ID: 1170848509

View in Genome Browser
Species Human (GRCh38)
Location 20:19982458-19982480
Sequence TGGTGGCTGAGGAGGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4721
Summary {0: 1, 1: 1, 2: 29, 3: 475, 4: 4215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170848509_1170848519 24 Left 1170848509 20:19982458-19982480 CCTTCCACCCTCCTCAGCCACCA 0: 1
1: 1
2: 29
3: 475
4: 4215
Right 1170848519 20:19982505-19982527 GTTTCTTGGCTGAAAGTCAGGGG 0: 1
1: 0
2: 3
3: 19
4: 220
1170848509_1170848516 10 Left 1170848509 20:19982458-19982480 CCTTCCACCCTCCTCAGCCACCA 0: 1
1: 1
2: 29
3: 475
4: 4215
Right 1170848516 20:19982491-19982513 CATAAGATAGAGAAGTTTCTTGG 0: 1
1: 0
2: 2
3: 23
4: 380
1170848509_1170848518 23 Left 1170848509 20:19982458-19982480 CCTTCCACCCTCCTCAGCCACCA 0: 1
1: 1
2: 29
3: 475
4: 4215
Right 1170848518 20:19982504-19982526 AGTTTCTTGGCTGAAAGTCAGGG 0: 1
1: 1
2: 1
3: 11
4: 214
1170848509_1170848517 22 Left 1170848509 20:19982458-19982480 CCTTCCACCCTCCTCAGCCACCA 0: 1
1: 1
2: 29
3: 475
4: 4215
Right 1170848517 20:19982503-19982525 AAGTTTCTTGGCTGAAAGTCAGG 0: 2
1: 0
2: 1
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170848509 Original CRISPR TGGTGGCTGAGGAGGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr