCAAAGAGGTGGG - Intronic
976041247 4:80887128-80887150 GAGGAGGTAGACAAAGAGATAGG + Intronic
976303439 4:83536427-83536449 GAGGAGGAGCCCAGGGAGGAAGG + Intronic
977416890 4:96744243-96744265 GAGGAGGAGAACAAAGAGGGAGG - Intergenic
977522240 4:98099478-98099500 GATGAGGCTCACAAGGAGGTGGG + Intronic
977586596 4:98781346-98781368 GAGGAACAGCACAAATAGGATGG - Intergenic
977666440 4:99650918-99650940 GAGGAGGAGGTCAAGGAGGAAGG - Exonic
977677076 4:99759523-99759545 GAGGGGGAGGACACAGAGGCGGG - Intergenic
977934399 4:102784780-102784802 GAGGAGGAGGAGGAGGAGGTTGG - Intergenic
978102547 4:104860336-104860358 TAGGAAGAGCACAGAGAGGCAGG + Intergenic
978420423 4:108526819-108526841 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
978682765 4:111402368-111402390 GAGAAGGAGCAGGAAGAGGAGGG + Intergenic
978734628 4:112071713-112071735 GAGGAGGAGGAGAAAGAGAAGGG - Intergenic
978782074 4:112566796-112566818 GAGGAGGGGATCAAAGAGGGTGG + Intronic
980183474 4:129432091-129432113 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
980413152 4:132448685-132448707 GAGGAGGTAGACAAAGAGATAGG + Intergenic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
980844912 4:138312811-138312833 GAGGAGGAGGAGAAAGGGGCAGG - Intergenic
981498716 4:145423119-145423141 GAGGAGGAGAAGAAAGGGGAGGG + Intergenic
981797057 4:148607309-148607331 GGGGAGGTGCACCAAGATGTGGG - Intergenic
981809662 4:148759493-148759515 GAGGAGGAGCAAGAGGAGGAGGG + Intergenic
981979174 4:150771027-150771049 CAGGAGGAGCCCAAAGTGGCTGG + Intronic
982114449 4:152086100-152086122 GAGGAGGAGAAGAAAGAGATGGG - Intergenic
983348913 4:166561973-166561995 GAGGAGGTGGAGAAAGAGATAGG - Intergenic
984019701 4:174470242-174470264 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
984334512 4:178372399-178372421 GAAGAGGAGGAAAAAGAGGTTGG - Intergenic
984702226 4:182825762-182825784 GAGGAGGGAAACAAGGAGGTGGG - Intergenic
984782389 4:183537708-183537730 GAGGAGGAGGATGAAGAGGAGGG + Intergenic
985106887 4:186508928-186508950 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
986063546 5:4213896-4213918 GAGGAGGAGGAGAAAGAAGAGGG + Intergenic
986281752 5:6329127-6329149 GAGGAAGAGAACGAAGAGGGAGG - Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986630987 5:9774011-9774033 GAGGAGGTGGAAAAAGAGATAGG - Intergenic
986759926 5:10870542-10870564 GAGGAGGAGAAGGAGGAGGTGGG - Intergenic
986953349 5:13119304-13119326 GAGGAGGAGGAAGAGGAGGTAGG + Intergenic
986999245 5:13642473-13642495 GAGAAGCAAAACAAAGAGGTTGG - Intergenic
987081206 5:14427190-14427212 GAGGAGCTGCAGAAAGGGGTGGG - Intronic
987338698 5:16920473-16920495 GAGAAGGAGAAAAAAGAAGTAGG + Intronic
987425056 5:17763575-17763597 CAGCACAAGCACAAAGAGGTGGG - Intergenic
987510838 5:18836312-18836334 GAGGAGGAGGAGAAAGTGGAGGG - Intergenic
987665510 5:20933323-20933345 GAGGACGAGGATAAAGAGGAAGG + Intergenic
988211990 5:28215862-28215884 AAGGAGGAGAAGAAGGAGGTGGG - Intergenic
988427486 5:31080354-31080376 GAGGAGGAGCTCTGAGAGGTGGG - Intergenic
988695510 5:33618266-33618288 GAGGAGGAAAACGAAGAGGAGGG + Intronic
988757185 5:34268855-34268877 GAGGACGAGGATAAAGAGGAAGG - Intergenic
