ID: 1170841613

View in Genome Browser
Species Human (GRCh38)
Location 20:19928765-19928787
Sequence CACAAGAGGGAGAGGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1124
Summary {0: 1, 1: 2, 2: 6, 3: 110, 4: 1005}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170841613_1170841620 5 Left 1170841613 20:19928765-19928787 CCTGCCTTCCTCTCCCTCTTGTG 0: 1
1: 2
2: 6
3: 110
4: 1005
Right 1170841620 20:19928793-19928815 CAGCACCCCCTCTTCTTCCCTGG 0: 1
1: 0
2: 3
3: 69
4: 527
1170841613_1170841625 20 Left 1170841613 20:19928765-19928787 CCTGCCTTCCTCTCCCTCTTGTG 0: 1
1: 2
2: 6
3: 110
4: 1005
Right 1170841625 20:19928808-19928830 TTCCCTGGAAGTCCCCAGCCAGG 0: 1
1: 0
2: 0
3: 26
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170841613 Original CRISPR CACAAGAGGGAGAGGAAGGC AGG (reversed) Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900526832 1:3133477-3133499 CACGATGGGGAGAGGAGGGCAGG + Intronic
900610482 1:3542522-3542544 AAGAGGAGGCAGAGGAAGGCAGG + Intronic
900714732 1:4137008-4137030 CAAGAGAGGGAGAGGATGGAAGG - Intergenic
901104207 1:6742919-6742941 CACAGGAGAAAGACGAAGGCTGG + Intergenic
901118327 1:6867502-6867524 CAGGAGAGGGAGAGAAAGGGAGG + Intronic
901336529 1:8454091-8454113 CACCAGAGTGGGAGGAAGGATGG - Intronic
901401271 1:9016638-9016660 AAGAAGAGAGAGAGGAAGGAAGG + Intronic
901496346 1:9624538-9624560 AAGAAGAGGGAGAGGAGGGAGGG - Intergenic
901647559 1:10724772-10724794 AAGAGGAGGCAGAGGAAGGCAGG + Intronic
902018490 1:13327661-13327683 CATGAGAGGGAGAGGGAGACGGG - Intergenic
902179907 1:14679974-14679996 GACAAGAGGGAGAAGGTGGCTGG + Intronic
902655776 1:17867039-17867061 CACAGGAGGCAGAAGAAGGCTGG - Intergenic
902777712 1:18685212-18685234 CAATAAAGGGAGGGGAAGGCAGG - Intronic
902885186 1:19399672-19399694 CAAGAGTGGGAGAGGAAGTCTGG + Intronic
903034693 1:20486156-20486178 CAGAGGGGGGAGAGGGAGGCAGG + Exonic
903335188 1:22619854-22619876 TGCCAGAGGGAGAGGAAGGAAGG + Intergenic
903342000 1:22660540-22660562 CACAAGCTGGGGAGGAGGGCCGG + Intronic
903363347 1:22790887-22790909 GACAAGAGGGAGAGGCTGGGAGG - Intronic
903638146 1:24834793-24834815 CATGAGAGGGAGAGGGAGACGGG + Intronic
903858950 1:26353872-26353894 AAAGGGAGGGAGAGGAAGGCAGG + Intronic
904364481 1:30001743-30001765 CACAGGAGGGAGAGAGGGGCAGG - Intergenic
904640502 1:31923628-31923650 CTCAAGAGGTTGAGGCAGGCTGG - Intronic
904696446 1:32334437-32334459 CACAGGAGGGAGAGGAGGAAAGG + Exonic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904881087 1:33697614-33697636 AACAGGAGGGAGAGGAAGGGAGG - Intronic
905636706 1:39558800-39558822 CACAGGGAGGAGAGGAAGGGAGG + Intergenic
905798534 1:40829183-40829205 TCCAAGAGGGAGAGGAAGAGAGG - Intronic
906819698 1:48916389-48916411 CACAGGGAGGAGAGGGAGGCGGG + Intronic
906909425 1:49931476-49931498 CAGAAGAGAGAGAGCAAGACGGG + Intronic
907082412 1:51636130-51636152 CAAGAGAGAGAGAGGAAGGAAGG - Intronic
907110634 1:51923347-51923369 CAGGAGAGGGAGAGGCTGGCAGG + Intronic
907243638 1:53093897-53093919 AGCAGGAGGGAGAGGCAGGCAGG - Intronic
907394136 1:54177885-54177907 CAGAGGAGGGAAAGCAAGGCTGG + Intronic
907466306 1:54640090-54640112 GACAAGATGGACAGGCAGGCAGG + Intergenic
907492470 1:54816965-54816987 TGCAACAGGGAGAGGATGGCAGG - Intronic
907509887 1:54950267-54950289 AGCAAGAGGGAGAGAAAGGGAGG + Intergenic
907776708 1:57522853-57522875 CACCAGAGAAAGATGAAGGCCGG - Intronic
907865897 1:58398754-58398776 GACAGGAAGCAGAGGAAGGCTGG + Intronic
908238418 1:62169131-62169153 CACCAGAGGGGGCGGGAGGCTGG - Intergenic
908832009 1:68188698-68188720 CAAGAGAGGAAGAGGCAGGCAGG + Intronic
908878495 1:68704247-68704269 GACAAGAGGAAGATGAAGCCTGG + Intergenic
909196776 1:72636732-72636754 CAAAAGAGAGAGAGAAAGGCAGG - Intergenic
909209475 1:72805803-72805825 CACAAGAGAAAGATGAAGGTTGG - Intergenic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
909742848 1:79054204-79054226 AAAAAGAGGAAGAGGAAGACTGG + Intergenic
910120211 1:83779841-83779863 CAAGAGAGGGAGAGGGAGACAGG + Intergenic
910672132 1:89784060-89784082 CTCAGGAGGCAGAGGAAGGATGG + Intronic
911115263 1:94239487-94239509 CACAAGGAGGAGAGAAAAGCAGG + Intronic
911401367 1:97379251-97379273 GACAATGGGGAGAGGCAGGCAGG + Intronic
911478436 1:98403737-98403759 AGCAACAGGGAGAGGAAGGTAGG - Intergenic
911700995 1:100951648-100951670 CACAACATGGAGAGGATTGCAGG - Intronic
911735718 1:101334625-101334647 CAGAAGGGGGAGAGGGAGGGAGG - Intergenic
911890771 1:103368888-103368910 TGCAAGAGGGAGAGGAAGGGAGG + Intergenic
912480369 1:109978189-109978211 CCAGAGAGGGTGAGGAAGGCAGG + Intergenic
912654056 1:111469789-111469811 CACAAGAAGGAGAGGAGAACTGG + Intergenic
913211252 1:116584606-116584628 CACCAGAGGGAGTGGAAGCTTGG + Intronic
913535678 1:119769782-119769804 CACAAAAGGTAGAGGAAGATTGG - Intergenic
915364908 1:155309660-155309682 CACAAGAGGGAGGGGCACTCTGG + Intronic
915971919 1:160361080-160361102 CACAATAGGCAGAGGCAGGCTGG - Intergenic
916069442 1:161161292-161161314 CAGAAAAGGCAGAGGATGGCAGG - Intronic
916084354 1:161257982-161258004 CACAAGAGAGGGAGGAAGGCTGG - Intergenic
916210523 1:162356413-162356435 CACCAGAGGCAGTGGAGGGCAGG + Intronic
916298793 1:163250209-163250231 CATTAGAGAGAGAGGAAGACTGG + Intronic
916404887 1:164488599-164488621 CACAAGAGAAAGATGTAGGCTGG + Intergenic
916745608 1:167682762-167682784 CACAAGAGCCAGGGAAAGGCAGG + Intronic
916758483 1:167795894-167795916 AACAACTGGGAGTGGAAGGCAGG + Intergenic
917130505 1:171737265-171737287 GACAAGAAGGAAAGGAAGGAGGG + Intronic
917431014 1:174969137-174969159 CGCAAGTGGCACAGGAAGGCAGG - Intronic
917817568 1:178725724-178725746 CCCAAGAGGGAGAGCGAGGCGGG - Intronic
918251951 1:182710693-182710715 CACAAGAGGAGGAGGGATGCAGG + Intergenic
918911820 1:190582668-190582690 CACAGGAGAAAGATGAAGGCTGG + Intergenic
919074594 1:192798047-192798069 AACAAGAGGGAGAGGGAGGGAGG - Intergenic
919624345 1:199896552-199896574 CACAAAAGGGAGGAAAAGGCTGG - Intergenic
920035828 1:203064809-203064831 CACAAGTGAGAGAAGCAGGCTGG - Intronic
920062470 1:203237053-203237075 CACAAGGCTGAGAGGTAGGCGGG - Intronic
920175988 1:204102299-204102321 CCCCAGAGGGAGAGGAAGGTGGG - Intronic
920182046 1:204138020-204138042 GACAAGAAGAAGAGGAAGGAGGG - Intronic
920311967 1:205053927-205053949 GAGGAGAGGCAGAGGAAGGCTGG + Intronic
920452608 1:206071245-206071267 CACGAGAGAAAGATGAAGGCCGG + Intronic
920702802 1:208230643-208230665 CACTAGAGAGAAAGAAAGGCAGG - Intronic
921335772 1:214084352-214084374 CACAGGAGGAAGATGTAGGCTGG - Intergenic
921575640 1:216831539-216831561 AGAAAGAGGGAGAGGAAGGGAGG + Intronic
921672508 1:217941880-217941902 TCCGAGAGGGAGAGGAGGGCTGG + Intergenic
921820197 1:219608448-219608470 ATCAGGAGGAAGAGGAAGGCAGG - Intergenic
922019059 1:221685460-221685482 CACAGGAGAAAGATGAAGGCTGG + Intergenic
922580670 1:226695596-226695618 GAGAAGAGAGAGAGGATGGCGGG - Intronic
922753008 1:228079735-228079757 CCCAAGAGGGAGGGCAGGGCTGG + Intergenic
922979793 1:229816126-229816148 CACAAGGGGGTGGGGAAGGGTGG - Intergenic
923432944 1:233941166-233941188 TACAAAAATGAGAGGAAGGCAGG - Intronic
923957569 1:239040262-239040284 CACAGGAGAAAGATGAAGGCCGG - Intergenic
924823425 1:247516044-247516066 CAAAAATGGCAGAGGAAGGCAGG + Intronic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1062902193 10:1154806-1154828 CAGAAGAGGCAGAGGGAGACTGG - Intergenic
1063665877 10:8060304-8060326 GGCAGGAGGGAGAGGGAGGCAGG + Intronic
1063706568 10:8436575-8436597 CAAAAAATGGAGAGGAAAGCAGG - Intergenic
1063976681 10:11423375-11423397 GAGAAGGGGGAGAGGAAGGCTGG - Intergenic
1064363658 10:14688120-14688142 CACAGGAGAGAAACGAAGGCTGG - Intronic
1065070143 10:22015005-22015027 CAGTGCAGGGAGAGGAAGGCTGG - Intergenic
1065638316 10:27753307-27753329 GAAAAGAGAGAGAGGAAGGAAGG - Intergenic
1065813710 10:29465275-29465297 AACAAGACTGAGAGGAAGGCTGG + Intronic
1065957947 10:30709700-30709722 AACAAGACTGAGAGGAAGGCTGG - Intergenic
1066085156 10:31969107-31969129 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1066223792 10:33361550-33361572 CACAAGATAGAGAGGAAGCTTGG - Intergenic
1066290900 10:34013633-34013655 AGAAAGAGGGAGAGGAAGGAAGG - Intergenic
1066335415 10:34472618-34472640 CAGAAGAGGGAGAGAAATGGAGG - Intronic
1066582054 10:36891679-36891701 CACAGGATGGAGGGGCAGGCAGG - Intergenic
1067251286 10:44589085-44589107 AACAAGGGGGAGAGAAGGGCAGG - Intergenic
1067514652 10:46927847-46927869 CAAGAGAGGGAGAGGAACGTAGG + Intronic
1067554372 10:47257995-47258017 CACAGAAGAAAGAGGAAGGCTGG + Intergenic
1067647608 10:48123966-48123988 CAAGAGAGGGAGAGGAACGTAGG - Intergenic
1068207686 10:53877634-53877656 CAGAAGAGGGACAGCAAGGTGGG - Intronic
1068278072 10:54829053-54829075 GACAAGAGGGAGAGGAAATTAGG + Intronic
1068715583 10:60184211-60184233 GAGAAGAGGGAAAGGTAGGCAGG + Intronic
1068832148 10:61507589-61507611 CAGAAGAGGTAGTGGGAGGCAGG + Intergenic
1068915435 10:62426618-62426640 GACAGGAGCAAGAGGAAGGCAGG + Intronic
1069250947 10:66266068-66266090 GAAAAGAGAGAGAGGAAGGGGGG + Intronic
1069598755 10:69689542-69689564 GACAAGAGGCAGGGGAAGGCAGG + Intronic
1069914415 10:71778532-71778554 CCCATGAAGGAGAGGAGGGCAGG - Intronic
1070307744 10:75249690-75249712 CAAGAAAAGGAGAGGAAGGCTGG - Intergenic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1070657796 10:78283128-78283150 CACAAGAAGGACAGCAGGGCAGG + Intergenic
1070659203 10:78292905-78292927 GACAAGAGGGTGAGGAGGGCAGG - Intergenic
1070661795 10:78311777-78311799 GAAAAGAGAGAGAGGAAGGAAGG - Intergenic
1070694039 10:78548618-78548640 AAAAAGAGAGAGAGGAAGGGAGG + Intergenic
1070900505 10:80023965-80023987 CAAAAGAGGAGGAGGAAGGGAGG + Intergenic
1070902252 10:80039846-80039868 CAAAAGAGGAGGAGGAAGGGAGG + Intergenic
1071032712 10:81204226-81204248 CACAAGAGAAAGATGGAGGCCGG - Intergenic
1071415308 10:85435926-85435948 CCAAAGAGGGAGATGCAGGCTGG - Intergenic
1071499204 10:86191575-86191597 CACAGGAGGAGGAGGAAGCCAGG + Intronic
1071515240 10:86292606-86292628 CTGAAGAGAGGGAGGAAGGCAGG - Intronic
1071904825 10:90161299-90161321 CTCAAGATCAAGAGGAAGGCTGG - Intergenic
1072047315 10:91669937-91669959 CAAAAGTGGGAGAGGGAGGGAGG + Intergenic
1072442806 10:95471768-95471790 GACAGGAGGAAGTGGAAGGCAGG + Intronic
1072458467 10:95598024-95598046 AAAAAGAGAGAGAGGAAGGAAGG - Intergenic
1072614091 10:97038068-97038090 CAGAGCAGGGAGGGGAAGGCAGG - Intronic
1072832649 10:98675457-98675479 CACAGGAGGGAGGCCAAGGCGGG + Intronic
1073036674 10:100568660-100568682 CACTAGAGGGAGAGCTTGGCTGG - Intergenic
1073268876 10:102244994-102245016 GACAAGAGGGCGAGGAGAGCAGG + Intergenic
1073362474 10:102910796-102910818 CACAGGAGAAAGAGGTAGGCTGG - Intergenic
1073393410 10:103198067-103198089 AAAGAGAGGGAGAGGAAGGAAGG + Intergenic
1073545816 10:104347942-104347964 CAGGAGAGGCAGAGAAAGGCAGG - Intergenic
1073695302 10:105859927-105859949 CACAGGAGAAAGAGGTAGGCTGG - Intergenic
1074233518 10:111561811-111561833 CACCAGAGGAGGAGGAAGGTGGG - Intergenic
1074247782 10:111712681-111712703 CATAATGGAGAGAGGAAGGCAGG + Intergenic
1074423258 10:113328060-113328082 CATAAGGGGGAGAGGAAGGTGGG - Intergenic
1074531157 10:114299823-114299845 CACAGGAGAAAGATGAAGGCTGG - Intronic
1074602697 10:114931396-114931418 CACAGGAGAAAGATGAAGGCTGG - Intergenic
1074792754 10:116907711-116907733 CAGCGGAGGGAGGGGAAGGCAGG + Intronic
1074853753 10:117458327-117458349 CACAGGAGGGATGGGCAGGCTGG - Intergenic
1074982516 10:118631149-118631171 CACAAGAGAAAGATGTAGGCTGG + Intergenic
1075413175 10:122244121-122244143 CACCAGGATGAGAGGAAGGCAGG - Intronic
1075484740 10:122812980-122813002 CACAAGAAGGAATGGAGGGCTGG + Intergenic
1075874875 10:125797953-125797975 CACACAAGGGAGAGCAGGGCTGG - Intronic
1076574192 10:131453167-131453189 CACATTTAGGAGAGGAAGGCTGG + Intergenic
1076743825 10:132502640-132502662 CAGAGGAGGGAGAGCAAGGCTGG - Intergenic
1077459410 11:2701067-2701089 CACAGGAGGAAGGGGGAGGCTGG + Intronic
1078163403 11:8862022-8862044 CACAGAAGGGGGAGGAAGGGAGG + Intronic
1078276367 11:9851727-9851749 CAAAGGAGTGAGCGGAAGGCAGG - Intronic
1078421911 11:11219478-11219500 CACCAGAGGAATAGGAAGCCGGG - Intergenic
1078570143 11:12450805-12450827 CACAGGAGAAAGATGAAGGCCGG + Intronic
1078622652 11:12923235-12923257 AGCAAGAGAGAGAGGATGGCAGG - Intronic
1078894348 11:15584815-15584837 AACATGAGGGAGAAGAAGGCAGG + Intergenic
1079210191 11:18454458-18454480 CACAGGAGAAAGATGAAGGCTGG + Intergenic
1079320507 11:19447948-19447970 CAGAGGAGAGAGAGGAAGGTGGG - Intronic
1079446977 11:20566470-20566492 CACAGGAGAAAGATGAAGGCCGG - Intergenic
1079447899 11:20572976-20572998 CACAGGAGAAAGATGAAGGCCGG + Intergenic
1079473494 11:20803906-20803928 CACAAGAGAAAGATGTAGGCTGG - Intronic
1080146363 11:28989290-28989312 CACAGGAGAAAGATGAAGGCCGG - Intergenic
1080224543 11:29945585-29945607 CACAGGAGAAAGATGAAGGCTGG - Intergenic
1080928691 11:36784912-36784934 AAAAAGAGGGGAAGGAAGGCAGG - Intergenic
1081048431 11:38306599-38306621 GAAAAGAGAGAGAGGAAGGAAGG - Intergenic
1081401586 11:42649198-42649220 GAAAAGAGGGGGAGGGAGGCTGG - Intergenic
1081601962 11:44501466-44501488 CTCAAGATGGACATGAAGGCTGG - Intergenic
1082819846 11:57537503-57537525 TGGAAGAGGGAGAGGAAGGGGGG + Intergenic
1083378285 11:62243876-62243898 TTGAACAGGGAGAGGAAGGCAGG + Intronic
1083592092 11:63901829-63901851 CACCAGAGGGAGAGCAGGGCAGG - Intronic
1083662396 11:64257703-64257725 TAAGAGAGGGAGAGCAAGGCAGG + Intronic
1083776997 11:64898881-64898903 CCCAAGAGGGAGGGAAGGGCTGG + Intronic
1083871260 11:65489841-65489863 CAGAGTAGGGAAAGGAAGGCCGG - Intergenic
1084644331 11:70445882-70445904 CAGCAGAGGGAGGGGAAAGCTGG + Intergenic
1084715914 11:70873279-70873301 CCCATGAGGAAGAGGAGGGCAGG + Intronic
1085129121 11:74022752-74022774 CACAAGAGGGAAGAGAAAGCAGG + Intronic
1085241797 11:75062638-75062660 AGCAAGAGAGAGAGCAAGGCAGG - Intergenic
1085284780 11:75352341-75352363 CACAACAGGGACAGGAAGAAGGG + Intergenic
1085482339 11:76833115-76833137 GACAAGACAGAGAGGAGGGCTGG - Intergenic
1085646187 11:78224522-78224544 AGCAAGAGTTAGAGGAAGGCTGG - Intronic
1085685214 11:78615416-78615438 CACAGGAGAAAGAGGAAGGCCGG + Intergenic
1086168250 11:83805574-83805596 GACAAAAGGGAGAGGGAGGATGG - Intronic
1086641074 11:89156434-89156456 CACAGGAGAAAGAGGTAGGCTGG + Intergenic
1086967051 11:93039811-93039833 CACAGGAGAAAGATGAAGGCTGG - Intergenic
1087529950 11:99367714-99367736 CACAAGAGAAAGAGGGAGGTAGG + Intronic
1088049883 11:105498995-105499017 CACAGGAGAAAGATGAAGGCTGG + Intergenic
1088192123 11:107237987-107238009 CACAAGAGAAAGATGTAGGCTGG + Intergenic
1088517860 11:110657909-110657931 AAAAAGAGAGAGAGGAAGGAAGG + Intronic
1088730508 11:112677531-112677553 CACAGGAGGAAGATGTAGGCTGG + Intergenic
1088773716 11:113061540-113061562 CAGAAGAGGGAAAGGAATACTGG + Intronic
1088804846 11:113342869-113342891 TACAGGAGGGCGAGGAAGGCAGG + Intronic
1088813146 11:113404919-113404941 GGCAAGAAGGAGAGGAAGGAGGG + Intergenic
1089290279 11:117433480-117433502 CAGTAGAGGGAGAGGAGGGCTGG + Intronic
1089399546 11:118156547-118156569 AAGAGGAGGGAGAGGGAGGCAGG - Intergenic
1089602100 11:119622633-119622655 CACAAGAGAGAGGGGATGGCTGG + Intergenic
1089895918 11:121929879-121929901 CTTAAGAAGGAGGGGAAGGCGGG + Intergenic
1089938647 11:122392694-122392716 AAGAAGTGGGAGAGGCAGGCGGG - Intergenic
1090196953 11:124824737-124824759 CACAGGAGAAAGATGAAGGCCGG + Intergenic
1090205279 11:124880389-124880411 CACAAGAGGGAAGGGTAGCCAGG - Intronic
1090481244 11:127070593-127070615 CACAAGAGAAAGATGAAGGCTGG + Intergenic
1090548979 11:127797929-127797951 CACCAGAGAGTGAGCAAGGCAGG - Intergenic
1091022858 11:132116416-132116438 AGCCAGAGGGAGAGGAAGCCTGG + Intronic
1091041502 11:132285281-132285303 CACAGGGTGGAGAGGAAGGCTGG - Intronic
1091170509 11:133516137-133516159 CCGCAGAGGGAGAGCAAGGCTGG + Intronic
1091209120 11:133841875-133841897 CAGTAGTGGGAGAGGAGGGCTGG - Intronic
1091229878 11:133981377-133981399 CAGGAGAGGGAGAGGCAGGAAGG + Intergenic
1091288233 11:134421073-134421095 CACCAGAGGGAGAGGCAGGGAGG - Intergenic
1091378405 12:41281-41303 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1091731973 12:2887715-2887737 CACATGAGGAAGCTGAAGGCCGG + Intronic
1092272103 12:7031386-7031408 CACAGGAGGGAGACCAAGGTGGG - Intronic
1092575540 12:9778569-9778591 CACAGGAGGAAGATGAAGGCCGG - Intergenic
1093164582 12:15789884-15789906 CAGAGGAGGAAGACGAAGGCTGG - Intronic
1093170911 12:15859376-15859398 CACAAGAGAGAGAAGAAGCACGG + Intronic
1093307899 12:17542032-17542054 AAAAAGAGAGAAAGGAAGGCAGG - Intergenic
1093385638 12:18549876-18549898 CACAAAAGGAAAAGGAAGGAAGG - Intronic
1093516329 12:19990808-19990830 CTTAAGAGGGAGAGGGAGGCAGG + Intergenic
1095396840 12:41771636-41771658 CACCAGAGGGATTGGAAGGTGGG + Intergenic
1095443373 12:42260194-42260216 AAGAAGAGAGAGAGGAAGGAAGG + Intronic
1095721478 12:45406073-45406095 CAAAGGCGGGAGAGGAAGGAAGG - Intronic
1096031303 12:48417730-48417752 TACTAGAGGGAGAGGGAGGGAGG - Intergenic
1096217051 12:49803582-49803604 CACAAGAGGAAGAGGCTGGATGG - Intronic
1096263050 12:50104772-50104794 AAGAACAGGGAGAGGAAGGGAGG + Intronic
1096269955 12:50157116-50157138 CACAAGAGAAAGATGTAGGCTGG - Intronic
1096696118 12:53349743-53349765 CTCAAGAGGCTGAGGTAGGCCGG + Intergenic
1096810111 12:54164011-54164033 CAAGAGAAGGGGAGGAAGGCAGG + Intergenic
1096836732 12:54355896-54355918 GACAAGGGAGAGAGGAAAGCTGG - Intergenic
1096841776 12:54384390-54384412 CACAAGAGGATGGAGAAGGCAGG + Intronic
1097145514 12:56936903-56936925 AACAAGAGGGAGGAGGAGGCAGG - Intergenic
1097915281 12:65014486-65014508 CAAAAGAGAGAAAGAAAGGCAGG + Intergenic
1098122549 12:67257061-67257083 CAGAAGAGGCAGAGGAAGGTTGG - Intergenic
1098488406 12:71047657-71047679 CACAGGAGGGAGGGCAGGGCAGG + Exonic
1098806047 12:75020948-75020970 CACAAGAGAAAGATGTAGGCTGG - Intergenic
1098831582 12:75371296-75371318 CACACGAGAAAGATGAAGGCTGG + Intronic
1100339589 12:93665684-93665706 GAGTAGGGGGAGAGGAAGGCTGG - Intergenic
1100368915 12:93947218-93947240 CATAAGGGGGAGAGGAGGGATGG - Intergenic
1100570924 12:95842348-95842370 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1100822483 12:98444344-98444366 TCCAAGAGGGAGAGGCTGGCTGG + Intergenic
1100899847 12:99225642-99225664 CACAGGAGACAGATGAAGGCCGG - Intronic
1101376719 12:104177798-104177820 CAGAAGAGGCACAGGGAGGCAGG - Intergenic
1101387119 12:104267838-104267860 AAAAAGAGAGAGAGGAAGGAAGG - Intronic
1101451220 12:104780790-104780812 CACCAGAGAGTGAGCAAGGCAGG + Intergenic
1101509279 12:105378321-105378343 CACAATAGCCAGAGGAAGACTGG + Intronic
1102050815 12:109860807-109860829 CAAAAGAGGGAGAGGAGGAGAGG - Intronic
1102177459 12:110886652-110886674 CACAAGTGGGAGATAAAGGGTGG - Intronic
1102548563 12:113674274-113674296 CAGAAAAGAGAGAGGAAGGAAGG - Intergenic
1102560975 12:113762244-113762266 CACAAGCGGGAGAGAGAAGCAGG - Intergenic
1102974217 12:117194845-117194867 GAAAAGAGAGAGAGGAAGGAAGG - Intergenic
1103003994 12:117407444-117407466 CAGAGGAGGGAGAGGCAGGTGGG - Intronic
1103135009 12:118499459-118499481 GAAAAGAAGGAGAGGAAGGAAGG - Intergenic
1103283426 12:119779731-119779753 CACATAAGAGGGAGGAAGGCAGG + Intronic
1103954340 12:124567898-124567920 GAGAAGAGGGAGGGGAAGGCTGG - Intergenic
1104062198 12:125277978-125278000 CACAACTGGGAGAAGCAGGCTGG - Intronic
1104185088 12:126422812-126422834 CACAGGAGAAAGATGAAGGCCGG + Intergenic
1104608436 12:130206743-130206765 CGTAATAGAGAGAGGAAGGCAGG + Intergenic
1105069429 12:133225760-133225782 CAGAAGAGGGGGAGGGTGGCAGG + Intronic
1105863165 13:24434949-24434971 CACAATAGGGTGAAGAAGGTGGG + Exonic
1105947418 13:25201828-25201850 CACAAGACTGAGAGGAAGGGTGG - Intergenic
1105974155 13:25458634-25458656 CAGAAGGTGGAGTGGAAGGCAGG + Intronic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1107672930 13:42765115-42765137 CATTAGATGGAGTGGAAGGCTGG + Intergenic
1107833343 13:44393684-44393706 CAAAAGAGGGAAAGGAAGCGGGG - Intronic
1107908416 13:45083071-45083093 CAACAGAGGGAGAAGAAGCCAGG - Intergenic
1108834401 13:54523293-54523315 GAGAAAAGGGAGAGGAAGGCAGG - Intergenic
1109140242 13:58705647-58705669 AAAAAGAAGGAGAGGAAGGGAGG - Intergenic
