ID: 1170849469

View in Genome Browser
Species Human (GRCh38)
Location 20:19991423-19991445
Sequence CAGGATAATTCTTCTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170849464_1170849469 10 Left 1170849464 20:19991390-19991412 CCTCAACACACACACTAAAGACA 0: 1
1: 2
2: 9
3: 85
4: 710
Right 1170849469 20:19991423-19991445 CAGGATAATTCTTCTTTTGGGGG 0: 1
1: 0
2: 2
3: 34
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170849469 Original CRISPR CAGGATAATTCTTCTTTTGG GGG Intronic
900621552 1:3589927-3589949 CAGCAGATTTCTTCTTTTGCAGG - Intronic
900916329 1:5641411-5641433 GAAAATAATTCTTCTTCTGGTGG - Intergenic
902622546 1:17658952-17658974 CAGGAGAATGCTTGATTTGGTGG + Intronic
904474348 1:30755329-30755351 CTGGATAATTCTTCATCTTGGGG - Intronic
905096057 1:35471918-35471940 CAAAAAAATTCTTGTTTTGGAGG - Intronic
905187820 1:36209373-36209395 CAGGATTATTCTTCGTTGTGAGG + Intergenic
906222493 1:44092518-44092540 CATGGTAATTTTTCTTTTGGGGG - Intergenic
906721021 1:48004638-48004660 CAGGATAATTCTTTGTTGTGAGG - Intergenic
907055710 1:51365887-51365909 AAGGAGGATTGTTCTTTTGGTGG + Intronic
907552582 1:55316804-55316826 GAGGAGAAATTTTCTTTTGGTGG + Intergenic
910007715 1:82419029-82419051 CATAATAATTGTTCTTTTTGTGG + Intergenic
910241608 1:85092693-85092715 CAGGATAATTTTTCATTTTGGGG + Intronic
910552651 1:88493998-88494020 CAGAATAAATCTGGTTTTGGGGG - Intergenic
911646597 1:100343530-100343552 CATTATAATTCTGATTTTGGGGG + Intergenic
913121899 1:115750016-115750038 CAGGGTCCTTCTTCTTATGGAGG - Intronic
916121787 1:161534509-161534531 GAAGATAATTCTTTTTGTGGAGG + Intergenic
916131380 1:161614455-161614477 GAAGATAATTCTTTTTGTGGAGG + Intronic
916313351 1:163420794-163420816 CAGCATAATTATCCTGTTGGGGG + Intergenic
917215667 1:172675701-172675723 CAGGAAAAGACTGCTTTTGGAGG + Intergenic
917558184 1:176114568-176114590 TAGGGTAATTCTTTTTTTTGCGG + Intronic
918353946 1:183687384-183687406 CAGGAAAATTATTCCTTTGCTGG + Intronic
920193646 1:204211899-204211921 CAGGATAATTCTTTGTTGTGGGG - Intronic
920763901 1:208812533-208812555 CTGGATAATCCTTGTTGTGGTGG + Intergenic
920871783 1:209801082-209801104 CATAGTAATTCCTCTTTTGGGGG - Intronic
922156302 1:223042110-223042132 CATTATAATTGTTCCTTTGGGGG + Intergenic
923637930 1:235719808-235719830 CAGGTCACTTATTCTTTTGGAGG - Intronic
923762948 1:236863614-236863636 CAGAATAATTCTTCAATGGGTGG + Intronic
923900826 1:238324467-238324489 CAAGCTAATTCTTTTTTAGGTGG + Intergenic
923982071 1:239336322-239336344 TAGCATAATTCTTATTTTGTAGG - Intergenic
924365444 1:243288577-243288599 CAAGAAATATCTTCTTTTGGGGG + Intronic
924846149 1:247774255-247774277 CAGGCTCATGTTTCTTTTGGAGG - Intergenic
1063359512 10:5439930-5439952 CAGGACTCTTCATCTTTTGGAGG - Intronic
1063680484 10:8182547-8182569 CATGATTATTATTTTTTTGGGGG + Intergenic
1065966731 10:30776664-30776686 CAGCATAATTCTTATTTTGTGGG - Intergenic
1067590800 10:47508054-47508076 CCAGATAATTTTTTTTTTGGGGG + Intronic