989325572 5:40189696-40189718 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989556826 5:42806638-42806660 GAGGAGGAGAAAGAAGAGGAAGG + Intronic
989756209 5:44958726-44958748 GAGGAGGAACAAGAAGAGGAAGG - Intergenic
990549141 5:56855113-56855135 GAGGAGGAGAAAAAGGAGGAGGG - Intronic
991435958 5:66597001-66597023 GAGGAGCAGGACGAGGAGGTGGG + Exonic
991556646 5:67902303-67902325 GAGGAGGAGCACTTACAGGAGGG + Intergenic
991562656 5:67970953-67970975 AAGGAGGAGGAGAAAGAGGTAGG + Intergenic
992047332 5:72907407-72907429 GAAGAGGAGTACAAAAAGGCAGG - Intronic
992697332 5:79303057-79303079 GAGGAAGAGCACATATGGGTGGG + Intronic
992912335 5:81408164-81408186 GAGGAGGAGGAGGAGGAGGTGGG + Intergenic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993153223 5:84187846-84187868 GAGGAGGAGTACAAAGGAGAAGG - Intronic
993456575 5:88133987-88134009 GAGGAGGAGAAAGAAGAGGAAGG + Intergenic
993625448 5:90219321-90219343 GAGGAGGAGGAGGAAGAGGTGGG + Intergenic
993915973 5:93742574-93742596 GAGGAAGAGCACAATGACCTTGG + Intronic
993998045 5:94745744-94745766 GAGAAGCAGCACAAAGTGCTCGG + Intronic
994607570 5:101988813-101988835 GAGGAGGAAGACGAAGAGGAGGG + Intergenic
995264772 5:110145821-110145843 GAGGAGGAGGAAAAAGAAGAAGG - Intergenic
995963845 5:117879858-117879880 GAGGAAGGGCACACACAGGTGGG - Intergenic
996134334 5:119820459-119820481 GAGGAAGAGAACAAAAAGATGGG - Intergenic
996165745 5:120220734-120220756 GAGGAGGAGGAAAAGGAGGTGGG - Intergenic
996557618 5:124795432-124795454 GAGGAGGAGAATGAAGAGGAGGG + Intergenic
996620306 5:125493337-125493359 TAGGATGAGCACAAAGTGGCTGG + Intergenic
996665602 5:126056686-126056708 GAAGAGGAGGAAATAGAGGTAGG + Intergenic
997278536 5:132620953-132620975 GAGGAGGAGGAAGAAGAGGAGGG + Intronic
997419507 5:133754992-133755014 GAGGAGGAGGAGCAAGAGCTGGG - Intergenic
998555103 5:143115448-143115470 GAGGAGAAATACAAATAGGTAGG + Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998877000 5:146610013-146610035 GAGGTGGAGCCCACAGAGGCAGG - Intronic
999044842 5:148455924-148455946 GAGGAGGAGGATGAAGAGGGGGG + Intronic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999178364 5:149648379-149648401 GAGGAGGAGAGCAAGGAGGGAGG - Intergenic
999275163 5:150325370-150325392 GAGGAGGAGAACAGGGATGTAGG + Intronic
999376341 5:151088979-151089001 GGAGAGGAGCAATAAGAGGTGGG + Intronic
999578593 5:153008745-153008767 GGGGAAGAGGACACAGAGGTAGG - Intergenic
999612194 5:153381920-153381942 GAGGTGGAGCATACAGAGGCAGG - Intergenic
1000647241 5:163773606-163773628 GGGGAGGAGGATAGAGAGGTAGG - Intergenic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1000776531 5:165426537-165426559 GAGAAGGAGGAAAAAGAGGAGGG - Intergenic
1000847551 5:166300367-166300389 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1001600758 5:172926628-172926650 GAGGGGGAGGGCAGAGAGGTGGG + Intronic
1002042271 5:176523437-176523459 GAGGAGGAGGAGAAAAAAGTGGG - Intergenic
1002193455 5:177490443-177490465 CAGGAGGAACAGAAAGAGGGAGG + Intronic
1002664683 5:180814423-180814445 GAGGAGGAGCAGCCAGAGGAGGG - Intronic
1002937701 6:1687653-1687675 GAGGAGAGACACAAAGAGGCAGG + Intronic