1109273450 13:60279532-60279554 CACAATGGGGAGAGGAGGACAGG - Intergenic
1109609905 13:64751120-64751142 CACAGGAGAAAGAGGTAGGCTGG + Intergenic
1109713123 13:66184574-66184596 CACAGGAGAAAGATGAAGGCTGG + Intergenic
1110356503 13:74573802-74573824 CACCAGCGGGAGAAGAAAGCAGG - Intergenic
1110505433 13:76280460-76280482 CAAAAGAGGGAGAGAAAGAGGGG + Intergenic
1110760166 13:79222509-79222531 CACAGGAGAAAGATGAAGGCCGG + Intergenic
1111275006 13:85936564-85936586 GAAAAGAAGGAGAGGAAGGAAGG - Intergenic
1111384972 13:87513384-87513406 CAAAAAGGGGAGAGGATGGCAGG + Intergenic
1111440605 13:88279326-88279348 CACAGGAGAAAGATGAAGGCTGG - Intergenic
1111695789 13:91622034-91622056 CACAGGAGAAAGATGAAGGCTGG + Intronic
1112142501 13:96660957-96660979 CACAAAAGAAAGATGAAGGCTGG - Intronic
1112376967 13:98851606-98851628 CACAAGAAGGACAGCAAGGAGGG + Intronic
1112382575 13:98906183-98906205 CGCAAGGCTGAGAGGAAGGCTGG + Intronic
1112440500 13:99421438-99421460 CACATGAGGAAGAGCAAGGTGGG - Intergenic
1112524706 13:100133868-100133890 CACAAGAGAAAGATGAAGGCCGG - Intronic
1112687668 13:101850039-101850061 TGAGAGAGGGAGAGGAAGGCAGG + Intronic
1113110206 13:106814480-106814502 AAAAAGAGAGAGAGGAAGGAAGG + Intergenic
1113343991 13:109455834-109455856 CATCGGAGGGAGAAGAAGGCAGG - Intergenic
1113536965 13:111075956-111075978 CAGCAGTGGGAGAGGTAGGCTGG + Intergenic
1113604881 13:111598016-111598038 AACAGAAGGGAGAGGAGGGCGGG - Intronic
1113674010 13:112195917-112195939 ATGAAGAGAGAGAGGAAGGCAGG - Intergenic
1113674102 13:112196299-112196321 ATGAAGAGAGAGAGGAAGGCAGG - Intergenic
1114317320 14:21521286-21521308 TACAAGACGGAGAGGCAGGGAGG + Exonic
1114659202 14:24334136-24334158 CCTAAGAGGGAGAGAAAGGCAGG + Intronic
1115040228 14:28915439-28915461 CACAAGAGAAAGATGAAGTCTGG + Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115656364 14:35447420-35447442 CACAGGAGAAAGATGAAGGCTGG + Intergenic
1115975902 14:38996581-38996603 CACAAGAGAAAGATGAAGGCCGG + Intergenic
1116270560 14:42759838-42759860 CACCACAGGGAGAGGAATGTGGG - Intergenic
1116464044 14:45211965-45211987 TAAAAGAGGCAGAGGGAGGCTGG - Intronic
1117495163 14:56295315-56295337 CCCAGGCGGGAGAGGGAGGCTGG - Intronic
1117548296 14:56810581-56810603 CACAACAGGGGGAGGAAAACAGG + Intergenic
1118289238 14:64504644-64504666 GGCGAGAGGGAGGGGAAGGCTGG + Intronic
1118309436 14:64681849-64681871 CCCAAGAGGAAGAGGGAGGCTGG + Intergenic
1118316665 14:64729996-64730018 AACAAGAGGGAGATGAAGAGGGG - Intronic
1118341418 14:64896653-64896675 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1119424084 14:74524636-74524658 GACCAGAGGGAGAGGAATGCAGG + Intronic
1120015629 14:79470216-79470238 CACAAGGGGGAGATGAAGGCAGG + Intronic
1120556435 14:85933912-85933934 CACAAGAGAAAGATGTAGGCTGG + Intergenic
1120692022 14:87603302-87603324 CACAAAAGGCTGAGGAAGGCAGG + Intergenic
1121066212 14:90968299-90968321 CACAATAGGAAGAGGGAGGGAGG - Intronic
1121150253 14:91626588-91626610 CAAAAGAGAGAGAGAAAGACAGG - Intronic
1121464587 14:94106797-94106819 TGCAAGAGCAAGAGGAAGGCAGG + Intronic
1121478451 14:94237790-94237812 AAAAAGAGGGAGAGGAAGGGAGG - Intronic
1122200339 14:100118759-100118781 CACAAGAGGGGAGGGAAGGCTGG - Intronic
1122634825 14:103124905-103124927 CACCTGAGGGACAGGAAGCCTGG - Intronic
1122883879 14:104702024-104702046 CACAGGACGGGGAGGAAGGGTGG - Intronic
1122948566 14:105027059-105027081 CAGAAGAGAGAAAGGAAGGGAGG + Intergenic
1123438483 15:20272857-20272879 CACAAGAAGGCCAGGAAGGCTGG + Intergenic
1124007728 15:25808286-25808308 CACATGAGGAAGAGCAAGGAAGG + Intronic
1124466241 15:29942339-29942361 CACTAGGTGGAGATGAAGGCCGG + Intronic
1124959113 15:34381963-34381985 GACAAGGAGGAGAGGAAGGTAGG - Exonic
1124975739 15:34528184-34528206 GACAAGGAGGAGAGGAAGGTAGG - Exonic
1125310963 15:38377789-38377811 GAGAAGAGGAAGAGGAAGGCTGG + Intergenic
1125886663 15:43234644-43234666 CAGAAGAGGCAAAGGAAGGAGGG + Intronic
1126666352 15:51078857-51078879 AAAGAGAGGCAGAGGAAGGCAGG - Intronic
1126890660 15:53200851-53200873 CAGGAGAGGGAGGGGAAGGTTGG + Intergenic
1127568668 15:60218683-60218705 CACAAGAGGCAGAGGGAGTTGGG - Intergenic
1127675580 15:61235063-61235085 CACACGAGGGTAAAGAAGGCTGG + Intergenic
1128109439 15:65067485-65067507 CACAAAGGGAAGAGGCAGGCAGG + Intronic
1128590177 15:68888517-68888539 GGCAAGATGGAGATGAAGGCAGG - Intronic
1128735889 15:70053694-70053716 CTCAGGAAGGTGAGGAAGGCAGG + Intronic
1129154887 15:73711549-73711571 GCCAAGAGGGAGAGAAAGGAAGG + Intronic
1129700569 15:77765755-77765777 AGCGAGTGGGAGAGGAAGGCTGG - Intronic
1129704501 15:77786586-77786608 CAGAGGAGGGAGGGGATGGCAGG + Intronic
1129983524 15:79896624-79896646 CTAAAGAGCGAGAGGACGGCAGG - Intronic
1130867876 15:87947705-87947727 GAAAACAGGGAGAGGAAGGGAGG + Intronic
1130868195 15:87949930-87949952 CAGAAGAGGCAGAGGAAGGAGGG - Intronic
1130973651 15:88756028-88756050 CACAGGAGAAAGATGAAGGCTGG + Intergenic
1131141325 15:89978914-89978936 CACAGGAGGGAGGGGAGAGCAGG + Intergenic
1131334287 15:91532757-91532779 AACAAGGTGGAGAGGATGGCAGG + Intergenic
1131391264 15:92050798-92050820 CACAGGCTGAAGAGGAAGGCAGG - Intronic
1131486620 15:92826079-92826101 GAAAAGTGGGAGAGGAAGACAGG + Intergenic
1131831120 15:96355083-96355105 AACAAGAGACAGAGGAAGGGAGG - Intergenic
1132119890 15:99167651-99167673 CCCAAGAGCAAGAGGAATGCAGG + Intronic
1132317216 15:100898837-100898859 CACAAGAGGGAAGGAAGGGCTGG + Intronic
1132357421 15:101182621-101182643 CACAAGTGGGATATGAGGGCAGG - Intronic
1132684290 16:1155836-1155858 CTCCAGGGGGAGAGGAGGGCTGG + Intronic
1133209959 16:4258024-4258046 CCCAGAAGGGAGAGGAGGGCTGG + Exonic
1133268424 16:4598819-4598841 CTCAAGAAGGCAAGGAAGGCTGG + Intronic
1133315605 16:4881920-4881942 CACCAAAGGGAAAGGAAGGAGGG - Exonic
1133406214 16:5526582-5526604 CACAAAAGGGAGTGGAAGCCAGG - Intergenic
1133409787 16:5558667-5558689 CACAAGACTGAGACGATGGCAGG - Intergenic
1133413109 16:5584668-5584690 CACAGATGGGAGAGGAGGGCTGG + Intergenic
1133665761 16:7966289-7966311 CACAAGAGAGAAATGAAGGCTGG - Intergenic
1133904543 16:10009896-10009918 AACAAGAGGCAGAGACAGGCCGG + Intronic
1134067871 16:11240866-11240888 CAGTTGAGGGACAGGAAGGCTGG + Intergenic
1134205411 16:12233432-12233454 TACAAGAAGGGGAGGAAGGGAGG + Intronic
1134356088 16:13483611-13483633 GATTAGAGGGAGAGGAGGGCTGG - Intergenic
1134570260 16:15284653-15284675 CACGAGAGAAAGATGAAGGCTGG - Intergenic
1134676880 16:16096971-16096993 AAGAAGAGGGACATGAAGGCTGG - Intronic
1134726777 16:16424712-16424734 CACAGGAGAAAGATGAAGGCCGG + Intergenic
1134732115 16:16471400-16471422 CACGAGAGAAAGATGAAGGCTGG + Intergenic
1134776118 16:16855127-16855149 CACAAGTGGGAGCTGAACGCTGG - Intergenic
1134935321 16:18240563-18240585 CACGAGAGAAAGATGAAGGCTGG - Intergenic
1134940657 16:18287151-18287173 CACAGGAGAAAGATGAAGGCCGG - Intergenic
1135269591 16:21057656-21057678 CACAAGAGAAAGCTGAAGGCAGG + Intronic
1135380511 16:21992587-21992609 CACAGGAGAAAGATGAAGGCTGG - Intronic
1135964041 16:27021306-27021328 CACAGCAGTGAGAGGAAGGATGG - Intergenic
1136588502 16:31202779-31202801 GACCAGAGTGGGAGGAAGGCGGG - Exonic
1137316013 16:47323878-47323900 GAGAACAGGGAGAGGAAGACGGG + Intronic
1137488893 16:48914250-48914272 CACAGGGAGGAGAGGAAGGGAGG - Intergenic
1137840625 16:51637474-51637496 CAAGAGAGGGAGAAGAAGGAGGG + Intergenic
1137897718 16:52232307-52232329 CAAAAGGGGGAGAGGAAGAAAGG + Intergenic
1138355523 16:56375364-56375386 CACAAGAGGCAGAGAAAGAGTGG + Intronic
1138489080 16:57365735-57365757 CTCAAGAGGAAGAGGAAGCCAGG - Exonic
1138649914 16:58454067-58454089 CAAAAGTGGAAGAGGGAGGCAGG - Intergenic
1138838498 16:60468530-60468552 CACAAGAGAGAGAGAAAGAGAGG + Intergenic
1138867970 16:60847206-60847228 CACAGGAGAAAGATGAAGGCTGG - Intergenic
1139041499 16:63004460-63004482 CAGAGCAGGGAGAGGAAGGGGGG - Intergenic
1139147481 16:64341694-64341716 GAAAAGAGAGAGAGGAAGGAAGG - Intergenic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139503358 16:67386455-67386477 AAGAAGAGGCAGAGGCAGGCCGG + Intergenic
1140119809 16:72073857-72073879 AACAAGAAGGAGCGGAAAGCTGG - Intronic
1140197723 16:72869097-72869119 GAGAAGACGGAAAGGAAGGCAGG + Intronic
1140316411 16:73902104-73902126 CACAGGAGAAAGATGAAGGCCGG - Intergenic
1140501343 16:75436069-75436091 CAGAAGAGGAAGAGGGTGGCAGG - Intronic
1141149426 16:81553630-81553652 CACAGCCTGGAGAGGAAGGCTGG + Intronic
1141267651 16:82511476-82511498 CACAAGAGGAAGATGTAGGCTGG - Intergenic
1141713963 16:85716453-85716475 GAGAGGAGGGAGAGGAAGGGAGG + Intronic
1141773024 16:86102331-86102353 AAGGAGAGGGAGAGGAAGGAAGG - Intergenic
1141864265 16:86739354-86739376 AAGAAGAGAGAGAGGAAGGAAGG - Intergenic
1141988065 16:87592948-87592970 GAAGAGAGGGAGAGGAAGGAAGG - Intergenic
1142003123 16:87675389-87675411 CCCAGGAGCAAGAGGAAGGCTGG - Intronic
1142129171 16:88424957-88424979 CCTGAGAGGGAGAGGAAGGCCGG - Intergenic
1142214657 16:88824661-88824683 CACAGGAGGGTGAGACAGGCAGG - Intronic
1142324895 16:89408403-89408425 CAGAGGAGGAAGAGGATGGCAGG + Intronic
1142481162 17:219033-219055 CACAGCAGGGTGAGGAGGGCAGG - Intronic
1142635562 17:1255226-1255248 CAAAAGAAGGAGAGGAAGAATGG - Intergenic
1142697220 17:1640226-1640248 CCCCAGAGGGCGAGGAGGGCAGG + Intronic
1143433017 17:6900687-6900709 GACAGGACTGAGAGGAAGGCTGG - Intronic
1143592796 17:7895585-7895607 TAAGAGAGGGAGAGGATGGCAGG - Intronic
1143626665 17:8114276-8114298 CACAAGGGGGAGACAAGGGCAGG + Intronic
1143684656 17:8504218-8504240 CACAAGGGTGAGAAGAAGGCTGG - Intronic
1143701107 17:8660864-8660886 GAAAAGAGAGAGAGGAAGGGAGG - Intergenic
1144010726 17:11146342-11146364 CACAAGGAGTAGAGGAAGGAAGG - Intergenic
1144031815 17:11329911-11329933 GACAGGAGGGAGAGGGAGGGAGG - Intronic
1144145199 17:12390743-12390765 CAGAACAGGAAGAGGAAGGTTGG + Intergenic
1144281641 17:13732775-13732797 CACAGGAGAGAGATGTAGGCTGG + Intergenic
1144740891 17:17581693-17581715 CACAGGAGGGAGAGGGGGGAGGG - Intronic
1145051517 17:19665682-19665704 CACATGTGGGAGAGGCAGGCAGG - Intronic