1068870063 10:61933867-61933889 CAGGCTGATTCTTCTGTTAGGGG - Intronic
1069818935 10:71215746-71215768 CAAGATAATACTTCTTTTTAAGG + Intronic
1070649477 10:78224584-78224606 CAGAATATCTCTTCTTTTTGGGG + Intergenic
1070652789 10:78250024-78250046 CTGGATAATTCTGTTTTTAGAGG - Intergenic
1071541576 10:86489665-86489687 CTGAATAATTCTTGGTTTGGAGG - Intronic
1071820305 10:89273130-89273152 CATCAGAATTCCTCTTTTGGTGG + Intronic
1073576657 10:104631518-104631540 GAGGAAGATACTTCTTTTGGGGG + Intergenic
1073625329 10:105090920-105090942 CAGGAGAAATCTACTGTTGGAGG + Intronic
1075373589 10:121958779-121958801 CAGGATTGTTCTTGGTTTGGTGG - Intronic
1076148457 10:128143840-128143862 CAGGTTGATTCCTCTTCTGGAGG - Intergenic
1078737116 11:14030351-14030373 GAGGATTAATCTGCTTTTGGGGG + Intronic
1079234690 11:18679803-18679825 CAGTAGAATTCTTTCTTTGGAGG + Intergenic
1079640599 11:22800200-22800222 CAGGTTACTTGTTCTTATGGAGG + Intronic
1080009027 11:27438998-27439020 CTGGATAATTCTTGTTGTAGGGG - Intronic
1080705085 11:34683603-34683625 CATTATAATTCTTCCTCTGGGGG - Intergenic
1082689788 11:56286153-56286175 CAAGATAATTCTTTTTTTTTCGG + Intergenic
1083018063 11:59476823-59476845 CAGCGAAATTCTTCCTTTGGGGG + Intergenic
1085555840 11:77420891-77420913 CAGGATAATTCTTTGTTATGAGG - Intronic
1086571251 11:88286831-88286853 CTGGTTAATTCTTCATGTGGAGG + Intergenic
1086635986 11:89086512-89086534 AAGGCAAATTCTTCTTTTGTTGG - Intergenic
1087749267 11:101989314-101989336 CTGGATAATTTTTATTGTGGGGG + Intronic
1087934737 11:104019046-104019068 CAGGAAAACTCTTCTTTTATTGG + Intronic
1090231412 11:125108832-125108854 CAGGACAATTCTTCGTTGTGAGG + Intronic
1091133926 11:133170853-133170875 CTGGCTAATTGTGCTTTTGGGGG - Intronic
1093394140 12:18660052-18660074 CAGTGTAATTGTTCTGTTGGAGG - Intergenic
1093702602 12:22239086-22239108 TAGTATAATTATTCTTTTGCAGG + Intronic
1094175742 12:27539028-27539050 CAGGATAATTCTTCATTGGTGGG - Intronic
1094983941 12:36458860-36458882 CAGGATAACCTTTCTTTTGATGG + Intergenic
1095675795 12:44916641-44916663 CAGGAAAATTGTTGTTGTGGTGG - Intronic
1095756650 12:45775043-45775065 CTGGATAATTCTTCTTTATGGGG - Intronic
1096763431 12:53862676-53862698 CTGGCTAATTGTTTTTTTGGCGG + Intergenic
1096890570 12:54766607-54766629 CAGGATAATTCTTGTTGTCAAGG - Intergenic
1099609176 12:84844717-84844739 AAAGATAATTATTCTTTTGATGG + Intergenic
1100088863 12:90945613-90945635 CATTAAAATTCTGCTTTTGGTGG + Intronic
1100157089 12:91812771-91812793 CAGGATAATTCTGTGTTTGGAGG - Intergenic
1100601145 12:96112431-96112453 CTGGATAATTCTTAGTTGGGGGG - Intergenic
1100705282 12:97194071-97194093 CAGTTTGGTTCTTCTTTTGGGGG + Intergenic
1103009800 12:117449396-117449418 CTGGATAATTCTTGTTGTGGAGG + Intronic
1104231039 12:126884205-126884227 CAGAATAACTCTTGCTTTGGGGG - Intergenic
1105470980 13:20694438-20694460 CAAGATAATTGCTATTTTGGGGG + Intergenic
1105976035 13:25473635-25473657 GAGTATAATATTTCTTTTGGAGG - Intronic