1003487860 6:6595267-6595289 GAGGAGGATGAGGAAGAGGTGGG + Intronic
1003849621 6:10208508-10208530 GAGGAGGAGCAGGCAGAGGAGGG + Intronic
1003856940 6:10286045-10286067 GAGGAGGAGGAGAAGGAGGGAGG + Intergenic
1003872791 6:10415152-10415174 GAGGAGGAGGAGGAAGAGGAGGG + Exonic
1003963990 6:11235837-11235859 GAGGATGAGCTCAGAGAGGTAGG + Intronic
1003989230 6:11469399-11469421 GAGGAGGAGGCCAAAGAGAGGGG - Intergenic
1004129783 6:12908669-12908691 GTGGAGGACCACACAGAGGCTGG - Intronic
1004476483 6:15978041-15978063 GAGGAAGAGAGCAAAGAGGGAGG - Intergenic
1004584006 6:16981950-16981972 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1004832826 6:19495672-19495694 GAGGTGGAGCCCACAGAGGCAGG - Intergenic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005122574 6:22406004-22406026 AAGGAGGAGGAGAAAAAGGTGGG + Intergenic
1005451546 6:25977695-25977717 GAGGAGGAAGAGAAAGAGGTGGG + Intronic
1005704401 6:28437031-28437053 GATAATGAGCACAAAGAAGTTGG + Intronic
1005990413 6:30898644-30898666 GAGGAGCAGAAGGAAGAGGTGGG + Intronic
1006077985 6:31546620-31546642 GAGGAGGAGAAGTAAGCGGTGGG - Exonic
1007164771 6:39821579-39821601 GAGAAGGAGGAGACAGAGGTGGG + Intronic
1007369781 6:41418871-41418893 AAGGTGGAGGACAAAGAGATTGG - Intergenic
1007725698 6:43914467-43914489 GAGGAGGAAAACAGAGAGATGGG - Intergenic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1008054565 6:46933015-46933037 GAGGAGAAGCACAAAGTTGGAGG + Intronic
1009234456 6:61105664-61105686 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1009352972 6:62706148-62706170 GAGGAGGAAGAGAAAGAGATAGG - Intergenic
1009407304 6:63327910-63327932 GTGCAGGAACACAAAGAGGTGGG - Intergenic
1009728993 6:67574717-67574739 GAGGAGGAGGAGAAAGAGAAGGG + Intergenic
1009881183 6:69568085-69568107 GAGGAGAATAACCAAGAGGTGGG + Intergenic
1010179799 6:73073112-73073134 GAGGAGGAACAGAAAGGGGGAGG - Intronic
1010373845 6:75143247-75143269 GAAGAGGATGTCAAAGAGGTAGG - Exonic
1010641445 6:78333329-78333351 GAGGAGGAGGAGAAAGAAGGGGG + Intergenic
1011116139 6:83894853-83894875 GAGGAGGAGGAGAAATAGGGAGG + Intronic
1011258559 6:85449571-85449593 GAGGAGGAGTAAAGAGAGGCCGG - Intronic
1011778694 6:90761875-90761897 GAGGAGGAGGAAGAAGAGGAGGG + Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1012107203 6:95178122-95178144 GAGGAGGAGGAGGAAGAGGATGG + Intergenic
1012274905 6:97261372-97261394 GAGGAGGAGGAAGAAGAGGAGGG - Intronic
1012409281 6:98937624-98937646 GAGGAGGTGTAAAAAGAGGCAGG + Intronic
1012982620 6:105846251-105846273 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1013179925 6:107708944-107708966 AAAGGGGAGGACAAAGAGGTAGG - Intronic
1013189742 6:107792027-107792049 GGGGAGGGGAACAAATAGGTGGG + Intronic
1013329963 6:109090662-109090684 GAGGAGGAGGATCAAGAGGAGGG + Intronic
1013519920 6:110923677-110923699 GAAGAGGAGCAAAAAGAAGGTGG + Intergenic
1013652509 6:112209999-112210021 GAGGGAGAGCACAAAGGGGGAGG - Intronic
1013660120 6:112287155-112287177 GTGGAAGAGGACAAAGAGGTAGG - Intergenic
1013836772 6:114343089-114343111 GAGGAGGAGCACGGGGAGGAGGG - Intergenic
1013908911 6:115250601-115250623 GAGGTGGAGCCTACAGAGGTAGG - Intergenic