1145733480 17:27211414-27211436 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1145788795 17:27611369-27611391 GCCAAGTGGGTGAGGAAGGCTGG + Intronic
1146238359 17:31188800-31188822 CACAGGAGGAAGATGGAGGCTGG - Intronic
1146638389 17:34522472-34522494 CACAAGAGGGAGGGGTGGGTGGG + Intergenic
1146942857 17:36855720-36855742 CACACAGGGGTGAGGAAGGCTGG + Intergenic
1147311358 17:39597835-39597857 CACAAGGAGGAGAGGAAGGGGGG - Intergenic
1147383926 17:40070986-40071008 CAGTAGAGGGAGAGGAAGAAAGG - Intronic
1147606214 17:41775234-41775256 CACAACAGACAGAAGAAGGCTGG + Intronic
1147876977 17:43628651-43628673 CAGAAGAGGGACAGGAGGGAGGG - Intergenic
1147997887 17:44371107-44371129 GAGAAGGGGCAGAGGAAGGCTGG - Intergenic
1148265906 17:46225475-46225497 CAGAAGGGGGAGAGGGATGCTGG + Intergenic
1148317301 17:46713324-46713346 CAAAACAGGGAAGGGAAGGCAGG + Intronic
1148337573 17:46851751-46851773 CGCAGGAGGGAGAGACAGGCAGG - Intronic
1148444797 17:47731043-47731065 CTCTGGAGGAAGAGGAAGGCTGG - Intergenic
1148551437 17:48552653-48552675 CACAAGGGGGAGAAGAGGACTGG + Exonic
1149343255 17:55708634-55708656 CACAAAAGGGCAAGGAAGGTTGG - Intergenic
1149471207 17:56916562-56916584 AAAAAGAGAGAGAGGAAGGAAGG + Intergenic
1149516161 17:57282594-57282616 CAGAACAGGGAGAGGAAGCAGGG - Intronic
1149588817 17:57812118-57812140 CACCAGGGGCAGGGGAAGGCAGG - Intergenic
1149746120 17:59100089-59100111 CAAAAGAGGGAGAGGAGGAGAGG - Intronic
1149867124 17:60157206-60157228 CAGGAGAGGGGGAGGCAGGCAGG + Intronic
1150009677 17:61492268-61492290 CATAAGAGGGGAAGGAAGGAGGG - Intergenic
1150737751 17:67754780-67754802 CACAAGAAGGAGAGGAGGTAGGG - Intergenic
1150956222 17:69863150-69863172 CACAGGAGAAAGATGAAGGCCGG + Intergenic
1151200239 17:72462617-72462639 CACGAGGAGGAGAGGGAGGCTGG - Intergenic
1151260932 17:72915424-72915446 CAGAAGAGTGAGGGGAAAGCCGG - Intronic
1151268919 17:72978193-72978215 AGGAAGAGGAAGAGGAAGGCAGG - Intronic
1151450735 17:74196875-74196897 TGCAGGAGGGAGAGGAGGGCGGG - Intergenic
1151596747 17:75082606-75082628 CACGAGAGGGGAAGGAAGGAGGG - Intergenic
1151930475 17:77228777-77228799 GACAAGGGGGACAGGAAGGGAGG - Intergenic
1152033765 17:77859268-77859290 GAAGAGAGGGAGAGGGAGGCAGG + Intergenic
1152864393 17:82713545-82713567 CACAAGGGGGACAGTCAGGCAGG + Intergenic
1152916156 17:83037221-83037243 CACTACAAGGAGGGGAAGGCAGG + Intronic
1153998499 18:10463062-10463084 GACAAGGGGCAGAGGGAGGCAGG - Intronic
1154198123 18:12280836-12280858 CACAGGAGGGAGTGGGAGCCAGG - Intergenic
1154515324 18:15157905-15157927 TGCTAGAGGGAGAGGAAGGCAGG - Intergenic
1155249145 18:23938818-23938840 CAAAGGAGGGAGAGAAAGGGGGG + Intronic
1156183994 18:34640263-34640285 CAGAGGAGGGACAGGCAGGCAGG - Intronic
1156554871 18:38055984-38056006 CACAAGAGAAAGATGTAGGCTGG + Intergenic
1156957704 18:42988719-42988741 CACAAGAGAAAGCGGAAAGCAGG + Intronic
1156990729 18:43404337-43404359 CACAAGAGAAAGATGTAGGCTGG + Intergenic
1157049601 18:44146540-44146562 TAAAAGAGGGAGAGGAAGAGGGG + Intergenic
1157112034 18:44830179-44830201 CACAAAAGGGAGAAGAGGGGAGG + Intronic
1157128482 18:44980601-44980623 CAGAGGAGGGAGAGGCAGGGAGG + Intronic
1157374545 18:47150785-47150807 GACAAGTGGTAGAGGAAGGGAGG - Intronic
1157394342 18:47329329-47329351 CACGGGAGAAAGAGGAAGGCTGG + Intergenic
1157429863 18:47615763-47615785 CCCAAGGGGGAAAGGAAGGCCGG + Intergenic
1157440019 18:47703518-47703540 TACAAGATGGAGAGGCAGGGAGG - Intergenic
1157951060 18:52037647-52037669 GAAAAGAGAGAGAGGAAGGAGGG + Intergenic
1158427260 18:57351844-57351866 CGGAAAGGGGAGAGGAAGGCAGG + Exonic
1158446488 18:57526658-57526680 CACAGGAGAAAGATGAAGGCTGG - Intergenic
1158456074 18:57608940-57608962 CACCGGAGGAAGATGAAGGCTGG - Intronic
1159310195 18:66698104-66698126 CACAGGAGGCTGAGGAAGGAGGG + Intergenic
1159351684 18:67283528-67283550 AATAAGAGGGAAAGAAAGGCAGG - Intergenic
1159672523 18:71239346-71239368 CACCAGAGGGAGAGCCAGGCAGG + Intergenic
1159849937 18:73515456-73515478 CACAGGAGAAAGATGAAGGCTGG - Intergenic
1159889728 18:73942349-73942371 CACAACTGGGAGAGGAAGCCAGG + Intergenic
1159956236 18:74520155-74520177 GACAAGAGGGAAAGGAAAGAGGG - Exonic
1160271263 18:77386471-77386493 TAGAAGGGGAAGAGGAAGGCAGG + Intergenic
1161270550 19:3387204-3387226 CACAAGTGAGAGAGGAGGCCGGG + Intronic
1161470542 19:4454914-4454936 CCCAAGAGGGACAGGAAGTCCGG + Intronic
1161483006 19:4519990-4520012 GAGAAGAAGGAGAGGAAGGTGGG - Intergenic
1161667795 19:5587636-5587658 CAAAAAAGGGAGAGGAAGTGAGG + Intronic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1161852624 19:6745527-6745549 GCCGAGAGGGAGTGGAAGGCAGG - Intronic
1161957045 19:7501904-7501926 AACAAGACAGAGAGGAAGGGAGG + Intronic
1162143074 19:8596270-8596292 CACAAGAGGGGGAGGAGGGGAGG - Intronic
1162776352 19:12982082-12982104 CACAAAAGGGGAAAGAAGGCAGG - Intergenic
1162854861 19:13460418-13460440 CCCAAGTGGGAGCAGAAGGCTGG - Intronic
1162877812 19:13633901-13633923 GAAAAGAGAGAGAGGAAGGAAGG - Intergenic
1162982739 19:14249423-14249445 CAGGAGAGGACGAGGAAGGCAGG - Intergenic
1163004748 19:14390097-14390119 AACAAGAGAGAGAGGGAGGGAGG + Intronic
1163061258 19:14763872-14763894 GACAAGAGGAAGAGGACGGGAGG - Intronic
1163315176 19:16536385-16536407 CCCAAGACGGAGAGAGAGGCAGG - Intronic
1164066272 19:21720372-21720394 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1164156958 19:22602875-22602897 GACAAGGAGGAGATGAAGGCAGG + Intergenic
1164324783 19:24181516-24181538 CAGAAGAGGAAGAGGAAAGGAGG + Intergenic
1164652033 19:29897843-29897865 CACAAGAGCCAGAGAAAGACTGG - Intergenic
1164654357 19:29910054-29910076 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654382 19:29910134-29910156 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164654428 19:29910274-29910296 CAGGAGAGGGAGAGGAGGGAGGG - Intergenic
1164765088 19:30758492-30758514 CACAGGAGAAAGATGAAGGCTGG + Intergenic
1164840429 19:31388920-31388942 CATAGAAGGGAGAGAAAGGCCGG + Intergenic
1164931190 19:32177546-32177568 AAAAAGAAGGAAAGGAAGGCAGG + Intergenic
1165007835 19:32820963-32820985 CCCAAGTGGAAGAGGAAGGCAGG - Intronic
1165034455 19:33022757-33022779 CACAAGAAGGCCAGGAAGGCTGG + Intronic
1165350431 19:35272292-35272314 CACAGGCAGGAGAGGAAAGCTGG + Intronic
1165433630 19:35785383-35785405 CAGGAGAGGGAGAGGTAGGAGGG - Intronic
1165438673 19:35811518-35811540 CAAAAGAGGAAGAGGAAGGAAGG + Intronic
1165494249 19:36142412-36142434 CACAAGAAGGGGAGGAAGGTGGG - Intronic
1165993139 19:39827168-39827190 GACAAGGGGGAGTGGAAGGAAGG + Intronic
1166044790 19:40223524-40223546 CTCAGGAGGCAGAGGAAGGCGGG + Exonic
1166159609 19:40942035-40942057 CACAGTAGGGAGGGGAGGGCAGG - Intergenic
1166161788 19:40959475-40959497 GAGAAGGGGGAGAGGAAGGGAGG - Intergenic
1166504821 19:43364598-43364620 CACAAGGGGCACAGGATGGCTGG + Intergenic
1166505719 19:43370316-43370338 CACAAGGGGCACAGGATGGCTGG - Intergenic
1166531885 19:43547794-43547816 CCCAAGAGGGAGGGGAATTCTGG - Intronic
1166680611 19:44764117-44764139 GGAAAGAGGGAGAGGAAGGAAGG + Intergenic
1166939072 19:46352046-46352068 CTCCAGAGGGAAAGGAAGGAGGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167259938 19:48452687-48452709 GACTAGAGGGAGAGGATGGGAGG - Exonic
1168220357 19:54956118-54956140 CAACAGAGGGAGAGAAAGGAAGG + Intronic
1168527791 19:57102720-57102742 AAAACGAGGGAGATGAAGGCAGG - Intergenic
1168563488 19:57403485-57403507 CACCAGAGAGTGAGCAAGGCAGG - Intronic
1168582476 19:57566993-57567015 CACAGGAGGGAGAGGAATTGGGG + Intergenic
1168637404 19:58007315-58007337 AGCAATAGGAAGAGGAAGGCTGG + Exonic
1168667473 19:58215259-58215281 CAAGACAGGAAGAGGAAGGCAGG + Intergenic
925437503 2:3852988-3853010 TAAAAGTGGCAGAGGAAGGCTGG + Intergenic
925625925 2:5842048-5842070 AAGAAGAGGGAGAGGAGGGGAGG + Intergenic
925864274 2:8212523-8212545 AGAAAGAGGGAGAGGAAGGAAGG - Intergenic
926693278 2:15752253-15752275 CACAAGAGGGAAATGAATGCAGG - Intergenic
926810836 2:16754168-16754190 CACAAGAGAAAGATGTAGGCTGG + Intergenic
927031495 2:19124814-19124836 CATAAGTGGAAGAGGGAGGCAGG - Intergenic
927506916 2:23620756-23620778 CAGAGGTGGGAGAGGGAGGCAGG + Intronic
927826297 2:26312197-26312219 GAGAAAAGGGAGAGGAAGACAGG + Intronic
927965823 2:27267453-27267475 CACAAGAAGGCCAGGATGGCTGG - Intronic
928046903 2:27943416-27943438 CAGAAGCAGGAAAGGAAGGCAGG - Intronic
928129874 2:28641782-28641804 GAGAAGAGGGAGAGGAGAGCTGG - Intronic
928171476 2:29007269-29007291 CACCAGAGGGAGAGACAGGGAGG + Intronic
928731752 2:34239934-34239956 CAAAAGAGGAAGAAGCAGGCAGG + Intergenic
929692266 2:44084821-44084843 GAAAAGAGAGAGAGGAAGGAAGG - Intergenic
929872059 2:45767438-45767460 TACAAGAGGAAGAGGCAGGAAGG - Intronic
929881568 2:45841452-45841474 CACAAGAGAAAGATGAAGGCTGG + Intronic
931383265 2:61773494-61773516 AACAAGAGGGAGTGGCAGGGTGG + Intergenic
932433270 2:71687895-71687917 GGCTAGAGGGAGAGGAAGGAAGG + Intergenic
933233500 2:79837274-79837296 CACGAGAGAAAGATGAAGGCTGG + Intronic
933776505 2:85774280-85774302 GACAAGAGGAAGAGGAGGACAGG + Intronic
933987870 2:87607841-87607863 CATTAGAGTGAAAGGAAGGCAGG - Intergenic
934658428 2:96130033-96130055 AAGCAGAGGGAGAAGAAGGCAGG + Intronic
935159112 2:100513750-100513772 CACAGGAGAAAGATGAAGGCTGG + Intergenic
935279127 2:101502570-101502592 GAGAAGAGAGACAGGAAGGCCGG + Intergenic
936305971 2:111342967-111342989 CATTAGAGTGAAAGGAAGGCAGG + Intergenic
936389286 2:112056526-112056548 CAAAAGAGAGACAGGAAGTCTGG + Intronic
936502809 2:113079644-113079666 CACAAGAGGGCGATGAACCCAGG + Intergenic
936600059 2:113887209-113887231 CAAAAGAGAGAGAGGGAAGCGGG + Intergenic
937305290 2:120867149-120867171 CCCAAGAGGAAGAGGAAGCTGGG - Intronic
937727426 2:125183900-125183922 CAAAATAGGGAGAAGAAGCCAGG - Intergenic
937732219 2:125246820-125246842 CACAAGGGGAAGAGGAAGATGGG + Intergenic
937799878 2:126071032-126071054 CACAAGAGAAAGATGAAGGCTGG - Intergenic
937843507 2:126552039-126552061 CACAGGAGAAAGAGGTAGGCTGG + Intergenic
938178863 2:129161957-129161979 GAAAAGAGGGAGAGGAAAGGTGG + Intergenic
938342046 2:130542049-130542071 CAACAGAGGGAGAGGAGGCCGGG + Intronic