1106554046 13:30795087-30795109 CAGGGTTTGTCTTCTTTTGGGGG + Intergenic
1108711296 13:53035027-53035049 CTGGTTAATTCTTTTTTGGGGGG + Intronic
1109822591 13:67677813-67677835 GAGGGTAAATCTTCTTTTGGGGG - Intergenic
1110237361 13:73230628-73230650 CAGCAAAATCCTTCCTTTGGTGG - Intergenic
1110859135 13:80328461-80328483 CTGGATAATTCTTGTTATGGAGG + Intergenic
1111279225 13:85997544-85997566 AAAGATAATTCTTTTTTTTGGGG + Intergenic
1111832157 13:93343014-93343036 CTGGATATTTTTTCTTTTGCAGG + Intronic
1111919472 13:94395590-94395612 CTGTGTAGTTCTTCTTTTGGAGG + Intronic
1112677226 13:101716038-101716060 CTGGATAATTCCTTGTTTGGGGG - Exonic
1112695190 13:101940081-101940103 CAAGATAAGTCCTCTTTTGCAGG - Intronic
1114664818 14:24371335-24371357 CAGGATAATTCTTTGTTATGTGG + Intronic
1116426079 14:44793447-44793469 CATGATAACTCGTCTTGTGGAGG + Intergenic
1116471968 14:45295926-45295948 CAGGATGATTTATGTTTTGGGGG - Intergenic
1116472276 14:45299416-45299438 CAGGAGAGTTCTTCTATTGTAGG - Intergenic
1117109237 14:52431610-52431632 CAGGATAATTCTTTGTTGTGGGG + Exonic
1117962589 14:61177960-61177982 CAGGATGATTCTTTTTTGTGTGG + Intergenic
1118075819 14:62297685-62297707 CAGGTTATTTCTCCTTTAGGAGG - Intergenic
1118188316 14:63557683-63557705 CTGGATGATTCTTCACTTGGAGG + Intergenic
1118495654 14:66305906-66305928 CTGGATAATTCTTTGTTTGGGGG - Intergenic
1119055268 14:71413055-71413077 CAGGATAATTCTTTGTTGGAGGG + Intronic
1119496232 14:75081828-75081850 AAGGATCATCCTTCTTTTAGTGG + Exonic
1121718499 14:96092941-96092963 CTGGATAATTCTTATTTGTGGGG - Exonic
1122497610 14:102170226-102170248 TATCATAATTCTTCTTTTGATGG + Intronic
1124866199 15:33493784-33493806 CCAGCTAATTATTCTTTTGGTGG - Intronic
1127900163 15:63335205-63335227 CAGGATAATTCTTACAGTGGGGG - Intronic
1128379194 15:67099034-67099056 CATGATAATTCTCCTTTCTGTGG + Intronic
1130364033 15:83217242-83217264 CAGGAGAATTCTTTGTTGGGTGG - Intergenic
1130533607 15:84766954-84766976 CAGGATCACTCTTTCTTTGGTGG - Intronic
1131068948 15:89452272-89452294 AAGGATAATTTTTCTTTTTTTGG + Intergenic
1133453758 16:5924577-5924599 CAGGCTACTTCTACTTATGGTGG - Intergenic
1134643136 16:15845360-15845382 CAAGACAATTCTTCTTTTTCTGG + Intronic
1135160713 16:20093558-20093580 CAGGCTGACTCTTCTCTTGGAGG + Intergenic
1135855423 16:26005828-26005850 CTGGATAATTCTTCATTGTGGGG + Intronic
1138000141 16:53269886-53269908 CAGGATATTTCTTCATTGTGGGG - Intronic
1138364217 16:56460121-56460143 CATGATAATCTTTCTTTAGGGGG - Intronic
1139187342 16:64822547-64822569 CAGGACAATTCTTCATTGGATGG - Intergenic
1140155904 16:72426413-72426435 GGGGCTAATTTTTCTTTTGGTGG + Intergenic
1140939860 16:79711432-79711454 CTGGATACTTCTTTTTTTGTGGG - Intergenic
1142651128 17:1352905-1352927 CAGGATAGTTTTACATTTGGTGG - Intronic
1144261121 17:13521865-13521887 ATGGATAATTCTTTGTTTGGGGG + Intronic
1146020929 17:29278140-29278162 CTGGATAATTCTTCTTATCCTGG - Intronic
1147858159 17:43498830-43498852 ATGGCTAATTCTTCTTTTGGGGG + Intronic