1014311818 6:119813193-119813215 GAGGAGGAGGAGAAAGAGAAGGG + Intergenic
1014617553 6:123622128-123622150 GAGGAGGAGGAAAAAGAGGAAGG - Intronic
1015030478 6:128588183-128588205 GAGGAGGTAGACAAAGAGATAGG + Intergenic
1015038193 6:128683506-128683528 GATGAGTAGAACAAAGAGATAGG + Intergenic
1015088082 6:129320263-129320285 GAGGAGGAGGAAGAAGAGGAGGG + Intronic
1015091691 6:129365948-129365970 GAGGAGGAGCAAATAGATTTGGG - Intronic
1015218512 6:130777814-130777836 GAGGAGGAGAATATAGGGGTTGG + Intergenic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1015977648 6:138807069-138807091 GAGGAGGAAGAGAAAGAGGAAGG + Intronic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016543607 6:145195352-145195374 GAGGAAGAGAACAAAGGGGGAGG + Intergenic
1016731551 6:147433060-147433082 GAGGAAGGGTAGAAAGAGGTTGG - Intergenic
1016801484 6:148173538-148173560 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1017032498 6:150236575-150236597 GAGGAGGAGCTGAAAGCGGAGGG + Intronic
1017179759 6:151540332-151540354 GAGGAGGAGGAGGAAGAGGAAGG - Intronic
1017602164 6:156095481-156095503 GAGGAGGAGGAGGAAGAGGTGGG - Intergenic
1017624063 6:156330459-156330481 GAGGTGGAGCCTACAGAGGTAGG + Intergenic
1018038096 6:159898723-159898745 GAGGAGGAGGAGGAAGAGGGAGG - Intergenic
1018378974 6:163240538-163240560 GAGGAGGGGACCAAGGAGGTGGG - Intronic
1018693927 6:166374879-166374901 GAGGAGGAGAACAAAGTTGGAGG - Intronic
1019322777 7:423104-423126 TAGGAGAAGCACGAAGGGGTGGG + Intergenic
1020314812 7:6897996-6898018 GAAGAGGAGCTCAGAGAGGAAGG + Intergenic
1020555913 7:9670157-9670179 GAGGAGGAGGAGGAGGAGGTTGG + Intergenic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020679267 7:11216727-11216749 GTTGAGGAGGACAAAGAGTTAGG + Intergenic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1020898750 7:13975633-13975655 GAAGAGGTCCACAAAGAGGAGGG + Intronic
1021003281 7:15360580-15360602 GAGGAGGAGGAGGAAGAGGTGGG + Intronic
1021359032 7:19689163-19689185 GAGGTGGAGCCTACAGAGGTAGG + Intergenic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021782833 7:24122644-24122666 GAGGAGGAACATGAACAGGTTGG - Intergenic
1022324558 7:29319366-29319388 GAGGAGGAGAAAAAAGTTGTGGG + Intronic
1022731813 7:33033645-33033667 GAGGAAGAGCCAACAGAGGTAGG + Intronic
1022745581 7:33168417-33168439 AAGGAGGAGGAAAAAGAGATAGG - Intronic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023586856 7:41739781-41739803 GAGGAGGAGGAGAAAAAGGAGGG + Intergenic
1023761460 7:43468414-43468436 GTGGAGTCGCACAGAGAGGTGGG + Intronic
1024022249 7:45382976-45382998 GAGGTGGAGCCTAAAGAGGCAGG + Intergenic
1024104352 7:46067066-46067088 GAGGAGGAGGAAAAGGAGATGGG - Intergenic
1024168878 7:46764024-46764046 GAGGAAGAGAAAAAAGAAGTGGG - Intergenic
1024192894 7:47030829-47030851 GAGGAGGAGGTAAAAGAGCTTGG + Intergenic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1024330659 7:48151580-48151602 GAGGAGAACCACAGAGAAGTGGG - Intergenic
1024422748 7:49188575-49188597 GAGTAGGAGCTGAAAGAGGGAGG - Intergenic
1024429223 7:49266530-49266552 GAGGAGGAGGAAAGAGAGTTTGG + Intergenic