938347786 2:130578662-130578684 CAACAGAGGGAGAGGAGGCCGGG - Intronic
938442448 2:131348058-131348080 CAACAGAAGGTGAGGAAGGCAGG - Intronic
938515587 2:132002689-132002711 TGCTAGAGGGAGAGGAAGGGAGG - Intergenic
938736857 2:134193562-134193584 CCCAAGAGGGCTAGGAAGGAGGG - Intronic
939287935 2:140156672-140156694 TATAAAAGGAAGAGGAAGGCAGG - Intergenic
939387412 2:141518650-141518672 TAAAAGAGGGAGAGAGAGGCCGG + Intronic
939497447 2:142941078-142941100 TCCCAGAGGGAGAGGAGGGCTGG - Intronic
940319223 2:152358108-152358130 CACAAGAGAAAGATGAAGGCTGG - Intronic
940627532 2:156194114-156194136 AGTAAGAGGGAGAGGAAAGCAGG + Intergenic
940742955 2:157532821-157532843 CAGAAAAGGAAGAGGAAGGAAGG - Exonic
941101800 2:161304821-161304843 AACAGAAGGGAGAGGAAGGAGGG - Intergenic
941670920 2:168291380-168291402 TAATAGAGGGAGGGGAAGGCTGG - Intergenic
941778099 2:169414507-169414529 AAAATGAGGGAAAGGAAGGCAGG + Intergenic
942185684 2:173422776-173422798 CACAAGGGAGACAGGAAGGAGGG + Intergenic
942250940 2:174047312-174047334 CAGAAGAGGAAGAAGAAGCCTGG + Intergenic
943542843 2:189239411-189239433 TACAAGGGGCAGAGGGAGGCAGG + Intergenic
943699460 2:190973956-190973978 CTCAACAAAGAGAGGAAGGCAGG - Intronic
943996192 2:194769064-194769086 TACAAGTGAGAGAGGATGGCAGG + Intergenic
944599042 2:201284649-201284671 CATGAGAGGGAGAGGGAGACGGG + Intronic
945970609 2:216227528-216227550 CATGAGAGGGAGAGGGAGACGGG + Intergenic
945990973 2:216395034-216395056 CACATGATGCAGAGGAAGGCAGG + Intergenic
946025318 2:216668517-216668539 AACGAGAGGAAGAGGAAGCCAGG + Intergenic
946174967 2:217916990-217917012 CACAAGAGGGAGGAAAGGGCGGG - Intronic
946523421 2:220491735-220491757 CCCAACAGGGAGAGGCAGGAAGG - Intergenic
946524676 2:220505546-220505568 CAAGAGAGGGAGAGAGAGGCAGG + Intergenic
947533842 2:230928769-230928791 CCCAACAGAGAGAGGAAGGCAGG + Intronic
947635060 2:231676068-231676090 CACATGAGAAACAGGAAGGCAGG + Intergenic
947801501 2:232931097-232931119 AAAAAGAGAGAGAGGAAGGAAGG + Intronic
948144606 2:235699097-235699119 CACAGGAGGGACGGGGAGGCAGG + Intronic
948273288 2:236689884-236689906 GAGAAGGGGGAGAGGAAGGGAGG - Intergenic
948558844 2:238836926-238836948 CACAGGAGAAAGACGAAGGCAGG + Intergenic
948563170 2:238867238-238867260 AGAAAGAGGGAGAGGGAGGCAGG + Intronic
1168878261 20:1185554-1185576 AAGGAGAGGGACAGGAAGGCGGG + Intronic
1168947997 20:1777399-1777421 CACAAGAGGGAGCTGTCGGCCGG - Intergenic
1169188601 20:3642161-3642183 CACAAGAAGGGGACAAAGGCAGG - Intronic
1169213982 20:3783364-3783386 CCCAAGAGGCAGAGGATGGTTGG - Intergenic
1169292099 20:4361581-4361603 CACAGGAGAGGGATGAAGGCTGG - Intergenic
1169472862 20:5903236-5903258 AAAGAGAGGGAGAGGAGGGCCGG + Intergenic
1169774705 20:9239910-9239932 CACAGGAGAAAGATGAAGGCTGG + Intronic
1169804626 20:9546696-9546718 CACAACAGGGAGATGAAACCAGG + Intronic
1170479816 20:16754660-16754682 CACAAGAGGAAGATGAAAGCCGG - Intronic
1170841613 20:19928765-19928787 CACAAGAGGGAGAGGAAGGCAGG - Intronic
1171079071 20:22159656-22159678 CACTAGAGAGAGAGGGAGGAGGG - Intergenic
1171181176 20:23091776-23091798 AAAAAGAGAGAGAGAAAGGCTGG + Intergenic
1171209954 20:23309385-23309407 ATGAAGAGAGAGAGGAAGGCAGG - Intergenic
1171238769 20:23548443-23548465 TTCAAAAGGCAGAGGAAGGCTGG + Intergenic
1172210216 20:33192446-33192468 CACAAGAGAGAAAGGATGGAAGG + Intergenic
1172446463 20:34995986-34996008 CACAGGAGGGAAAGTGAGGCAGG + Intronic
1172632201 20:36386037-36386059 AACAGGAGGGAAAGGAAGGCGGG + Intronic
1172643378 20:36455198-36455220 AGAAAGAGGGAGAGGAAGGGAGG - Intronic
1173046856 20:39521068-39521090 CAACCGAGGGAGAGGAGGGCAGG - Intergenic
1173079997 20:39856899-39856921 AAAATAAGGGAGAGGAAGGCAGG - Intergenic
1173117485 20:40259600-40259622 CAAAAGAGAGAGATGAAGGCCGG + Intergenic
1173154217 20:40594234-40594256 GTCAGGAGGAAGAGGAAGGCTGG + Intergenic
1173404282 20:42751672-42751694 CATAGGAGGAAGACGAAGGCAGG - Intronic
1173766931 20:45620054-45620076 CACAAAAGAGGGAGGAAGGCAGG + Intronic
1174421097 20:50399647-50399669 GACAAGAGTGACAAGAAGGCAGG + Intergenic
1174485194 20:50856575-50856597 CACAAAAGGGACAAGGAGGCTGG - Intronic
1174684980 20:52446034-52446056 CAAATGAGGGAAAAGAAGGCAGG + Intergenic
1174803102 20:53581616-53581638 CACAAGAAGGACCGGAGGGCCGG - Exonic
1175065435 20:56282425-56282447 CCCCAGAAGGAGAGGGAGGCTGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175256627 20:57651966-57651988 AAGAGGAGTGAGAGGAAGGCGGG - Exonic
1175361658 20:58415943-58415965 CAGAGTAGGGAGAGGAAGGTTGG + Intronic
1175807156 20:61835979-61836001 CACAGGCTGGAGGGGAAGGCCGG + Intronic
1175870182 20:62205671-62205693 CACAAGATGGGAAGGGAGGCTGG - Intergenic
1176843317 21:13857820-13857842 CACAAGACAGAGAGGAAAGAGGG + Intergenic
1176987503 21:15454943-15454965 CACAAGAGACAGATGTAGGCTGG - Intergenic
1177489595 21:21805236-21805258 CACAAGAGAAAGATGAAGGCCGG - Intergenic
1177534761 21:22409825-22409847 AAAAAGAGAGAGAGGAAGGAAGG - Intergenic
1177670727 21:24222768-24222790 AACAAGAGAGGGAGGAAGGAAGG + Intergenic
1177940846 21:27409813-27409835 CACAGGAGAAAGATGAAGGCTGG + Intergenic
1177975817 21:27849249-27849271 TGCTAGAGGGAGAGGAAGGGAGG + Intergenic
1178341427 21:31788583-31788605 GACAAGAGGGAGGCTAAGGCAGG + Intergenic
1178521032 21:33288650-33288672 CACCAGAGGGAGAGAATGGGAGG + Intronic
1179003637 21:37487988-37488010 CTCAAGAGTGAGGAGAAGGCAGG - Intronic
1179095478 21:38310846-38310868 CAAAACATGGAGAGGAAGCCAGG - Intergenic
1179116694 21:38499806-38499828 CAGAAGAGAGAGAGAAAGGAAGG + Intronic
1179482111 21:41685117-41685139 TACAAGAGGGAGATGGAGGGAGG - Intergenic
1179837723 21:44048325-44048347 CACCAGAGGGTGGGGAGGGCAGG - Intronic
1180013840 21:45070081-45070103 CAGAAGAGGGAGACGATGGGTGG - Intergenic
1180048955 21:45322756-45322778 CACGCGAGGAAGAGGAGGGCGGG - Intergenic
1180302603 22:11049577-11049599 AAAAAAAAGGAGAGGAAGGCTGG + Intergenic
1180630230 22:17224101-17224123 CATTAGAGGGAGAGGATTGCTGG - Intergenic
1180865125 22:19114120-19114142 CAAAAGATGGAGAGGAAAGGTGG - Intronic
1181428830 22:22864351-22864373 AACAAAAGGAAGAGGAAGGAAGG + Intronic
1181458859 22:23074522-23074544 GGCCAGAGGGAGAGCAAGGCTGG + Intronic
1183135858 22:35886961-35886983 GACAAGACGGAGAGGGAGGGTGG - Intronic
1183162812 22:36126410-36126432 GAAAGGAGGGAGAGGAAGGAAGG - Intergenic
1183162818 22:36126432-36126454 GAAAGGAGGGAGAGGAAGGGAGG - Intergenic
1183162825 22:36126454-36126476 GAAAGGAGGGAGAGGAAGGGAGG - Intergenic
1183162872 22:36126652-36126674 AAAAGGAGGGAGAGGAAGGGAGG - Intergenic
1183162889 22:36126718-36126740 GAAAGGAGGGAGAGGAAGGAAGG - Intergenic
1183162895 22:36126740-36126762 GAAAGGAGGGAGAGGAAGGAAGG - Intergenic
1183504581 22:38202204-38202226 CAGAAGCGGGTGAGGAACGCGGG + Exonic
1183547665 22:38463507-38463529 AACCGCAGGGAGAGGAAGGCTGG + Intergenic
1183871892 22:40746367-40746389 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1184017021 22:41793985-41794007 CACACAAGGGAATGGAAGGCTGG - Intronic
1184112780 22:42405063-42405085 GAGAGGAGGAAGAGGAAGGCAGG + Intronic
1184280584 22:43435287-43435309 CGCAGGAGGGAAAGGCAGGCAGG - Intronic
1184410995 22:44326395-44326417 CAGCAGAGGGAGGGGATGGCCGG - Intergenic
1184431429 22:44443430-44443452 TACAAGAGGCAGAGGGCGGCAGG + Intergenic
1184638944 22:45858656-45858678 CCCTAGAGTGAAAGGAAGGCCGG - Intergenic
1184854278 22:47137922-47137944 CTGAAGAGGGAGGCGAAGGCAGG - Intronic
1185020169 22:48369879-48369901 CCCAAGAGGCAGAGGGAGACCGG - Intergenic
1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG + Intergenic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
949096755 3:95512-95534 CAAAAGTAGAAGAGGAAGGCAGG - Intergenic
949379970 3:3433557-3433579 CAGAAGAGGGAGAAGAAGAGAGG + Intergenic
949445174 3:4127515-4127537 CACAAGAGAAAGATGCAGGCTGG - Intronic
950222553 3:11207159-11207181 CAGCAGTGGGAGGGGAAGGCGGG + Intronic
950680853 3:14584175-14584197 GACAAGCTGGAGAGAAAGGCTGG + Intergenic
950838424 3:15942879-15942901 TAGAAGAGAGAGAAGAAGGCAGG - Intergenic
950916239 3:16648037-16648059 CACAAGAGAAAGATGAAGGTGGG + Intronic
951161385 3:19426915-19426937 CACAAAAGGGAAAGGAAAGGAGG - Intronic
951256237 3:20452830-20452852 TACAAGAGGGAGAGGAAAAACGG + Intergenic
952224176 3:31357240-31357262 CACAAGAGGGTGATGAAGGCTGG + Intergenic
952240457 3:31526984-31527006 CATTAGAAGCAGAGGAAGGCCGG - Intergenic
952498700 3:33938836-33938858 CAGGAGATGGAGAGGAAGGGTGG + Intergenic
952718209 3:36503727-36503749 CACAAAATGGGCAGGAAGGCTGG - Intronic
953827855 3:46269583-46269605 CACCAGAGGGTGAGGATGGATGG - Intergenic
954008541 3:47613811-47613833 GTGAAGAGGGAGAGGAAGGCAGG - Intronic
954433700 3:50484860-50484882 CACAAGCTGGACAGGAGGGCTGG - Intronic
954464024 3:50644197-50644219 CACAAAAGGGGAAGCAAGGCAGG - Intronic
954919227 3:54175318-54175340 CTCAAGAGGCAGATTAAGGCCGG + Intronic
955078590 3:55637041-55637063 CAGGAGAGGGACAGGAAGACAGG - Intronic
955193672 3:56785206-56785228 CACAGGAAGAAAAGGAAGGCAGG - Intronic
955358351 3:58250560-58250582 AACAGGAGGGAGAGGAAGGGAGG + Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955567759 3:60267230-60267252 GAAATGAGGGAGAGGAAGGAGGG + Intronic
955954029 3:64269855-64269877 CACAATAAAGAAAGGAAGGCTGG + Intronic
956100278 3:65760926-65760948 AACAAGGGGTAGAGGTAGGCAGG + Intronic
956894912 3:73649654-73649676 CATAAGATGAAAAGGAAGGCAGG - Intergenic
957193374 3:77039184-77039206 CACAAGGGGGAGAAAAAGGAGGG - Intronic
957416180 3:79908645-79908667 CAGAAGGGGGAGAGGAAGCAAGG + Intergenic
957427284 3:80054086-80054108 GACAAGGAGCAGAGGAAGGCAGG - Intergenic
957712288 3:83877136-83877158 CACAGGAGAAAGATGAAGGCTGG - Intergenic
958133008 3:89453945-89453967 CAGAAGAGAGAGAGGGAGACAGG - Intronic
958253873 3:91302059-91302081 CAAAAGAGAGAGAGAAAGGGAGG + Intergenic
958423848 3:93958972-93958994 CACTAGAGGCAGAGGAATTCAGG + Intronic
958949504 3:100401158-100401180 CCGAAGAGGGAGAGGAGGGGCGG + Exonic
959204212 3:103284272-103284294 CACAAGAGAAAGATGTAGGCTGG + Intergenic
959226463 3:103594693-103594715 CACGAGAGGAAGATGTAGGCTGG + Intergenic
