ID: 1170845310

View in Genome Browser
Species Human (GRCh38)
Location 20:19957190-19957212
Sequence CAAGTTGGATGGCTGGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170845310 Original CRISPR CAAGTTGGATGGCTGGACCT TGG (reversed) Intronic
900982045 1:6051439-6051461 CAGGCTGGATGGCTGGCCCTGGG - Intronic
901423406 1:9165769-9165791 TAAGATGGATGGCTGGAGCCGGG - Intergenic
901869167 1:12127348-12127370 CAAGGTGGACGGCTGGCCCAGGG + Intronic
903580826 1:24369348-24369370 CAAGTTGGCTGTGTGGACTTGGG + Intronic
912872837 1:113325971-113325993 CAAGTTTGATGATTGGTCCTTGG - Intergenic
913075378 1:115337500-115337522 CAAGTGGCAGGGCTGAACCTTGG + Intronic
921898143 1:220422609-220422631 CAAGAAGGATGGCTGGATATTGG - Intergenic
922872410 1:228913934-228913956 CAGGTTAAATGGCTTGACCTGGG - Intergenic
1062854387 10:772426-772448 CAAGTGGGTTGGCTGGGGCTTGG + Intergenic
1063219240 10:3950837-3950859 CCAGTTTGCTGGCTGCACCTTGG + Intergenic
1064199697 10:13274099-13274121 CCAGTTGGGTTGCTGGACTTGGG + Intergenic
1068716719 10:60196942-60196964 GAAGTTGGAGAGCTGGATCTGGG + Intronic
1071522754 10:86341202-86341224 TAAGTTGAAAGGATGGACCTGGG - Intronic
1072903174 10:99427663-99427685 CAAGTCACATGGCTGGACCACGG + Intronic
1073096480 10:100983362-100983384 CAGGTTGGATGGCTGGTCACAGG - Exonic
1074237911 10:111604610-111604632 TAACTGGGATGGCTGGAGCTTGG + Intergenic
1074365312 10:112853118-112853140 CAGGTTGCCTGGCTGTACCTTGG - Intergenic
1074858841 10:117494072-117494094 TAATTTTGATGGCTGGACTTAGG + Intergenic
1076252463 10:128995228-128995250 AAAGTTGGATTTCAGGACCTGGG + Intergenic
1077603026 11:3586974-3586996 CAAGATGGTTGGCTGGACCAAGG + Intergenic
1077703581 11:4463211-4463233 GAGGTTGGATGGATGGCCCTCGG - Intergenic
1078778533 11:14415454-14415476 CAAGTTGAATGCCTGGAACGGGG + Intergenic
1084258906 11:67961512-67961534 CAAGATGGTTGGCTGGACCAAGG + Intergenic
1084589737 11:70083814-70083836 AAAGCTGGATGGCAGGACCCCGG - Intronic
1084813843 11:71633666-71633688 CAAGATGGTTGGCTGGACCAAGG - Intergenic
1085415354 11:76315819-76315841 CAAGAAGGATGGCTGCAGCTAGG + Intergenic
1086070818 11:82797152-82797174 CAAGCTCCATGGCTGGCCCTGGG + Intergenic
1089461399 11:118656291-118656313 CAAGTAGGATGCCAGGCCCTGGG - Intronic
1090244227 11:125204217-125204239 CAAGTTGGGTAGCAGGGCCTTGG + Intronic
1090922280 11:131216834-131216856 CCAGATGGATGCCTGGACCTAGG + Intergenic
1091640579 12:2233971-2233993 CAAGTGGGAAGGGTGGACCTGGG - Intronic
1092430231 12:8402520-8402542 CAAGTTGGTTGGCTGGACCAAGG + Intergenic
1095943957 12:47743563-47743585 CCAGGAGGATGGCTGGACCAAGG - Exonic
1096910015 12:54974054-54974076 CAAGCTGGATGCCTGGACTCTGG - Intronic
1097176966 12:57148913-57148935 GAAGTTGGCCAGCTGGACCTGGG - Intronic
1101990738 12:109482473-109482495 AAAGTCGGATGGCTAGAACTAGG - Intronic
1103963025 12:124621384-124621406 CCAGCTGGAAGGCTGTACCTGGG - Intergenic
1106382577 13:29254439-29254461 CAAGTTGACTTGATGGACCTTGG + Intronic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1115025977 14:28746783-28746805 CAAGTGAGATGGTTGGACTTAGG - Intergenic
1118442609 14:65825949-65825971 TCAGTTGGATGGCTGTAGCTGGG + Intergenic
1121988403 14:98530137-98530159 CATCCTGGATGGCTGGACCATGG - Intergenic
1130554675 15:84914457-84914479 CAAGGGGCATGGCAGGACCTTGG + Intronic
1132244266 15:100281781-100281803 CAAGGTGGATAACTGGACCAAGG + Intronic