1025022244 7:55488946-55488968 GAGGAGGGCCACACAGAGTTTGG - Intronic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026849708 7:73717203-73717225 GAGGAGGAGGAGGAAGAGGGAGG + Intronic
1027184490 7:75962722-75962744 GAGGATGATTGCAAAGAGGTAGG - Intronic
1027572770 7:79891493-79891515 GAGGAGGAGGACGAAGAGGAGGG + Intergenic
1027903430 7:84148733-84148755 GAGGAGGATCAGGAAGAGGAGGG - Intronic
1028433527 7:90775652-90775674 GAGGAGGAGGAGAAAGGGGGAGG - Intronic
1029275759 7:99403480-99403502 GAAGAGGAGCAAAAAGAAGGTGG - Exonic
1029313176 7:99686551-99686573 GAGGTGGAGCCTAAAGAGGCAGG - Intronic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1030269132 7:107651929-107651951 GAGGTGGAGCCTACAGAGGTAGG + Intergenic
1030311130 7:108070496-108070518 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1031129770 7:117818712-117818734 GAGGAAGAGCAGAAAGAACTAGG + Intronic
1031649561 7:124270702-124270724 GAGGAGGAGGAAGAAGAGGAGGG + Intergenic
1031706336 7:124984938-124984960 GAGGTGGAGCCCACAGAGGCAGG + Intergenic
1031721431 7:125181428-125181450 GAGGTGGAGCCCACAGAGGCAGG + Intergenic
1032523129 7:132561358-132561380 GAGGAGGAGGACAAGAAGGAGGG - Intronic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1033104773 7:138511253-138511275 GAGCAGGAGCCAAAAGAGGGTGG + Intronic
1033339424 7:140480055-140480077 AAGCAGGAGCACCAAGAGGTAGG - Intergenic
1034021631 7:147650457-147650479 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1034412333 7:150947909-150947931 GGGGAGGAGAACAGAGAGGAGGG + Intronic
1034426485 7:151016783-151016805 GAGAGGGTGCACGAAGAGGTTGG + Exonic
1035775755 8:2186825-2186847 GAGGATGAGGACAAAGAGACAGG + Intergenic
1036450213 8:8859549-8859571 GAGGAGGAGGAAGAAGAGGAGGG - Intronic
1036813429 8:11883722-11883744 GAGGAGGAGAAGAAATAGGGGGG + Intergenic
1037046579 8:14312704-14312726 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
1037356606 8:18026685-18026707 GAGGAGGAGGAGAGAGAGGTAGG - Intronic
1037541757 8:19878858-19878880 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1037802371 8:22042761-22042783 GAGGAGGAGAGAAAAGAGGGAGG - Exonic
1037835833 8:22214244-22214266 GAGGAGGAACACTCAGAGGACGG + Intergenic
1037892674 8:22631745-22631767 AGGGAGGAGCACAGAGGGGTGGG - Intronic
1038336160 8:26647350-26647372 GGGGAGGAGCAGCAAGAGGTTGG - Intronic
1038366446 8:26940535-26940557 GAGGTGGAGCATACAGAGGCAGG + Intergenic
1038568519 8:28639571-28639593 GAGGGGAAGTATAAAGAGGTAGG - Intronic
1038679332 8:29652425-29652447 GAGGAAGAGAAGAAAGAGGAAGG + Intergenic
1039093508 8:33857799-33857821 GGGGAGGAGGGCAAAGAGGGAGG - Intergenic
1039096424 8:33891573-33891595 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1039436012 8:37559668-37559690 GAGGAGGAGGAAAAGGAGGAGGG + Intergenic
1039436263 8:37561367-37561389 GAGGGGGAGGAGAAAGAGGGTGG + Intergenic
1039503022 8:38031571-38031593 GGAGAGGAGCAAAAAGGGGTGGG - Intronic
1039986479 8:42452164-42452186 GAGGAGGAGGAGGAAGAGATAGG + Intronic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1041311109 8:56517503-56517525 GAGGAGGAGGGGAAAGAGGAGGG - Intergenic