959252422 3:103965661-103965683 CACTCCAGGGAGAAGAAGGCAGG + Intergenic
959339640 3:105112722-105112744 CACAAGAGAAAGATGAAGGCCGG + Intergenic
959425141 3:106178072-106178094 CACAGGAGAAAGATGAAGGCCGG + Intergenic
960349105 3:116572339-116572361 CACAGGAGGAAGATGTAGGCTGG - Intronic
960859033 3:122132691-122132713 GAAAAGAGAGTGAGGAAGGCAGG - Intergenic
961497899 3:127307420-127307442 AACATAAGGGAGAGGAAGGAAGG - Intergenic
962013369 3:131415763-131415785 CACAGGAGGAAGATGTAGGCTGG - Intergenic
962556181 3:136554232-136554254 CACAAGAGGGAGGGTAAGGAAGG + Intronic
962696961 3:137959031-137959053 AAGAAGGGAGAGAGGAAGGCAGG + Intergenic
962784771 3:138757643-138757665 GAGGAGAGGGAGAGGAAGGAGGG + Intronic
963214055 3:142724613-142724635 AAGAGGATGGAGAGGAAGGCAGG - Exonic
963462405 3:145633375-145633397 CACGAGAGAAAGATGAAGGCTGG - Intergenic
963660940 3:148128576-148128598 CACAGGAGAAAGATGAAGGCTGG - Intergenic
964184414 3:153925215-153925237 AAAAAGGGGGAGAGGAAGGAAGG + Intergenic
964204159 3:154152305-154152327 CACAAGAGGGAAGGGAAGGAAGG + Intronic
964556583 3:157946135-157946157 CAGAAGAGGGGGAGGGAGGGAGG + Intergenic
964820279 3:160761289-160761311 CAAATGATGGAGAGGAAAGCAGG - Intronic
964974741 3:162605190-162605212 CAGAAGCGGGAGAGCAAAGCAGG - Intergenic
965038115 3:163468807-163468829 AACGAGAGAGAGAGGAAGGAAGG + Intergenic
965050372 3:163639160-163639182 CACAGGAGGAAGATGTAGGCTGG + Intergenic
965071317 3:163918252-163918274 CACAGGAGAAAGATGAAGGCTGG - Intergenic
965402717 3:168232190-168232212 CACAGGAAGGAAAGGAAGGAAGG - Intergenic
965516439 3:169626602-169626624 ATCACGAGGGAGAGGAAGGCTGG - Intronic
965554444 3:170004972-170004994 CCCAAGATTGAAAGGAAGGCTGG + Intergenic
965898448 3:173608730-173608752 AAAAAGAGAGAGAGGAAGGATGG - Intronic
965954213 3:174348672-174348694 GAAAAGAGAGAGAGGAAGGAAGG + Intergenic
966169287 3:177059916-177059938 CACGAGAGAAAGATGAAGGCTGG - Intronic
966221585 3:177556928-177556950 CACAGGAGAAAGATGAAGGCTGG - Intergenic
966323165 3:178723634-178723656 CAAAAGAGGGAGATGAAGAGAGG - Intronic
966888482 3:184389581-184389603 CACAAGGGGGAGAGGCAGCTGGG + Exonic
966989042 3:185210087-185210109 CACAAGCGGAGGAGGAAGGCAGG + Intronic
967103117 3:186233218-186233240 CATAAGTGGAAGAGGGAGGCAGG + Intronic
967183365 3:186925790-186925812 CACAAGACTGGGAGGATGGCTGG - Intergenic
967676481 3:192305058-192305080 CAGAGAAGGGAGAGGAAGGAGGG + Intronic
968040775 3:195587526-195587548 CACAGGAGGGAGAGGAAAGAGGG - Intergenic
968297158 3:197585467-197585489 AACAAGAGGGAAAGGAAGATAGG + Intergenic
968779973 4:2573125-2573147 CACAAGAGTAAGAGTGAGGCGGG - Intronic
968780692 4:2578936-2578958 CAGAGGAGGTAGAGGAAGGCAGG + Intronic
969148594 4:5146429-5146451 CACAGGAGGAAGATGAAGGCTGG + Intronic
969253543 4:5987591-5987613 AGAAAGAGGGAAAGGAAGGCAGG + Intronic
969345925 4:6569980-6570002 GAAAAGAGAGAGAGGAAGGAAGG + Intergenic
969363553 4:6680845-6680867 TGCAAGATGCAGAGGAAGGCAGG - Intergenic
969559092 4:7934607-7934629 CAGAGGAGAGAGAGGAAAGCAGG + Intronic
969608840 4:8216055-8216077 CAGAAGAGGGGCAGGGAGGCAGG - Intronic
970088481 4:12374842-12374864 CACAGGAGAGACAGGAAGGCTGG + Intergenic
970096960 4:12474984-12475006 CACAAGGTGGAGAGATAGGCAGG - Intergenic
970329229 4:14962127-14962149 CACAGGAGAAAGAGGTAGGCAGG + Intergenic
970348837 4:15180624-15180646 GAGAACAGGGTGAGGAAGGCTGG + Intergenic
970570742 4:17379885-17379907 CGCTAGAGGGAGAGGGAGTCTGG - Intergenic
970818557 4:20187118-20187140 CACAAGAGAAAGATGAAAGCTGG - Intergenic
971224065 4:24735187-24735209 CATAAGAGGTTGTGGAAGGCAGG - Intergenic
971261092 4:25057541-25057563 GACAAGAGGGTGAGGAGGGGAGG + Intergenic
971377553 4:26067412-26067434 CACAGTTGGGAGAAGAAGGCCGG + Intergenic
971963971 4:33527313-33527335 CACAGAAGGGACAGGAAGGAGGG - Intergenic
972167987 4:36310867-36310889 GAGAGGAGGGAGAGGAAGGAAGG + Intronic
972213682 4:36870131-36870153 CAGAAAAGGGAGAGAAAGGAGGG + Intergenic
972418472 4:38865517-38865539 CACAGCAGGGAAGGGAAGGCAGG + Intergenic
972977398 4:44653346-44653368 CACAAGTGGAAGAGGGAGACTGG + Intronic
973061788 4:45735471-45735493 GAAAAGAGAGAGAGGAAGGGAGG - Intergenic
973535975 4:51882393-51882415 CACGACGGGGAGAGGAAGCCGGG + Intronic
973539967 4:51925911-51925933 CACAGGAGAAAGATGAAGGCTGG + Intergenic
973604250 4:52570890-52570912 CAAAAGAGGGGAAGGAAGGGAGG + Intergenic
975570307 4:75810212-75810234 CATAAGAGTACGAGGAAGGCTGG - Intronic
975644067 4:76528848-76528870 AAGAATAGGGAGAGGAAGACCGG - Intronic
975715590 4:77202745-77202767 AACAAGCTGGAGAGGAAGACGGG - Intronic
976231240 4:82845505-82845527 TGAAACAGGGAGAGGAAGGCAGG + Intronic
976473124 4:85452801-85452823 AACATGAGGGAGAGGAAGACAGG - Intergenic
976490938 4:85669428-85669450 CACATAAGGAAGAGGAAGTCTGG + Intronic
976775151 4:88698866-88698888 AAGAAGAGGGTGAGGAAGGTGGG - Intronic
977933164 4:102770389-102770411 CACAAAAGGCAGAGGAAGAGTGG + Intergenic
978024628 4:103857757-103857779 TACAAAAGGGAAAGGAAGTCTGG - Intergenic
978341246 4:107722985-107723007 CACAAGAGAAAGATGTAGGCTGG + Intergenic
978833337 4:113116322-113116344 CAAAAGAGGGAGAGGAAGGCAGG - Intronic
979175154 4:117653215-117653237 TACAAGGGGAAGAGGAAGGCAGG - Intergenic
979402545 4:120266150-120266172 AACAAGAGGGAGAGACAGGATGG - Intergenic
979551172 4:121992537-121992559 CACAAGAGGGAGAAGGAAGGTGG - Intergenic
982232437 4:153221853-153221875 AAGAAGAGAGAGAGGAAGGAAGG + Intronic
982358287 4:154491966-154491988 CACGGCAGGGAGGGGAAGGCAGG - Intergenic
982371701 4:154640338-154640360 CATAAGATGGCCAGGAAGGCCGG + Intronic
982799875 4:159692275-159692297 CACAAAAGAAAGATGAAGGCTGG - Intergenic
982816734 4:159895119-159895141 CACTAGTAGGAGAGGAAGACAGG + Intergenic
982893851 4:160891728-160891750 TACTAGAGGGAGAGGAAGGAAGG + Intergenic
983125915 4:163950256-163950278 CACAAGAGGGAGTCCAAGGGCGG - Intronic
983353495 4:166625148-166625170 CTTAAGAGGGAGGGGAGGGCAGG + Intergenic
983571239 4:169210146-169210168 CATTAGTGAGAGAGGAAGGCAGG - Intronic
983915535 4:173287553-173287575 CCCAAGATGGAGGGAAAGGCTGG + Intronic
984347074 4:178542166-178542188 CACAGGAGAAAGATGAAGGCTGG - Intergenic
984436639 4:179718423-179718445 CACAGGAGAAAGATGAAGGCTGG + Intergenic
985002031 4:185495018-185495040 AATAAAAGGGAGAGGAAGGAAGG + Intergenic
985721788 5:1493340-1493362 CACAGCTGGGATAGGAAGGCTGG - Intronic
985838853 5:2290739-2290761 GAAAAGAGAGAGAGGAAGGAAGG - Intergenic
985969154 5:3361796-3361818 CTAAAGAATGAGAGGAAGGCAGG + Intergenic
986004846 5:3659094-3659116 CACAAGAGTGAGCAGAAGGGTGG + Intergenic
986022646 5:3819423-3819445 CACAAGAGGAACAGAAAGACTGG - Intergenic
986133775 5:4955390-4955412 CACAGGAGGAGGATGAAGGCTGG + Intergenic
986198778 5:5561984-5562006 CACAAGAGGGAATCGAAGGCAGG - Intergenic
986445664 5:7819070-7819092 CACAGGAGGAAGATGTAGGCTGG + Intronic
986800310 5:11253257-11253279 CACAAAAGCCAGAGAAAGGCAGG - Intronic
987122207 5:14778014-14778036 CACAAGTGGCAGAGGCAGGGAGG - Intronic
987254445 5:16135835-16135857 CACAGGAAAGAAAGGAAGGCGGG + Intronic
987683897 5:21171802-21171824 AAAAACAGGGAGAGGAGGGCAGG + Intergenic
987976588 5:25022484-25022506 AGAAATAGGGAGAGGAAGGCTGG + Intergenic
988318876 5:29667201-29667223 AAAAAGAGAGAGAGGAAGGAAGG + Intergenic
988485491 5:31665226-31665248 CACACGGGGAAGAGGCAGGCTGG - Intronic
988655810 5:33210275-33210297 CACAGGAGAAAGATGAAGGCTGG + Intergenic
988965808 5:36416550-36416572 CACAGGAGAAAGACGAAGGCTGG + Intergenic
989826767 5:45865943-45865965 GACAAGAGGGAGAGGGAGAGAGG - Intergenic
989985700 5:50694954-50694976 CACAGGAGAAAGATGAAGGCTGG + Intronic
990224521 5:53634605-53634627 GGGAAGAGGGAGAGGAAGGAGGG - Intronic
990333026 5:54745953-54745975 TACAAGAGGGTGTGGAAGGAGGG - Intergenic
990908202 5:60825857-60825879 TACAAGAATGAGAGGAAGGGTGG + Intronic
991042471 5:62190237-62190259 CACAAGTTGGAGGGGAAGCCTGG + Intergenic
991198574 5:63962389-63962411 AGCTAGAGGGAGAGGAGGGCGGG - Intronic
991288187 5:65004222-65004244 TACAAGAGGCATAGGAAGGAAGG - Intronic
991327584 5:65454106-65454128 CACAACAGAGAGAGGAAGTTGGG - Intronic
991940624 5:71848926-71848948 CACAAGTGAGTGAGGAAGACTGG - Intergenic
992871365 5:81008694-81008716 TACAAAAGGGAGAGGAAGGAGGG - Intronic
993636544 5:90351571-90351593 CACAGGAGAAAGATGAAGGCTGG - Intergenic
994133073 5:96253278-96253300 CACAGGAGGGAGAGGGTGTCTGG + Intergenic
995725816 5:115179662-115179684 CGGAAGATGGAGAGGAGGGCGGG - Intronic
995810169 5:116097803-116097825 AACAAGAGAGAGAGGGAGGAGGG + Intronic
995856811 5:116601164-116601186 CAGAGGAGGGAGAGGAGGGAGGG - Intergenic
995903630 5:117097209-117097231 CACAAGGGGGATGGGAGGGCAGG + Intergenic
996016346 5:118538145-118538167 CACAGGAGGAAGATGGAGGCTGG + Intergenic
996399762 5:123048897-123048919 CACAGGAGGAAGATGAAGCCTGG + Intergenic
996899982 5:128533497-128533519 TACCAGAGGGAGAGGGAGACAGG + Intronic
997183262 5:131855522-131855544 CAAAAGAGAGAGAGGGAGGAAGG + Intronic
997399465 5:133591271-133591293 CAAGACAGGGAGAGGAAGGCAGG + Intronic
997649829 5:135508149-135508171 CAAAAGAGGGGAAGGAGGGCGGG + Intergenic
997730494 5:136169222-136169244 CACAGGAGAAAGATGAAGGCCGG + Intronic
998158913 5:139802112-139802134 AAGAGGAGGGAGAGGAAGGGAGG + Intronic
998232686 5:140371421-140371443 AACAAGAGGAAGAGGAAAGCAGG - Intronic
998254693 5:140575578-140575600 TGCAAGAGGGAGAGGAAGAAAGG + Intronic
998670454 5:144347574-144347596 GACAAGAGGTAGAGGGAGGTTGG + Intronic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
998912232 5:146972413-146972435 CTCAAGAGGGAGATGTTGGCTGG + Intronic
999328774 5:150659200-150659222 CACAGGAGGCAGAAGAATGCAGG - Intronic
999506573 5:152204719-152204741 CAAAAGAGAGAGATCAAGGCTGG + Intergenic
999773867 5:154795472-154795494 CAAGAGAGGGAGAGAAAGGAAGG - Intronic
1000469369 5:161621484-161621506 CACGAGAGAAAGATGAAGGCTGG + Intronic
1001083457 5:168683755-168683777 AGGAAGAGGCAGAGGAAGGCAGG - Intronic
1001142674 5:169158021-169158043 AAGAAGAGGGAGAGAAAGGATGG + Intronic
1001415236 5:171540993-171541015 AGAAAGAGGGAGAGGAAGGAAGG + Intergenic
1001482551 5:172098493-172098515 CACAGGATGCAGAGGAAGGATGG + Intronic