1133365956 16:5210353-5210375 GAAGATGGTTGGCTGGACCAAGG - Intergenic
1137752502 16:50877276-50877298 AAAGTTGGAGGAATGGACCTAGG - Intergenic
1137956300 16:52834135-52834157 GAAGTTGGATGGCTTGCCCAAGG - Intergenic
1138591553 16:58001789-58001811 CAAGTTGGGAGGCCAGACCTGGG + Intronic
1140104823 16:71950176-71950198 GAAGTTGGCTGGCTGCATCTAGG + Exonic
1142115302 16:88353209-88353231 CGAGTGAGAGGGCTGGACCTGGG - Intergenic
1143068391 17:4267726-4267748 CAAGTTGCATGGCTGGGATTCGG - Intergenic
1143893890 17:10122016-10122038 GAAGTTGTATGGCTGGCCTTCGG - Intronic
1144484261 17:15651859-15651881 GAAGTTTCAGGGCTGGACCTGGG - Exonic
1146288084 17:31588090-31588112 CAATGTGGATGGGTGGCCCTGGG + Intergenic
1146454859 17:33001658-33001680 AAAGATGGATGGTTGGACCATGG - Intergenic
1146772030 17:35577959-35577981 AAAGATGGATGGCTGGTCATCGG + Exonic
1148194018 17:45700308-45700330 CAATTTGGAAGGCTGGTTCTTGG - Intergenic
1152357956 17:79815671-79815693 CAAGGCGGCTGGCTGGACGTGGG - Intergenic
1152900175 17:82936673-82936695 CCTGTTGGGTGGCTGGAGCTTGG + Intronic
1153542660 18:6172566-6172588 CCAGTAGGATGGCTGGACCTGGG - Intronic
1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG + Intergenic
1156456885 18:37299828-37299850 CATGCTGGCTGGCTGGACCCTGG - Intronic
1156871124 18:41946413-41946435 CCAGTTCTATGGCTGGCCCTTGG + Intergenic
1157162492 18:45326747-45326769 CAGGTTGGATGAGTGGACTTAGG + Intronic
1157606187 18:48927346-48927368 GAAGTGAGATGGCTGGACTTGGG + Intronic
1157803413 18:50639224-50639246 CAAGCTGGATGACTGGAAATGGG + Intronic
1157868247 18:51205108-51205130 TAACTGGGATGGCTGGGCCTTGG - Intronic
1158259755 18:55593551-55593573 CAAGTGGGATGACTGGGCCAAGG + Intronic
1161920880 19:7264867-7264889 CATGTTGGATGGTTGGAAATCGG - Intronic
1164758246 19:30707109-30707131 AAAATTGGATGGCTGAATCTTGG + Intronic
925310553 2:2878667-2878689 TCAGTGGGATGGCTGGACTTTGG - Intergenic
927714584 2:25343237-25343259 CAAGTAGGATGGCGGGTCCCTGG - Intergenic
930745608 2:54880296-54880318 CAAATTGTATTGCTGGGCCTTGG - Intronic
930763744 2:55062940-55062962 CAAGCATGATGGCTGGAACTGGG + Intronic
932162563 2:69475260-69475282 AAAGTTGGTTGGCTAGAGCTGGG + Exonic
935208078 2:100913962-100913984 CAAGATGCATGGCTGTAGCTGGG - Intronic
937201479 2:120206994-120207016 CAAGCCCCATGGCTGGACCTGGG + Intergenic
945049033 2:205806172-205806194 CAAGATGGATGGCTCTGCCTGGG + Intergenic
945492990 2:210477554-210477576 CCAGTTGGAGGTCTGGAGCTAGG - Intronic
946699594 2:222398549-222398571 CATGTTGATTGGTTGGACCTGGG + Intergenic
947926191 2:233924556-233924578 CAAGTTGGTTGACTGGGTCTTGG - Intronic
948722968 2:239912918-239912940 CAGCTTGGCTGGCTGGACCAAGG - Intronic
1170845310 20:19957190-19957212 CAAGTTGGATGGCTGGACCTTGG - Intronic
1173667650 20:44774191-44774213 CACGTGGGATGGATGGATCTTGG - Intronic
1173926915 20:46787609-46787631 CTAGTTGGTTGGATGGACGTGGG - Intergenic
1173967234 20:47121888-47121910 CAAGTTTGAGGGCTGGGCCAGGG - Intronic
1174145768 20:48451519-48451541 CAGGTTGGATGGCGCCACCTTGG + Intergenic
1174268789 20:49351693-49351715 CAGCCTGGATGGCTGGGCCTAGG - Intergenic
1175531678 20:59677448-59677470 GAAGTTGGATGTCTGGAGTTGGG + Intronic
1176368997 21:6051426-6051448 TAAGATGGGTGGATGGACCTGGG + Intergenic
1176848038 21:13891550-13891572 CAGGTTGGATGGCTGGGGGTTGG - Intergenic
1179754522 21:43487115-43487137 TAAGATGGGTGGATGGACCTGGG - Intergenic