1041312952 8:56535012-56535034 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1041353481 8:56973991-56974013 GAGGAGGAGGAGAAAGAGAAAGG - Intronic
1041602093 8:59731122-59731144 GAGGAGGAGGAGGAAGAGGTTGG - Intergenic
1041614954 8:59895631-59895653 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1042457235 8:69019534-69019556 GAGGTGGAGCCTACAGAGGTAGG - Intergenic
1043224451 8:77706429-77706451 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1043586833 8:81779629-81779651 GAGGAGGAGCAGATGTAGGTGGG + Intergenic
1044399985 8:91759263-91759285 GAGGAGGAGGAGAAAGATGAGGG + Intergenic
1044422558 8:92014724-92014746 GAGGAGGAGGAAGAAGAGGAAGG + Exonic
1044881968 8:96732377-96732399 GAGGAATAGCACGAAGCGGTAGG + Intronic
1045254160 8:100505722-100505744 GAGGAGGAGTAATCAGAGGTAGG - Intergenic
1045600213 8:103706880-103706902 GAGGAGGCTGACAAAGAGATTGG - Intronic
1045832144 8:106475411-106475433 GAGGAGGAGGAGGAAGAGGTGGG + Intronic
1046000129 8:108410436-108410458 GAGGAGGGGGAGGAAGAGGTGGG + Intronic
1046176255 8:110578770-110578792 GAGGAGGAGCAGAATAAAGTAGG - Intergenic
1046267833 8:111854542-111854564 GAGGAGGTAGACAAAGAGATAGG + Intergenic
1046647966 8:116806223-116806245 GAGGAGGTGCACAAAAAGAAGGG - Intronic
1046780561 8:118210292-118210314 GAACTAGAGCACAAAGAGGTTGG + Intronic
1047135961 8:122078733-122078755 GAGGAGGAGAAGAAAGAAGCAGG + Intergenic
1047299860 8:123604415-123604437 GAGGAGGAGAAGGAAGAGGAAGG + Intergenic
1048090697 8:131237237-131237259 GAGGTGGAGCCCACAGAGGCAGG + Intergenic
1048093164 8:131262625-131262647 GAGGTGGAGCCCACAGAGGCAGG - Intergenic
1048220096 8:132533183-132533205 GAGGAGGATGAGAAAGAGGAAGG + Intergenic
1048532177 8:135259630-135259652 GAGGTGGAGCCTAAAGAGGCAGG - Intergenic
1049121945 8:140747428-140747450 GAGGAGGAGAAGAAAGGGGGGGG + Intronic
1049121954 8:140747457-140747479 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1049647037 8:143740168-143740190 GAGGTGGAGCACCAGGAGGTGGG - Intergenic
1050090975 9:2016359-2016381 GAGGAGGCCCCCAAGGAGGTCGG + Intronic
1050266068 9:3891105-3891127 GAGGAGGAGGAGGAAAAGGTAGG + Intronic
1050319601 9:4437740-4437762 GAGGAAGAGGAGGAAGAGGTGGG - Intergenic
1050600110 9:7241982-7242004 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1050744193 9:8857928-8857950 GAGGAGGAGGAAAAGGGGGTAGG - Intronic
1050824729 9:9931743-9931765 GAGGTGGAGCCTACAGAGGTAGG - Intronic
1051038291 9:12775911-12775933 GAGGAGGACGACAAGGAGGGAGG - Exonic
1051183687 9:14437755-14437777 GAGCAGGAGAACACAGAGCTTGG - Intergenic
1051318093 9:15865506-15865528 GAGGAGGAGAAGGAAGAGGAGGG - Intronic
1052148175 9:25076418-25076440 GAGGTGGAGCCTACAGAGGTAGG + Intergenic
1052442040 9:28510499-28510521 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1052500643 9:29285195-29285217 GAGGAGGAGAAAGAAGAGGAGGG + Intergenic
1052918200 9:33939994-33940016 GAGGAGGAGGGGAAAGAGGAGGG + Intronic
1052988956 9:34507523-34507545 GAAGAGGAGGAGAAAGAGGAGGG + Intronic
1053001607 9:34579865-34579887 GAGGAGGAGGCCAGAGAGGGAGG - Intronic
1053700066 9:40681281-40681303 GAGGTGGAGCCTAAAGAGGCAGG + Intergenic