1001564099 5:172688430-172688452 GGAAGGAGGGAGAGGAAGGCAGG + Exonic
1001574751 5:172755954-172755976 TACAAGAGGGAGAGGGAGGAAGG + Intergenic
1001927175 5:175646370-175646392 CACATGAGGGAGAGCAAGCAAGG + Intergenic
1001947015 5:175787707-175787729 CCCAAGAGTGAGAGGTAGGCTGG - Intergenic
1002177415 5:177409105-177409127 TACAAGGGAGAGAAGAAGGCAGG + Intronic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002568690 5:180128222-180128244 CACCCCAGGGAGAGGGAGGCTGG - Intronic
1003691788 6:8362026-8362048 CACGAGAGAAAGACGAAGGCTGG + Intergenic
1003754432 6:9100658-9100680 AGGAAGAGAGAGAGGAAGGCAGG - Intergenic
1003985296 6:11429007-11429029 CCCTAGAGGGAGAGGAGCGCTGG - Intergenic
1004280866 6:14278520-14278542 GAGGAGAGGGAGAGGAAGGTGGG + Intergenic
1004324061 6:14657685-14657707 AACATGAGAGAGAGGAAGACAGG - Intergenic
1004420605 6:15466167-15466189 CAGAGGGGAGAGAGGAAGGCTGG + Intronic
1004673942 6:17823433-17823455 AAAAAGAGAGGGAGGAAGGCAGG - Intronic
1005034663 6:21544560-21544582 GAAAAGTGGGAAAGGAAGGCAGG - Intergenic
1005713647 6:28526155-28526177 TACAAGAAGGAGTGGAGGGCAGG - Intronic
1005837032 6:29717921-29717943 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1005991908 6:30908465-30908487 GCGAAGAGTGAGAGGAAGGCAGG + Intronic
1006359953 6:33581849-33581871 CACAAAAGGGAGGCCAAGGCAGG + Intergenic
1007400169 6:41598815-41598837 CAGCAGAGGCAGAGGAAGACAGG + Exonic
1007877068 6:45116210-45116232 GAGAAGAAGGAGAGGAAGGGAGG - Intronic
1008820712 6:55627719-55627741 CACAAGAGAAAGATGTAGGCTGG - Intergenic
1008926785 6:56895989-56896011 CATGAGAGGGAGAGGGAGACGGG + Intronic
1009315149 6:62209779-62209801 CACAGGAGAAAGATGAAGGCTGG - Intronic
1009418595 6:63441532-63441554 CACAAGTGGGAGAGGCAGCAGGG + Intergenic
1010017352 6:71120971-71120993 CTTAAGAGAGAGAAGAAGGCCGG - Intergenic
1010323881 6:74543063-74543085 CACAAGAGAAAGATGTAGGCTGG - Intergenic
1010678930 6:78776650-78776672 CACAAGAGAGAGGAGAAGTCAGG - Intergenic
1011206347 6:84903475-84903497 CACAAGAGAAAGATGTAGGCTGG + Intergenic
1011324099 6:86129925-86129947 CAGAAGTGGCAGTGGAAGGCTGG - Intergenic
1012152600 6:95773480-95773502 CAAAAGAGGAAGAAGAAGGGGGG - Intergenic
1012227772 6:96724468-96724490 CACAGGAGAAAGATGAAGGCCGG + Intergenic
1012351564 6:98257687-98257709 CACAGGAGAAAGACGAAGGCTGG - Intergenic
1012533557 6:100268068-100268090 CAGGAGAGGAAAAGGAAGGCTGG - Intergenic
1012550511 6:100461047-100461069 CACAGAAGGGAGAGAAAGGAGGG + Intronic
1012551834 6:100470149-100470171 CAAAAAAGGGAGAGGAAGCCGGG + Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012649980 6:101740691-101740713 CACAAGAAGCAGAGGCTGGCTGG - Intronic
1012889889 6:104885807-104885829 CACAAGAGGGAGGCCAAGGTGGG + Intergenic
1012900820 6:105004087-105004109 CACAGGAGAAAGATGAAGGCTGG + Intronic
1012953869 6:105547840-105547862 CTAAAGAAGGAGAGGAAGGAAGG + Intergenic
1013462660 6:110390165-110390187 CCCAAGATGGCGAGGAAGGAAGG + Intergenic
1014005665 6:116414869-116414891 CACAAGAGTGAGAGTCTGGCTGG - Intronic
1014113977 6:117652052-117652074 CACAGGAGAAAGATGAAGGCTGG + Intergenic
1014764408 6:125390099-125390121 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1014851411 6:126343694-126343716 CACGGGAGAGAGATGAAGGCTGG + Intronic
1015435586 6:133182751-133182773 CAAAAGAAGGAAAAGAAGGCAGG - Intergenic
1015753682 6:136586854-136586876 CACAAGAGAAAGATGTAGGCTGG - Intronic
1015765284 6:136709822-136709844 CTCAAGAGGCAGAGGCAGGAGGG + Intronic
1015999836 6:139030738-139030760 CAAAAGAGGAAGAGGAAGCGGGG + Intronic
1016041986 6:139441158-139441180 CACAATAGTGGGAGGAAAGCAGG + Intergenic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1016439997 6:144073718-144073740 CAGGAGAGTGAAAGGAAGGCAGG - Intergenic
1016553180 6:145305672-145305694 CACAGGAGAGAGATGTAGGCTGG + Intergenic
1016734705 6:147464707-147464729 AAGAATAGGGAGAGGAAGGAAGG - Intergenic
1016767577 6:147812022-147812044 CTAAAGAGGCAGAGGAGGGCAGG + Intergenic
1016938390 6:149465456-149465478 GTCAAAAGGAAGAGGAAGGCCGG + Intronic
1017587705 6:155945539-155945561 CGCAAGAGGGAGGGGATGGCAGG - Intergenic
1017713944 6:157194875-157194897 CTCAAGAGGTTGAGGAAGGCAGG + Intronic
1017862967 6:158416091-158416113 CACGGGAGAGAGATGAAGGCTGG + Intronic
1018107768 6:160505336-160505358 CACAAGAGAAAGACGTAGGCTGG + Intergenic
1018299392 6:162384925-162384947 AACAAAAGGGAGGGGAAGGCAGG - Intronic
1018537304 6:164835165-164835187 AACAAGAGAGAGAGAAAGGCAGG + Intergenic
1018592468 6:165442513-165442535 CAGAAGAGGGAGTGCAAGGCGGG + Intronic
1018931586 6:168243601-168243623 GAGAGGATGGAGAGGAAGGCTGG - Intergenic
1018931594 6:168243641-168243663 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1018931602 6:168243681-168243703 GAGAGGAAGGAGAGGAAGGCTGG - Intergenic
1018931608 6:168243717-168243739 GAGAGGATGGAGAGGAAGGCTGG - Intergenic
1019076804 6:169394422-169394444 CCCAAAAGGGAGAGAGAGGCGGG + Intergenic
1019516393 7:1442068-1442090 GATGAGACGGAGAGGAAGGCGGG + Intronic
1019596124 7:1859184-1859206 CACACCAGGGGGAGGCAGGCTGG - Intronic
1019764911 7:2843396-2843418 CACTTGAGGGAGACCAAGGCAGG + Intronic
1019822801 7:3258070-3258092 CAGAAGAGGGCGAGGGAGGGAGG + Intergenic
1020046421 7:5044377-5044399 GAAAAGAGAGAGAGGAAGGAGGG - Intronic
1020742873 7:12043889-12043911 CACAGGAGAAAGATGAAGGCCGG + Intergenic
1021286377 7:18786497-18786519 TACATGAGAGAGAGGAAGGAAGG - Intronic
1022078451 7:26996860-26996882 CACAGGAGGAAGATGTAGGCTGG - Intergenic
1022181631 7:27926109-27926131 CTCAAGATGGAGAGGAAGGCTGG + Intronic
1022357014 7:29625667-29625689 AAGAAGAGAGAGAGGAAGGAAGG + Intergenic
1022500482 7:30879527-30879549 CTGAGGTGGGAGAGGAAGGCAGG - Intronic
1023185451 7:37528521-37528543 AACAAGACGGGGAGAAAGGCTGG + Intergenic
1023294060 7:38696952-38696974 AGCATCAGGGAGAGGAAGGCAGG + Intergenic
1023549799 7:41357478-41357500 CACAACAGGGAGATGATGGGTGG - Intergenic
1023888545 7:44377045-44377067 CACAGGAGGGACAGGGAGGGAGG - Intergenic
1024205483 7:47156020-47156042 CACAGGAAAGAGATGAAGGCTGG + Intergenic
1024268284 7:47622902-47622924 AAGAAGAGAGAGAGGAAGGTTGG - Intergenic
1024431381 7:49291981-49292003 CACGAGAGGGAGATGAAGGCTGG + Intergenic
1025123227 7:56323880-56323902 CACTGGAGTGAGAGGAAGGAAGG - Intergenic
1026227160 7:68452626-68452648 CACACTAAGGAGTGGAAGGCTGG + Intergenic
1026392071 7:69912038-69912060 CACAAGAGGGAGGCCAAGGTAGG - Intronic
1026484709 7:70808085-70808107 AACAAGAGGAAGAAGAGGGCTGG + Intergenic
1026530357 7:71192131-71192153 CACGAGAGAAAGATGAAGGCCGG + Intronic
1026726991 7:72877866-72877888 AAAAAGAGAGAGAGGAAGGAAGG - Intergenic
1026876020 7:73879542-73879564 CCCAGGAAGGAAAGGAAGGCAGG - Intergenic
1026890721 7:73980342-73980364 CAGAACAGGGAGATGAAAGCTGG + Intergenic
1027116843 7:75487760-75487782 AAAAAGAGAGAGAGGAAGGAAGG + Intergenic
1027235030 7:76293077-76293099 CTCAACTGAGAGAGGAAGGCAGG - Intergenic
1027274964 7:76547838-76547860 AAAAAGAGAGAGAGGAAGGAAGG - Intergenic
1027785667 7:82576356-82576378 CTCAAGAGGGAGACTGAGGCGGG - Intergenic
1027807864 7:82852451-82852473 CACTAGAGAAAGATGAAGGCCGG - Intronic
1028538521 7:91916370-91916392 CACAAGCAGGAGACGAAGACAGG - Intergenic
1028608116 7:92678420-92678442 CAGGAGGGGGAGCGGAAGGCAGG + Intronic
1028846423 7:95485953-95485975 TTCCAGAGGGAGAGGAAGGATGG + Exonic
1028990194 7:97040913-97040935 CACTAGAGGTGTAGGAAGGCAGG - Intergenic
1029880068 7:103798867-103798889 CACAGAAGCGGGAGGAAGGCTGG - Intronic
1030210821 7:106994036-106994058 CTCAAGAAAGAGAGGAAGCCTGG - Intergenic
1030272624 7:107686385-107686407 AAAAAGAGAGAGAGGAAGGAAGG - Intronic
1030300382 7:107968552-107968574 TAAAAGTGGGAGAGGCAGGCAGG + Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030406497 7:109121282-109121304 CACAAGAGTGGGAGGAGGGAGGG - Intergenic
1030464745 7:109886594-109886616 CAGAAGAGGAAAAGGAAGGTGGG - Intergenic
1030532699 7:110730329-110730351 CACGGGAGGAAGATGAAGGCCGG - Intronic
1030810950 7:113971385-113971407 CACGAGAGAAAGATGAAGGCCGG + Intronic
1030992739 7:116319852-116319874 AAAAAGAGAGAGAGGAAGGAAGG + Intronic
1031196872 7:118627077-118627099 CACCAGAGAGTGAGCAAGGCAGG - Intergenic
1031537149 7:122948959-122948981 AACAAGAGGGAGAGGGAGGGAGG - Intergenic
1031643433 7:124193567-124193589 CACAGGAGAAAGATGAAGGCTGG + Intergenic
1031863690 7:127013427-127013449 CACAAAGGGGAAAGGAAGGCAGG + Intronic
1031950028 7:127882345-127882367 CATAGGAGGGGAAGGAAGGCAGG + Intronic
1032097409 7:128946475-128946497 CACAGCAGGGAGAGAAAAGCAGG - Intronic
1032674978 7:134121520-134121542 GACAACAGTGAGCGGAAGGCAGG - Intergenic
1032798963 7:135302876-135302898 AAAAAGAGAGAGAGGAAGGAAGG + Intergenic
1032837449 7:135687217-135687239 TAGAAGAGAGAGAGGAAGGGAGG - Intronic
1033529059 7:142244985-142245007 CACAATAGGGAGAGGAAGAAAGG + Intergenic
1033653085 7:143356511-143356533 CTCAGGTGGGAGTGGAAGGCAGG + Exonic
1034008080 7:147496880-147496902 GCCAAGAGGGAGAGGAAAGGAGG - Intronic
1034082385 7:148291461-148291483 CACAAGAGAAAGATGTAGGCTGG + Intronic
1034461786 7:151201688-151201710 CTTGAGAGAGAGAGGAAGGCGGG + Intronic
1035259347 7:157651892-157651914 CAGAGGAGGGAGAGGCAGGAAGG - Intronic
1035688138 8:1540432-1540454 AAAGAGAGGGAAAGGAAGGCAGG + Intronic
1035724793 8:1817709-1817731 GGCAGGAGGGAGGGGAAGGCAGG + Intergenic
1036186375 8:6625968-6625990 CAGAGGAGGGAAAGGAAGGTGGG + Intronic
1036416048 8:8549578-8549600 TACAACAGAGAGAGGAAGGAGGG + Intergenic
1036826710 8:11982447-11982469 TACAAGAGTGAGAAAAAGGCAGG + Intronic
1037367006 8:18133655-18133677 GACAAGAGGGAGAGAAATTCTGG - Intergenic
1037459539 8:19095185-19095207 CACTAGAGGGGAAGGAAGACAGG - Intergenic
1037904252 8:22706109-22706131 GAAGAGAGGGATAGGAAGGCTGG - Intergenic
1038117921 8:24578843-24578865 CATAAGTGGGAGTTGAAGGCTGG + Intergenic
1038137295 8:24801570-24801592 CAAAAGAAGGAGGGGAAGGAAGG + Intergenic
1038236198 8:25758955-25758977 CACACGTGGGTGAGGAGGGCGGG - Intergenic
1038846880 8:31238189-31238211 CAGAAGAGGAAGAGGAAGAGGGG - Intergenic