1148430986 17:47643276-47643298 CAACATAATTCTTTTTTTTGTGG - Intergenic
1149155516 17:53624611-53624633 CAGGATAATTGTTATTTAGTGGG - Intergenic
1150175479 17:63050205-63050227 CTGGCTAATTTTTATTTTGGAGG - Intronic
1150387054 17:64770485-64770507 CAAGATGACTCGTCTTTTGGTGG - Intergenic
1150407220 17:64912593-64912615 CTGGTTATTTCTTTTTTTGGGGG - Intronic
1152951609 17:83237599-83237621 CATGTTAGTTCTTTTTTTGGGGG - Intergenic
1153059966 18:984995-985017 CTTGATAGTTCTTCTTTTGGAGG + Intergenic
1153284071 18:3441433-3441455 CAGGAGAATTCTTGGTGTGGGGG + Intronic
1154377543 18:13822529-13822551 GAGTATAATGATTCTTTTGGGGG + Intergenic
1155098889 18:22589314-22589336 CAGGATAATGCTTACTTTTGGGG + Intergenic
1157882236 18:51331452-51331474 CAGGATAATTCTTTCTGGGGGGG + Intergenic
1158968269 18:62642708-62642730 CAGGACTATTTTACTTTTGGAGG - Intergenic
1159460768 18:68720196-68720218 CAGGATAATTCTAGAATTGGTGG - Intronic
1159690760 18:71484090-71484112 TATGATAATTCTTTCTTTGGGGG + Intergenic
1161829544 19:6592364-6592386 CCGGCTAATTTTTTTTTTGGGGG + Intronic
1162438083 19:10675112-10675134 CTGGATAATTCTTGGTTGGGGGG - Intronic
1162582929 19:11541259-11541281 CAGGATCATGGTTGTTTTGGGGG - Intronic
1162733556 19:12733448-12733470 CTGGATTATTCTTTGTTTGGGGG + Intronic
1162735064 19:12742391-12742413 CCGGCTAATTTTTGTTTTGGGGG + Intronic
1164535380 19:29082444-29082466 CAGGCTAATTCATCTTTAGGCGG - Intergenic
1165196311 19:34106663-34106685 CAGGCTAATTTTTGTTGTGGCGG + Intergenic
1168120039 19:54246853-54246875 CAGGCTAATTATTTTTTTGCGGG - Intronic
926777739 2:16438993-16439015 CCACATAATTCTTCTTTTTGAGG + Intergenic
927096575 2:19751691-19751713 AAGAATAAGTTTTCTTTTGGAGG - Intergenic
927359499 2:22216068-22216090 CTGGAAATTTCTTCTTTTTGGGG + Intergenic
927627421 2:24736707-24736729 CTGGGTAATTCTTGTTATGGGGG + Intronic
928030663 2:27775867-27775889 CAGGATGATTCCTCATATGGTGG + Intronic
928241943 2:29594105-29594127 CAGGATAATTCTTTGTTTTGGGG - Intronic
929023294 2:37575377-37575399 CAGGATCTTTTTTCTTTTTGAGG + Intergenic
929115215 2:38438173-38438195 CAGGGGAATTCTTGTTTTGCTGG - Intergenic
929526277 2:42705713-42705735 CAAGTTAATTTTTTTTTTGGGGG - Intronic
931355918 2:61537792-61537814 CAGATTAATTCCCCTTTTGGGGG - Exonic
932056664 2:68452387-68452409 CTGGATAATTCTTTGTTTGGGGG - Intergenic
933027689 2:77282175-77282197 CTGGATACTTCATTTTTTGGTGG + Intronic
933748599 2:85588626-85588648 CAGGATAATTTCTCTATTGGTGG - Intronic
933866028 2:86518609-86518631 CTGGGTAATTCTTTTGTTGGAGG + Intronic
936867091 2:117087310-117087332 CAGGATAATTCTTGCTTCAGGGG - Intergenic
937726996 2:125178478-125178500 CAGGCTAAGTTTTCTTTTGATGG + Intergenic
937945526 2:127332358-127332380 CAAGATACTGCTACTTTTGGGGG + Intronic
938901242 2:135800228-135800250 CCTAATAATTCTTCTTTTTGGGG + Intronic
939092362 2:137794210-137794232 CAGGTTAAATGTTCTTTTGAGGG + Intergenic
939228375 2:139393245-139393267 GAGGAATATTCTTCTCTTGGTGG + Intergenic