1184058504 22:42067877-42067899 CAGGATGGATGGCGGGACATGGG - Exonic
1184974364 22:48050744-48050766 GAAGCTGCATGGCTGGACCTGGG + Intergenic
950370203 3:12522921-12522943 CAAGGTGCCTGGCTGGCCCTAGG - Intronic
957073860 3:75586032-75586054 CAAGATGGTTGGCTGGACTAAGG + Intergenic
959175064 3:102898030-102898052 GAAGTTGGATTGCTGGATCATGG + Intergenic
960534875 3:118804509-118804531 CAAGTTTTATAGCTGTACCTAGG + Intergenic
961280227 3:125760688-125760710 CAAGATGGTTGGCTGGACCAAGG - Intergenic
961874178 3:130008859-130008881 CAAGATGGTTGGCTGGACCAAGG + Intergenic
963851497 3:150215073-150215095 AGAGTTGAATGGCTGGATCTTGG + Intergenic
968898904 4:3421585-3421607 TCAGTTGCATGGCTGGCCCTTGG + Intronic
969017444 4:4113342-4113364 CAGGATGGTTGGCTGGACCAAGG + Intergenic
969736501 4:8994963-8994985 CAAGATGGTTGGCTGGACCAAGG - Intergenic
969795694 4:9526526-9526548 CAAGATGGTTGTCTGGACCAAGG - Intergenic
977025434 4:91813055-91813077 CAAGTTGGGTGGTTGGAACTTGG - Intergenic
977918659 4:102620539-102620561 CAAGTTGGAAGCCTGGAGCATGG - Intergenic
978661174 4:111128367-111128389 CAAGTTTGATAGGTGGACCTGGG - Intergenic
980159140 4:129138521-129138543 GAAGTTGCATTGATGGACCTGGG - Intergenic
990671177 5:58131817-58131839 CAAGTTTGAAGGCTGGACCGTGG - Intergenic
991486952 5:67147117-67147139 CAAAATGCATGGCAGGACCTAGG - Intronic
1003882517 6:10491331-10491353 CAAGGTGGCTGGGTGGAACTTGG + Intergenic
1003959733 6:11197928-11197950 CAAGTTGGATGAGAGGCCCTTGG + Intronic
1006130029 6:31863569-31863591 GAGGTTGGATGGCTGGACGGTGG + Exonic
1006177220 6:32129603-32129625 GAATTTGGCTGGCTGGATCTGGG + Exonic
1012329755 6:97969934-97969956 TACGTTGGTTTGCTGGACCTGGG + Intergenic
1015695708 6:135977389-135977411 CAAGTTTCATGGGTGGAGCTGGG - Intronic
1017083501 6:150691724-150691746 CAAGGTGGGTGGTTGGACTTGGG - Intronic
1018461955 6:164007130-164007152 CAAGCTTCTTGGCTGGACCTTGG - Intergenic
1018647249 6:165960046-165960068 AATTTTGGATGGCTGTACCTTGG - Intronic
1029075935 7:97934172-97934194 CAAGATGGTTGGCTAGACCAAGG + Intergenic
1033901440 7:146145821-146145843 CCATTTGGATGGCTGGATTTAGG - Intronic
1036241584 8:7086167-7086189 CAAGATGGTTGGCTGGACCAAGG - Intergenic
1036260254 8:7233950-7233972 CAAGATGGTTGGCTGGACCAAGG + Intergenic
1036306363 8:7605573-7605595 CAAGATGGTTGGCTGGACCAAGG - Intergenic
1036312291 8:7692506-7692528 CAAGATGGTTGGCTGGACCAAGG + Intergenic
1036357209 8:8053558-8053580 CAAGATGGTTGGCTGGACCAAGG - Intergenic
1036831152 8:12020910-12020932 CAAGATGGTTGGCTGGACCAAGG + Intergenic
1036901360 8:12671695-12671717 CAAGATGGTTGGCTGGACCAAGG + Intergenic
1039733556 8:40305826-40305848 CAATTTGGATGCCTGGTCTTGGG - Intergenic
1042262263 8:66871510-66871532 CAAGTTGGATGGCCTGATCCAGG - Intronic
1045024077 8:98070092-98070114 CTAGATGGATGGATGGACCTGGG + Intronic
1048187012 8:132250675-132250697 CAAGTGGATTGGGTGGACCTCGG + Intronic
1049384714 8:142337302-142337324 CAAGTTGAATTGCTGGCCGTAGG - Intronic
1051160357 9:14200729-14200751 CAAGTTGGATGGATCGTCTTTGG - Intronic
1056764767 9:89437911-89437933 CAGGTTGGATGGCTCATCCTTGG - Intronic
1058538401 9:105987351-105987373 CATGTTGGATGAATGGACGTGGG + Intergenic
1059275212 9:113090484-113090506 AAAGGTGGTTGGCTGGGCCTGGG + Intergenic
1188019719 X:25144032-25144054 CAGTTTGAGTGGCTGGACCTGGG + Intergenic
1199277024 X:145957047-145957069 GAAGTGGGATTGCTGGACATAGG - Intergenic