1039175388 8:34798543-34798565 AATAAGAGGGAAAGGAAGGAAGG - Intergenic
1039498416 8:37998496-37998518 CACACGAGGGAGAGGAGGTTTGG - Intergenic
1039977572 8:42380430-42380452 AAGAAGAGAGAGAGGAAGGAAGG + Intergenic
1040395001 8:46989808-46989830 CACAGGAGAAAGAGGTAGGCTGG + Intergenic
1040568641 8:48589120-48589142 GCCAAGAGGGAGAAGAAGGGTGG - Intergenic
1040654247 8:49486416-49486438 CAGAAAAGGGAGAGGCAAGCTGG - Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1041935622 8:63328576-63328598 CACAAGAGAAAGATGTAGGCTGG - Intergenic
1042363898 8:67914542-67914564 AAAAAGAAGGGGAGGAAGGCTGG - Intergenic
1042379642 8:68098041-68098063 AACAAGATGGAGAGGAAGGAAGG + Intronic
1042494420 8:69440317-69440339 TACAGGAGGGAGTGGAAGGGAGG + Intergenic
1042873679 8:73420603-73420625 CACAACAGGGAGTGGAATCCGGG + Exonic
1042890821 8:73608497-73608519 CTCAGGAGGCTGAGGAAGGCAGG + Intronic
1043614026 8:82103414-82103436 CACGGGAGGAAGATGAAGGCTGG - Intergenic
1044070191 8:87750973-87750995 CACAAAAGGAAGAGGCAGTCAGG - Intergenic
1044247410 8:89965207-89965229 AAGAAGAGAGAGAGGAAGGACGG + Intronic
1044647983 8:94464885-94464907 CACAAGAGGGAGAGCAAAAGAGG + Intronic
1044832875 8:96267452-96267474 CACTGGAGGGAGGGGAAGCCAGG - Intronic
1045048255 8:98299769-98299791 AAAAAGAGAGAGAGGAAGGAAGG + Intergenic
1045233943 8:100333167-100333189 GACAAGAGGAAGAGCAAGACAGG - Intronic
1045936131 8:107681575-107681597 CAAAAGAGGGAAGGGAAGGAGGG - Intergenic
1046029541 8:108766910-108766932 CACAGGAGAAAGATGAAGGCCGG + Intronic
1046103872 8:109644589-109644611 CACTGGAGGGCGGGGAAGGCGGG - Intronic
1046877048 8:119266672-119266694 GACAGCAGGGAGAGGAAGGAAGG + Intergenic
1047160330 8:122370949-122370971 CACGAGAGAAAGATGAAGGCTGG - Intergenic
1047254502 8:123205683-123205705 AGCAAGAGGGAGAGGATGGTCGG - Intronic
1047698745 8:127429458-127429480 CCCAAGTGGGATAGGTAGGCAGG - Intergenic
1047753136 8:127897585-127897607 GAAGAGAGGGAGAGGAAGGAAGG + Intergenic
1047970734 8:130082100-130082122 CTGAAGAGGGAGAGGCTGGCAGG + Intronic
1048178348 8:132172692-132172714 CCCTGGAGGGAGAGGCAGGCAGG + Exonic
1048522147 8:135166388-135166410 CCCAAGAGAGAGAGGGAGGGTGG - Intergenic
1048753958 8:137713829-137713851 CACAAGAGAAAGATGTAGGCTGG - Intergenic
1048952813 8:139510185-139510207 CACAGGAGAAAGATGAAGGCTGG + Intergenic
1049307740 8:141915204-141915226 GACAAGAGGGAGATGAAAGGAGG + Intergenic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049371806 8:142271488-142271510 CCGAAGAGGGCGGGGAAGGCTGG + Intronic
1049400484 8:142424565-142424587 CACAGGAGGGAGAACAAAGCGGG - Intergenic
1049416762 8:142498948-142498970 CAAGAGAGGGAGAGAGAGGCTGG - Intronic
1049425402 8:142535826-142535848 TCCATGAGGGAGAGGATGGCAGG + Intronic
1049537494 8:143189098-143189120 CACAGCAGGGAGAGGTAGGAGGG - Intergenic
1049549206 8:143248936-143248958 CTCATGAGGGAGAGGAGGGAAGG + Intronic
1049861245 8:144901028-144901050 GGCACGAGGGGGAGGAAGGCCGG + Intronic
1050352614 9:4754706-4754728 AAGAAGAGAGAGAGGAAGGAAGG - Intergenic
1050531211 9:6591252-6591274 CACAAGAGGGAAAGGAAGATGGG - Intronic
1050771470 9:9206663-9206685 CACAAAAGACAGATGAAGGCAGG - Intronic
1051002254 9:12297774-12297796 CACAGGAGAAAGATGAAGGCTGG - Intergenic
1051011221 9:12416710-12416732 CACAGGAGAAAGATGAAGGCTGG + Intergenic
1051029656 9:12658712-12658734 CACGAGAGGGAGGCCAAGGCGGG - Intergenic
1051681392 9:19611375-19611397 GAGATGAGGGAGAGGAAGGAGGG + Intronic
1051999934 9:23266150-23266172 CACAACAGTCAGAGGAATGCTGG - Intergenic
1052355148 9:27496432-27496454 CAAAAGAGCCATAGGAAGGCAGG - Intronic
1052743384 9:32415717-32415739 CAAAAGAGGGAGAGAAAGGAGGG - Intronic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053462660 9:38282506-38282528 CACATGAGGCATAGGAAGGAGGG + Intergenic
1053862785 9:42404291-42404313 CACAGGAGAAAGATGAAGGCTGG - Intergenic
1054840352 9:69731724-69731746 GAAAAGGGGGAGAGGAGGGCAGG - Intronic
1055021100 9:71670723-71670745 TACAAAATGAAGAGGAAGGCTGG - Intergenic
1055296599 9:74839844-74839866 GAGAAGAGAGAGAGGAAGGAAGG + Intronic
1055317404 9:75047961-75047983 CAGAAGAGGAAGAGGAAGTCAGG - Intergenic
1055713108 9:79086982-79087004 AAAAAGAGAGAGAGGAAGGAAGG + Intergenic
1055861507 9:80755518-80755540 CACAAGAGGGAGCTGAAGTAGGG + Intergenic
1055903611 9:81268619-81268641 CACAAGAGAAAGATGTAGGCTGG + Intergenic
1056204038 9:84303300-84303322 CTAAAGAGGGAGAGGGAGTCTGG - Intronic
1056648910 9:88440897-88440919 CACAAAGGGGAGGGGAAGGGAGG - Intronic
1056731530 9:89170117-89170139 CTCAAGAGGGAGAGGCAGCAAGG + Intronic
1056839923 9:89990336-89990358 CCCAAGAGTGACAGGAAGGAGGG - Intergenic
1057023038 9:91715329-91715351 CACAAGCTGCAGAGGAACGCAGG + Intronic
1057274703 9:93670178-93670200 GAGCAGAGGGAGAGGACGGCAGG + Intronic
1057694450 9:97313413-97313435 CTGGAGAGGGGGAGGAAGGCTGG - Intronic
1057885703 9:98828055-98828077 CCCAGGTGGGAGAGGAAGGAAGG + Intronic
1057930021 9:99185141-99185163 CTCAAGGGCGAGAGGGAGGCAGG + Intergenic
1058646425 9:107135345-107135367 GACAAGAGGGAAAGGGAGGAAGG + Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059233923 9:112746295-112746317 TAAAAGAGAGAGAGAAAGGCTGG + Intergenic
1059408399 9:114116603-114116625 CACAAGTGGGAGAGGAACCGTGG - Intergenic
1059428649 9:114236838-114236860 CACAGCAGGGAAAGGAAGGAAGG + Intronic
1059582463 9:115566691-115566713 AAAAAGAGAGAGAGGAAGGAAGG - Intergenic
1059760325 9:117331279-117331301 CAGAAGGGAAAGAGGAAGGCAGG - Intronic
1060031958 9:120222253-120222275 CACAAGAGAGAAAGGGAAGCAGG - Intergenic
1060397971 9:123329427-123329449 CCCAGGAGGAAGAGAAAGGCTGG - Intergenic
1060992668 9:127857748-127857770 CACAAGAGGGAGAGTGCAGCTGG - Intergenic
1061175779 9:128995797-128995819 CACAAGAGGCAGATGCAGCCAGG - Intronic
1062135905 9:134928252-134928274 CACAGGAGAAAGATGAAGGCTGG - Intergenic
1062182618 9:135198722-135198744 CACCAAAGGGAGAGCAAGCCAGG + Intergenic
1062321855 9:135994108-135994130 CACAAGAGGGAAGGGCGGGCAGG - Intergenic
1062533483 9:137011643-137011665 AGGAAGAGGGAGAGGACGGCAGG + Exonic
1062635503 9:137488523-137488545 CAAAGGATGGAGAGGAAGGCAGG + Intronic
1185512746 X:675708-675730 TCCAGGAGGGAGGGGAAGGCAGG - Intergenic
1185538357 X:882046-882068 AAAAAAAAGGAGAGGAAGGCTGG - Intergenic
1185815750 X:3153715-3153737 AGCAAGAGGGAGAGAGAGGCAGG + Intergenic
1185895407 X:3854163-3854185 AAAAAGAGGGAGAAGAAGGAAGG - Intergenic
1185900524 X:3892587-3892609 AAAAAGAGGGAGAAGAAGGAAGG - Intergenic
1185905640 X:3931018-3931040 AAAAAGAGGGAGAAGAAGGAAGG - Intergenic
1185958493 X:4519205-4519227 CACAGGAGAAAGATGAAGGCTGG + Intergenic
1186065378 X:5758163-5758185 CACAGGAGAAAGATGAAGGCTGG - Intergenic
1186105091 X:6196913-6196935 CTGAGGAGGGAGAGAAAGGCAGG + Intronic
1186501345 X:10053184-10053206 CCCAAGAGGAAGAGGAAGCAGGG + Intronic
1187149445 X:16668600-16668622 AAAAAGAGAGAGAGGAAGGAGGG + Intronic
1187642702 X:21312515-21312537 CACAGGAGAAAGATGAAGGCTGG - Intergenic
1187728171 X:22225204-22225226 TACAAGAGGAAAAGGGAGGCAGG - Intronic
1188521068 X:31038448-31038470 CACAAGAGGCACAGAAGGGCTGG + Intergenic
1189704586 X:43747367-43747389 CCTAAGAGGGTGAGGAAGGTAGG + Intergenic
1189775243 X:44464722-44464744 AAAAAGAGGAAGAAGAAGGCAGG + Intergenic
1190087122 X:47405089-47405111 CACAAGAAGAAGGGGGAGGCCGG + Intronic
1190180080 X:48184680-48184702 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190184034 X:48219391-48219413 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190189961 X:48268840-48268862 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190193097 X:48293900-48293922 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190197188 X:48329533-48329555 CACCAGAGGGAGAGGGTGCCAGG + Intergenic
1190199070 X:48344879-48344901 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190204895 X:48394778-48394800 CACCAGAGGGAGAGGGTGCCTGG + Intergenic
1190205641 X:48400625-48400647 CACCAGAGGGAGAGGGTGCCTGG - Intergenic
1190248303 X:48705152-48705174 CACATGAGGGTGAGCAAGGAAGG + Intronic
1190524680 X:51316933-51316955 CACGAGAGAAAGATGAAGGCCGG - Intergenic
1190658715 X:52635345-52635367 CACCAGAGGGAGAGGATGCCAGG + Intergenic
1190659602 X:52642513-52642535 CACCAGAGGGAGAGGGTGCCAGG - Intergenic
1190663925 X:52679911-52679933 CACCAGAGGGAGAGGGTGCCAGG + Intronic
1190665829 X:52695349-52695371 CACCAGAGGGAGAGGGTGCCTGG - Intronic
1190673589 X:52763061-52763083 CACCAGAGGGAGAGGGTGCCTGG + Intronic
1190675497 X:52778511-52778533 CACCAGAGGGAGAGGGTGCCAGG - Intronic
1190677124 X:52791831-52791853 CACCAGAGGGAGAGGATGCCAGG + Intergenic
1190871102 X:54425368-54425390 CACAAGATTAAAAGGAAGGCTGG + Intergenic
1191718927 X:64213143-64213165 CACAGGAGAATGAGGAAGGCTGG + Intergenic
1192432830 X:71124307-71124329 CATCAAAGGGAGAGGGAGGCCGG - Exonic
1192434666 X:71135887-71135909 AGAAAGAGAGAGAGGAAGGCAGG - Intronic
1193468785 X:81875621-81875643 AACAAGAGTGAGAGGGAGCCTGG - Intergenic
1193568524 X:83111303-83111325 CACAAGAGAAAGATGGAGGCCGG + Intergenic
1193713570 X:84908237-84908259 CATATGAGGGAGAGGGAGGAGGG + Intergenic
1193904172 X:87223033-87223055 CACAAGAGAAAGATGTAGGCTGG - Intergenic
1194052424 X:89087797-89087819 CACAGGAGGAAGATGTAGGCTGG - Intergenic
1195854003 X:109310933-109310955 CACAAGAGGTTGAGGATGGCAGG - Intergenic
1195964577 X:110418533-110418555 AACATGAACGAGAGGAAGGCCGG + Intronic
1196715165 X:118803913-118803935 AAAAAGAGAGAGAGGAAGGAAGG - Intergenic
1196721827 X:118861668-118861690 CAAAATAGGAAGAGGAAGACGGG - Intergenic
1197405588 X:126044117-126044139 CAAAAGAGAGAGAGAAAGACAGG + Intergenic
1198959372 X:142168204-142168226 GACAAGAGAGAGAGGAAAGATGG + Intergenic
1199613588 X:149637778-149637800 CACAAGAGAAAGATGTAGGCTGG + Intergenic
1199645011 X:149899954-149899976 GACAGGAGGCAGTGGAAGGCTGG - Intergenic
1199794748 X:151183287-151183309 CACAGGAGTGAGAGGCAGGAGGG + Intergenic
1201146461 Y:11067637-11067659 GACAGGAGGGAGCGGAAGGGAGG + Intergenic
1201550345 Y:15211629-15211651 TGCAAGAGGGAGAGGGAGGGAGG + Intergenic
1201550452 Y:15212133-15212155 TGCAAGGGAGAGAGGAAGGCAGG + Intergenic