941215152 2:162697536-162697558 CAGGGTAATTGTTATTTTGTGGG + Intronic
941661796 2:168203041-168203063 CAGGATAATTCTTCGTTGTGAGG + Intronic
941962427 2:171266934-171266956 AAGTATTATTCTTATTTTGGGGG + Intergenic
942329975 2:174812890-174812912 CTGGATATTCCTACTTTTGGAGG - Intronic
942742009 2:179191981-179192003 CAAGATAATTCTTTTTTTGTAGG + Intronic
942968312 2:181924716-181924738 CAGTAGAATTCTTTTTTTGAAGG + Intronic
943374920 2:187064798-187064820 CAGGATGTTTGTTCTTTTAGAGG + Intergenic
944195822 2:197051891-197051913 CAGGATAATTCTTTGTTGTGGGG - Intronic
945760851 2:213912835-213912857 CATGATAATTTGTTTTTTGGGGG - Intronic
946265083 2:218533694-218533716 TAGGAATATTCTTCTTTTAGTGG - Intronic
946860382 2:223995468-223995490 CAGCACAATTCTTCATTGGGTGG - Intronic
946924364 2:224612050-224612072 CTGGATAATTCTGTTGTTGGGGG + Intergenic
948688945 2:239690165-239690187 TAGGATAATTTTTCTTCTTGAGG - Intergenic
1168769545 20:406797-406819 TGGGATAATTTTTCTTTTGCCGG - Intergenic
1168864054 20:1069489-1069511 CAGGGTAATATTGCTTTTGGAGG - Intergenic
1170791562 20:19513165-19513187 CAGGTCAAATCCTCTTTTGGAGG + Intronic
1170849469 20:19991423-19991445 CAGGATAATTCTTCTTTTGGGGG + Intronic
1171483637 20:25471155-25471177 CTGGATAATTTTTGTTGTGGTGG + Intronic
1172310767 20:33916552-33916574 CAGGATAATGGTTATTTTTGAGG - Intergenic
1173668389 20:44779411-44779433 TAGGGTAATGCTACTTTTGGTGG - Intronic
1173759346 20:45546035-45546057 CTGGATAATTCTTTGTTTGGGGG + Intronic
1173949911 20:46983317-46983339 CAGAAAAACTTTTCTTTTGGAGG - Intronic
1174860978 20:54090721-54090743 AAGGACAACACTTCTTTTGGGGG + Intergenic
1175319499 20:58075193-58075215 GAGGATAATTCTTGTTTAAGGGG - Intergenic
1175574105 20:60047696-60047718 CTGGATAATTCTTCATTGTGGGG + Intergenic
1182220609 22:28755784-28755806 CCAGATAATTCTTCGTTTGGGGG + Intronic
1183022311 22:35037274-35037296 GAGGAAAAGTCTTCTTTTCGTGG - Intergenic
1183884836 22:40870865-40870887 CCGGCTAATTTTTTTTTTGGGGG - Intronic
1183976002 22:41512720-41512742 AAGGATGGATCTTCTTTTGGTGG + Intronic
1184846491 22:47090894-47090916 CAGGAGAAGTCGTCTTTGGGGGG + Intronic
1184846610 22:47091525-47091547 CAGGAGAAGTCGTCTTTGGGGGG + Intronic
949493909 3:4613733-4613755 CAGGATCATCCTTCTTTTCATGG + Intronic
949499520 3:4666041-4666063 CAGGATAATTCTTGGTTGTGTGG - Intronic
950214739 3:11151481-11151503 CATGAAAATTCCTTTTTTGGGGG + Intronic
951616965 3:24557655-24557677 CTGGATAATTCTTCGTTAGGAGG - Intergenic
951848444 3:27110994-27111016 CTGCAAAATTCATCTTTTGGAGG - Intronic
953167660 3:40479713-40479735 CCAGATAATTCTTTGTTTGGGGG + Intronic
955373709 3:58375961-58375983 CAAGATAATTATTATTTTGGAGG - Intronic
955467139 3:59249098-59249120 GAGGACAATTCTTGTTTTGTGGG + Intergenic
955867667 3:63402180-63402202 CTGGATAATTCTTCATTATGGGG + Intronic
955932067 3:64067183-64067205 TTGGATAATTCTTTGTTTGGTGG + Intergenic
955936628 3:64108849-64108871 CTGGATAATTCTTTGTTTGGTGG + Intronic
956375866 3:68613132-68613154 CGGGATAATTCTTCGTTGTGGGG + Intergenic