1053873045 9:42513776-42513798 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1053899707 9:42782144-42782166 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054261938 9:62875449-62875471 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1054269285 9:62952976-62952998 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054311358 9:63480679-63480701 GAGGTGGAGCCTAAAGAGGCAGG + Intergenic
1054410138 9:64804832-64804854 GAGGTGGAGCCTAAAGAGGCAGG + Intergenic
1054870329 9:70043243-70043265 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1054943929 9:70774236-70774258 GAGGAGGAGGAAGAAGAGGAGGG - Intronic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055379034 9:75685980-75686002 GAGGAGGAGGAGAAGGAGTTGGG + Intergenic
1055411476 9:76034501-76034523 GAGGAGGAGGAAGAAGAGGAGGG - Intronic
1055760767 9:79605014-79605036 GAGGAGGAGGAAGAAGAGGAGGG + Intronic
1056395903 9:86180859-86180881 GAGGAGTAACTCAAAGGGGTGGG - Intergenic
1056454952 9:86751161-86751183 GAGGAGGAGGATACAGAGGCTGG + Intergenic
1056464689 9:86842252-86842274 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1056679165 9:88702019-88702041 GAACAGGAGCAGAAAGGGGTGGG - Intergenic
1057036929 9:91817839-91817861 GAGGAGGAGGGGAAAGAGGGAGG + Intronic
1057059420 9:91990229-91990251 GAGGAGGAGGAAGAAGAGGAAGG + Intergenic
1057435500 9:95036648-95036670 GAGGAGGAGGAAGAAGAGGAGGG - Intronic
1057638886 9:96797534-96797556 GAGGTGGAGCATACAGAGGCAGG - Intergenic
1057791849 9:98129896-98129918 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1058556661 9:106175926-106175948 GTGGAGGAGCCCAAAGACATAGG - Intergenic
1058593636 9:106591570-106591592 GGGGAGGAGCAGCAGGAGGTGGG + Intergenic
1058645384 9:107127207-107127229 GAGGAAGAACACAAAGACATTGG + Intergenic
1059431532 9:114253414-114253436 GAAGAGGAGAAAAAAGAGGAGGG + Intronic
1059449196 9:114359711-114359733 GAGGAGGAGGAGGAAGAGGGGGG - Exonic
1060283538 9:122229027-122229049 GGGGAGGAGGACAAGGAGGAGGG - Intronic
1060504693 9:124188951-124188973 GGGGAGGTGCCCTAAGAGGTGGG - Intergenic
1061559569 9:131394014-131394036 GAGGAGGAGGACGAGGAGGCGGG + Intergenic
1061666673 9:132164021-132164043 GAGGAGGAGCGCAGAGAGTGAGG - Intronic
1185499289 X:584911-584933 GAGGAGGGGAAGGAAGAGGTTGG + Intergenic
1185701222 X:2231875-2231897 GAGGAGGAGGAGGAAGAAGTTGG - Intronic
1185830051 X:3292838-3292860 GAGGAGGAGTAAAAAGAAGAGGG + Intergenic
1186040014 X:5465599-5465621 GAGGAGGAGGAAGAAGAGGAGGG - Intergenic
1186125547 X:6409943-6409965 CATGAGGAGGAGAAAGAGGTAGG + Intergenic
1186451704 X:9679548-9679570 GGGCAGGAGAACAAAGAGCTTGG - Intronic
1186643765 X:11484348-11484370 GAGGAGGAGGAAGAAGAGGAAGG + Intronic
1186645430 X:11501838-11501860 GAGAAGGAGCAGGAAGAGGAGGG + Intronic
1186998466 X:15149489-15149511 GAGAAGGGGCAAAAAGTGGTAGG - Intergenic
1187025826 X:15434366-15434388 GAGGAGGAGAAAAAAGAAGGAGG + Intronic
1188159572 X:26783582-26783604 GTAGAGGAGCACAAAAAGGGAGG + Intergenic
1188505073 X:30873624-30873646 GAGGAGGTGGAGGAAGAGGTGGG - Intronic
1188660947 X:32757950-32757972 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1188940808 X:36235218-36235240 GAGGTGGAGCATACAGAGGCAGG + Intronic
