ID: 1170847542

View in Genome Browser
Species Human (GRCh38)
Location 20:19974965-19974987
Sequence GTGTGGAGACTATTAATAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170847542_1170847547 -4 Left 1170847542 20:19974965-19974987 CCCGCTATTAATAGTCTCCACAC 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1170847547 20:19974984-19975006 ACACAAGCCCTCGGCTGGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 146
1170847542_1170847545 -9 Left 1170847542 20:19974965-19974987 CCCGCTATTAATAGTCTCCACAC 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1170847545 20:19974979-19975001 TCTCCACACAAGCCCTCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170847542 Original CRISPR GTGTGGAGACTATTAATAGC GGG (reversed) Exonic
909402828 1:75253218-75253240 GAGAGGAGACAAGTAATAGCAGG + Intronic
919546494 1:198927164-198927186 GTGAGGAAAGTATTAATAGGGGG + Intergenic
1069250621 10:66261877-66261899 GTGTGGAGATTGTTAATTGGTGG - Intronic
1075671631 10:124267263-124267285 GTGTGGAGAGTAGGAATAGGAGG - Intergenic
1080067706 11:28038924-28038946 ATTTGGTGGCTATTAATAGCTGG + Intronic
1080430493 11:32194540-32194562 GTTTGCAGAATAATAATAGCTGG + Intergenic
1085407156 11:76270128-76270150 GTGAGGAGCCTCCTAATAGCCGG - Intergenic
1090601438 11:128376319-128376341 GTGTAGAGAATATTCATAGCAGG + Intergenic
1099449930 12:82796172-82796194 GGGAGGAGACTATTTGTAGCCGG + Intronic
1100703033 12:97167984-97168006 GTGTGGAGACTATGAACCCCTGG + Intergenic
1106197374 13:27505530-27505552 ATGTGCAGAATGTTAATAGCCGG - Intergenic
1106470915 13:30053314-30053336 GTGTGGTGGCTATTAATAGAAGG + Intergenic
1106788911 13:33134878-33134900 CTCTCAAGACTATTAATAGCAGG - Intronic
1107314037 13:39111925-39111947 GTGTTGATATTATTAATATCGGG + Intergenic
1108086054 13:46795017-46795039 GTGTGGTAAGTTTTAATAGCTGG - Intronic
1110517067 13:76426174-76426196 GTGAGGAAACTACTAACAGCTGG - Intergenic
1115165426 14:30443345-30443367 GTGAGGAGAAAATTAATATCAGG - Intergenic
1119938840 14:78619113-78619135 CTGTGGAGAATACTAACAGCAGG - Intronic
1125167518 15:36725421-36725443 GAATGGAGATTGTTAATAGCTGG + Intronic
1131759982 15:95612065-95612087 GTGTGGAGACTAGAGATAGATGG + Intergenic
1133544984 16:6797361-6797383 GAGTGGAGATTATTAACAGGTGG + Intronic
1135622562 16:23968424-23968446 GTTTGGAGCCTATTGAGAGCTGG + Intronic
1155097204 18:22568870-22568892 TTTTGGAGACTTTTACTAGCAGG - Intergenic
1157457095 18:47842233-47842255 ATGTAGATACTATTAATATCAGG + Intronic
1157910559 18:51614041-51614063 GTGGGGAGATTTTTAATGGCAGG + Intergenic
1158740086 18:60131521-60131543 GTGTGAATATTATTAATAACAGG - Intergenic
1159307734 18:66667388-66667410 GTTTGGAGGCTATTAATAATTGG - Intergenic
1165275362 19:34746522-34746544 GTGGGAAGATTATTAAAAGCAGG - Intergenic
927886618 2:26722759-26722781 GTGTGGATACTCTTTAGAGCAGG - Intronic
931746644 2:65296850-65296872 CTTTGGGGACTGTTAATAGCAGG + Intergenic
945622476 2:212157892-212157914 GTGTCAAGACTGTTAAGAGCAGG - Intronic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
1170188851 20:13623898-13623920 GTATGGAGAGTATTAACAGTGGG - Intronic
1170847542 20:19974965-19974987 GTGTGGAGACTATTAATAGCGGG - Exonic
1182739357 22:32555946-32555968 GTGTGACGAATATTAATACCAGG + Intronic
1183077502 22:35436267-35436289 GTGGGGAGGCTGTTAAGAGCTGG - Intergenic
1183278635 22:36919229-36919251 GGGTGGAGAGAATTAAGAGCAGG - Intronic
956776477 3:72569556-72569578 GTGTGTAGATTCCTAATAGCTGG - Intergenic
977117764 4:93053198-93053220 TTGTCGAAACTATTAATACCGGG + Intronic
978252917 4:106654857-106654879 GTGTAGAGATTATTAAGAGTTGG - Intergenic
978944950 4:114484070-114484092 GTTTAGAGACTATTACTAGTAGG - Intergenic
979526687 4:121724986-121725008 TTGTGGTGACTTTTCATAGCAGG + Intergenic
984299580 4:177897833-177897855 TTGTGTAGGCTAATAATAGCTGG + Intronic
988024107 5:25662503-25662525 GTCTGGAGACTTTTTATATCTGG - Intergenic
991036119 5:62129597-62129619 GTGTGGACTCTATTTCTAGCTGG - Intergenic
991639816 5:68741036-68741058 GTGTGAAAACTAATAATACCAGG - Intergenic
994298861 5:98122082-98122104 GTCTGGAGACTCTCAATAGGAGG - Intergenic
1010073277 6:71769641-71769663 GTGTGGAGTCTCCTGATAGCAGG + Intergenic
1014301547 6:119688465-119688487 GTGTGGAGAATGCCAATAGCTGG - Intergenic
1026245506 7:68616036-68616058 GTGTGGAGATTATTAATTGGTGG + Intergenic
1031289745 7:119918310-119918332 GTGTGGAGACAATTAAGAATTGG - Intergenic
1031292754 7:119958529-119958551 GTGTGGAGACCATTGATTGGTGG + Intergenic
1038945581 8:32355989-32356011 GTGAGGAGACTGTAATTAGCAGG + Intronic
1039493541 8:37965167-37965189 GTGTGGAGTTTATTAAGAGAAGG - Intronic
1048284691 8:133132671-133132693 GTTTTCAGACTATTAGTAGCTGG - Intronic
1056052124 9:82779787-82779809 TTGTGTAGACTATTAATAAAAGG + Intergenic
1056467121 9:86868505-86868527 GTGAGTAGAATATGAATAGCAGG + Intergenic
1057543171 9:95994960-95994982 GCTTGGAGAATATTAATAGAGGG + Intronic
1192948215 X:75988324-75988346 GTGAGGAAAGTATTACTAGCAGG - Intergenic
1193332679 X:80253058-80253080 GTGTGGTGACTATAAAAAGAAGG + Intergenic
1195146835 X:102026720-102026742 GTGTGGATACCAGTAATAGCAGG - Intergenic