956662938 3:71617057-71617079 CTGGATAATTCTTGGTTTAGGGG + Intergenic
956669795 3:71676300-71676322 CAGGATAATGGTTATTTTAGTGG + Exonic
957007544 3:74967958-74967980 CTGGGTAATTCTTTGTTTGGGGG + Intergenic
959753915 3:109873922-109873944 TAGGATAATTATTCCATTGGTGG + Intergenic
961076888 3:123991092-123991114 CAGGTTGATTCTTCCTTTGGAGG + Intronic
961307694 3:125970218-125970240 CAGGTTGATTCTTCCTTTGGAGG - Intronic
962571190 3:136715038-136715060 CAAGATAATTGTTCTTTTAGAGG + Intronic
963502709 3:146147959-146147981 CAGAATCTTTCTTGTTTTGGAGG - Intronic
964367856 3:155968858-155968880 CTGGATAATTCTTATTTAGCAGG - Intergenic
965146913 3:164916590-164916612 CCAGATAATTCTTTGTTTGGAGG + Intergenic
965234546 3:166099305-166099327 CAGGATGAATATTCTTTTGATGG + Intergenic
965688723 3:171333000-171333022 CAAAATAATTTTTCTTTTTGTGG - Intronic
968111717 3:196053818-196053840 CAGTTCAATTCTCCTTTTGGGGG + Intronic
970730036 4:19091810-19091832 CTGGATAATTCTTCAGTTTGGGG - Intergenic
971098185 4:23432614-23432636 CAGAATACTCTTTCTTTTGGTGG + Intergenic
971415596 4:26425456-26425478 CTGGCTAATTTTTTTTTTGGGGG - Intronic
971712595 4:30135231-30135253 GAGGAAATTTCTTCTTTTAGGGG + Intergenic
972221307 4:36958841-36958863 CTGTATTTTTCTTCTTTTGGGGG + Intergenic
975776480 4:77793016-77793038 CAAGATATTTCTTGTTGTGGGGG - Intronic
975850715 4:78569164-78569186 CAGCAGCATTTTTCTTTTGGAGG + Intronic
975873296 4:78806191-78806213 TAGGATAATTTTTTTTTTGGAGG + Intronic
976416846 4:84786139-84786161 AAGAATTATTCTTCTTTTGAAGG - Exonic
976550526 4:86389629-86389651 CAGGACAATTCTTCATTCTGTGG - Intronic
976604095 4:86966530-86966552 CACAATATTTCTGCTTTTGGGGG - Intronic
976662031 4:87549747-87549769 CAGCATAATTATTTTTTGGGAGG - Intergenic
976759684 4:88534900-88534922 CAAAAAAATACTTCTTTTGGAGG - Intronic
977761194 4:100739042-100739064 CTGGATAATTTTTTGTTTGGAGG - Intronic
979727300 4:123977957-123977979 GAAGATAATTCTTTGTTTGGGGG + Intergenic
981523664 4:145690949-145690971 CTGGCTAATTCTTTTTTTGTGGG - Intronic
982542128 4:156686874-156686896 CATTAAACTTCTTCTTTTGGTGG - Intergenic
985325731 4:188767674-188767696 CAGAATAGTTCTTTTTTTAGTGG + Intergenic
986637379 5:9836394-9836416 CAGGATAATTCTTTGTTGGAGGG + Intergenic
986854280 5:11851043-11851065 GAGGAGAATTCTGATTTTGGGGG - Intronic
987192146 5:15489444-15489466 CTGGATAATTCTTTGTTGGGAGG - Intergenic
988720399 5:33872072-33872094 CCTGATGATTTTTCTTTTGGAGG - Intronic
989016958 5:36947779-36947801 CTGGGGAATTCTTATTTTGGTGG - Intronic
989115563 5:37949099-37949121 CTGGATAATTCTTGGTTTAGGGG + Intergenic
989171201 5:38471674-38471696 CAGGATATCACCTCTTTTGGAGG + Intergenic
989534238 5:42545703-42545725 CAGTATAAAACTTGTTTTGGGGG + Intronic
991200965 5:63991999-63992021 CAGGCTAATAGTTCTTTTGCGGG + Intergenic
991665728 5:68998264-68998286 TAGTGTTATTCTTCTTTTGGTGG - Intergenic
992971554 5:82064608-82064630 CATGATAAGTATTATTTTGGGGG - Intronic