1189185844 X:39054047-39054069 GAGGGGCAGCTTAAAGAGGTTGG + Intergenic
1189332982 X:40154423-40154445 GGGGAGGAGAACAAAGGGGGAGG - Intronic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190073838 X:47300976-47300998 GAGGAGGAGGAAAAAGGGGAAGG + Intergenic
1190795036 X:53733053-53733075 GAGGAGGAGGAAGAAGAGGGGGG - Intergenic
1190981343 X:55458952-55458974 GAGGGAGAGCACACAGAGGAGGG + Intergenic
1190987355 X:55514228-55514250 GAGGGAGAGCACACAGAGGAGGG - Intergenic
1191109211 X:56791939-56791961 GAGGAGGAGGACGAAGAAGAAGG - Intergenic
1191157971 X:57295998-57296020 GAGGTGGAGCCCACAGAGGCAGG - Intronic
1192114939 X:68400956-68400978 GAGCAGGGGCAAGAAGAGGTGGG + Intronic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1192363988 X:70455749-70455771 GAGGAGGAGGCGAAAGAAGTCGG - Intronic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1192719441 X:73677328-73677350 GAGGTGGAGCCCACAGAGGCAGG + Intronic
1193366048 X:80635700-80635722 GAGGAGGTAGAGAAAGAGGTAGG - Intergenic
1193620857 X:83751028-83751050 GAGGTGGAGCCTACAGAGGTAGG - Intergenic
1193860900 X:86666199-86666221 GAAGAGGAGTAAACAGAGGTTGG - Intronic
1194284817 X:91996626-91996648 GAAGAGGAGAAGGAAGAGGTGGG - Intronic
1195061140 X:101196018-101196040 GTGAGGGAGCAGAAAGAGGTGGG - Intergenic
1195416713 X:104628320-104628342 GAGGGGGAACAGAGAGAGGTTGG - Intronic
1195421346 X:104678539-104678561 GAGGAAGAGCTCAAAGAGCTGGG - Intronic
1195570245 X:106392493-106392515 GAGGAGGAGGAGGAAGAGGGAGG - Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196109528 X:111930999-111931021 GAGGAGGAGGACAGGGAGGAAGG + Intronic
1196148339 X:112344489-112344511 AAGGAAGAGCACAAAGGGGGAGG + Intergenic
1196481918 X:116159728-116159750 GAGGTGGAGCCTACAGAGGTAGG - Intergenic
1196615481 X:117762777-117762799 GAGGAGGAGCCTACAGAGGCAGG + Intergenic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1197008902 X:121536808-121536830 GAGGTGGAGCATACAGAGGCAGG + Intergenic
1197436505 X:126434832-126434854 GAGGAGGAGGAGATAGAGGAGGG + Intergenic
1197457601 X:126697206-126697228 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1198483251 X:137060500-137060522 GAGGAGGAGGAGAAAGAAGAGGG - Intergenic
1198631261 X:138641318-138641340 GAGGAGAAGAAGAGAGAGGTGGG - Intronic
1198702397 X:139412380-139412402 GAGGAGGTGGAGAAAGAGATAGG - Intergenic
1198719116 X:139596067-139596089 GAGGAGGAACACAGAAAGGAAGG + Intronic
1198832432 X:140764808-140764830 GAGGAGGAGGTCGCAGAGGTGGG - Intergenic
1199288352 X:146078504-146078526 GAGGAGGGACACAAGGGGGTAGG + Intergenic
1199386961 X:147233919-147233941 AATGAGGATCACAAAGAGGCAGG + Intergenic
1199896900 X:152135454-152135476 GAGGAGGAGGGAAAAGAGGATGG + Exonic
1200239883 X:154487849-154487871 CAGGAGGAGCACAAAGCTGAAGG + Exonic
1200460053 Y:3444078-3444100 GAGGTGGAGCCTACAGAGGTAGG - Intergenic
1200602384 Y:5221196-5221218 GAAGAGGAGAAGGAAGAGGTGGG - Intronic
1201247911 Y:12024662-12024684 GAGGAGGAGTAAAAAGAGGAGGG - Intergenic
1201312742 Y:12611861-12611883 GAGGACGAGCAGAAAGAGGGTGG + Intergenic
1201890807 Y:18941900-18941922 GAGGAGGAGAATGAAGAGGAGGG - Intergenic