993017525 5:82551796-82551818 CAGGATAATGCTTATTTTTGTGG + Intergenic
994034350 5:95181351-95181373 CAAGCTCATTCCTCTTTTGGGGG + Intronic
995165126 5:109030835-109030857 CAGGATAGGTCTTTTTTTTGTGG + Intronic
995348970 5:111153252-111153274 TTGGATATTTCTTTTTTTGGGGG + Intergenic
995530150 5:113084387-113084409 TTGGATAATTCTTTTTATGGGGG + Intronic
995694470 5:114864664-114864686 ACGGATAATTGTTGTTTTGGAGG + Intergenic
996314086 5:122141744-122141766 CACGATCATCTTTCTTTTGGGGG + Intronic
996983703 5:129533099-129533121 CAGTATAATTTTTTTTTTTGTGG - Intronic
997570237 5:134921696-134921718 CAGGATAATTCTTCCGTTTCAGG - Intronic
998931836 5:147189787-147189809 CAAGACAATTCTTCTTTTTCTGG - Intergenic
999884575 5:155906997-155907019 CAGGTTGATTCTCTTTTTGGAGG + Intronic
1001275269 5:170346100-170346122 CAGGGGAATTCTGCTTCTGGTGG + Intergenic
1003775029 6:9350848-9350870 CACAATAGTTCTTCTTTTGATGG - Intergenic
1005631739 6:27714477-27714499 CAGGAGAATTCTTCTGAAGGTGG - Intergenic
1005692998 6:28325259-28325281 CAGCATTATTCTTCTTTTGGGGG - Exonic
1005893780 6:30161206-30161228 CAGAAGAAATATTCTTTTGGGGG + Intergenic
1005895636 6:30175129-30175151 GAGGAAAATTATTCATTTGGTGG + Intergenic
1006573587 6:35025981-35026003 AAGGAAAATTCTCCTTTTGCTGG - Intronic
1008730324 6:54474178-54474200 CAGCATAAGTCTTCTTTTAAAGG - Intergenic
1009053729 6:58310884-58310906 CAGGATAATTCTTTGTTGGGAGG - Intergenic
1009237396 6:61139665-61139687 CAGGATAATTCTTTGTTGGGAGG + Intergenic
1010140578 6:72610103-72610125 CAGGATAATTCCTTTTTTGTGGG + Intergenic
1011312595 6:85996741-85996763 CTGGATAATTCTTGTTTTGGGGG + Intergenic
1011376021 6:86687676-86687698 CAGCATGCTTCTTCTTTTGTAGG + Intergenic
1011496980 6:87946536-87946558 CTGGATAATTCTTGGTTTTGGGG + Intergenic
1011945585 6:92898172-92898194 CAGAATATCTCTTCTTATGGAGG + Intergenic
1014347476 6:120292399-120292421 CAGGATTTTCCTTCTTTTTGTGG + Intergenic
1014904088 6:127005107-127005129 CATGAACATTATTCTTTTGGAGG - Intergenic
1014908427 6:127059288-127059310 GAGGGTAATTTTTCCTTTGGAGG + Intergenic
1015863158 6:137701561-137701583 CTGGATAATTCTTCATTGTGGGG - Intergenic
1017954015 6:159163222-159163244 CTGGAGAATTCTTGTTTTGATGG + Intergenic
1020146383 7:5647160-5647182 CAGGTTAATTCTTGCTCTGGTGG + Intronic
1020471633 7:8543064-8543086 CATGATGATTGTCCTTTTGGGGG + Intronic
1021358415 7:19683107-19683129 AATAATAATTCCTCTTTTGGGGG + Intergenic
1021687526 7:23201764-23201786 CACAATAATTCTTTTTTTGTTGG - Intergenic
1022073645 7:26943338-26943360 TATGAGAATTCTTCATTTGGGGG - Intronic
1022210197 7:28201113-28201135 CACGATAATTATTTTTCTGGGGG + Intergenic
1022397812 7:30006643-30006665 CAGAATAATTCTTCGTTGTGTGG + Intergenic
1023113898 7:36841611-36841633 CAGGATAAATCCACATTTGGGGG + Intergenic
1023175729 7:37433723-37433745 CAGGAGAATTCGTTTTTGGGGGG - Intronic
1023652526 7:42387158-42387180 CAGGATGATGCTTCCTTTGCAGG + Intergenic
1027547531 7:79547154-79547176 CAAAATAATGATTCTTTTGGTGG - Intergenic
1028408362 7:90500740-90500762 AAGGTTAAATCTCCTTTTGGAGG - Intronic
1029811887 7:103057715-103057737 CAAGAAGTTTCTTCTTTTGGGGG - Intronic
1029925483 7:104311719-104311741 CAGGTTAATTATTCTTTTCAAGG - Intergenic
1030644487 7:112044826-112044848 CAGGATAATTGTAGTTGTGGTGG - Intronic
1031375340 7:121017766-121017788 CAGAGTAATTCTCCTTTTTGTGG - Intronic
1031558439 7:123207658-123207680 AAGGATAATTCTTCTTTCTTTGG - Intergenic
1032067296 7:128781222-128781244 CAGGATCATTCTTCTTTGTGTGG - Intergenic
1033166629 7:139044034-139044056 CAGAATAATTCTTCGTTGTGTGG - Exonic
1034133730 7:148745448-148745470 CAGTATACACCTTCTTTTGGTGG + Intronic
1038995012 8:32912678-32912700 CAAGATAATTTTTTTTTGGGGGG - Intergenic
1039329997 8:36526580-36526602 CACTCTAATTCTTCCTTTGGAGG + Intergenic
1042864485 8:73345339-73345361 CAGGAAAATTCTTACTTTGTAGG - Intergenic
1046175167 8:110566265-110566287 CAAGTTCATACTTCTTTTGGGGG + Intergenic
1050988043 9:12107575-12107597 CTTGATTATTTTTCTTTTGGTGG - Intergenic
1051159638 9:14192429-14192451 CAGGGCAATTCTAATTTTGGGGG - Intronic
1052595853 9:30557691-30557713 CAGAATCATTCTTCCTTTAGGGG + Intergenic
1052747298 9:32452973-32452995 CAAGATACTTTTTTTTTTGGGGG - Exonic
1053387800 9:37708439-37708461 CAGGCTCATTGTTCATTTGGAGG - Exonic
1054928212 9:70609619-70609641 CAGGATAATTCTTCATTGTGGGG - Intronic
1055105904 9:72512686-72512708 CAGGAACCTTCTTCTTTTGATGG - Intergenic
1055116714 9:72612881-72612903 CAGGGTAATTTTTGTTGTGGGGG - Intronic
1055119042 9:72636955-72636977 CTGAATAATTCTTTTTGTGGAGG - Intronic
1055196311 9:73598763-73598785 CCAGATAATTCTTTGTTTGGGGG - Intergenic
1055435200 9:76285775-76285797 CATGTTTATTTTTCTTTTGGGGG - Intronic
1056894710 9:90533528-90533550 TAGGTTAAGGCTTCTTTTGGTGG - Intergenic
1060145016 9:121244720-121244742 CTGCATAATACTTCATTTGGGGG - Intronic
1060450554 9:123734676-123734698 GAGGATAATTCTTCCTCTGCGGG + Intronic
1186121911 X:6372538-6372560 CAGGATAATGGTGATTTTGGTGG - Intergenic
1186504477 X:10080197-10080219 CTGGATCATTCTTGTCTTGGGGG + Intronic
1186625098 X:11284774-11284796 TTGGATAATTCTTTATTTGGGGG + Intronic
1186676022 X:11818324-11818346 CAGGATAATTTATCTATTTGAGG - Intergenic
1189510076 X:41653581-41653603 CTGTATAATTTTTCCTTTGGGGG - Intronic
1189718974 X:43895454-43895476 CAGGATAATTCTTTGTTGTGGGG + Intergenic
1192016552 X:67337768-67337790 CAAAATAATTCTTTTCTTGGGGG - Intergenic
1194819294 X:98486394-98486416 CTAGATAATTCTTTGTTTGGTGG + Intergenic
1197103748 X:122688470-122688492 CAGTTTAATTCTTCTTTGTGTGG - Intergenic
1197549864 X:127877647-127877669 CAGGATATTTCTTCTTTGAAAGG - Intergenic
1198686620 X:139234406-139234428 CATGATAATTCCTATTTTGCAGG + Intergenic
1199135289 X:144243176-144243198 CAGAATAATTTATATTTTGGGGG + Intergenic
1199218347 X:145287323-145287345 CAGGATTTTTTTTTTTTTGGTGG + Intergenic
1199664467 X:150085640-150085662 TAGAATCATTCTTTTTTTGGTGG + Intergenic
1199785966 X:151105084-151105106 CTGGATAATTCTTTGTTTGGGGG - Intergenic