ID: 1170854563

View in Genome Browser
Species Human (GRCh38)
Location 20:20039261-20039283
Sequence CATCCCCCTCGTTCTCCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170854557_1170854563 16 Left 1170854557 20:20039222-20039244 CCTGGTTTAGAGAATACAGGGAT 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1170854563 20:20039261-20039283 CATCCCCCTCGTTCTCCGGGTGG 0: 1
1: 0
2: 1
3: 1
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170854563 Original CRISPR CATCCCCCTCGTTCTCCGGG TGG Intronic
902615377 1:17620751-17620773 CATCCCTCTCGATCTCGGGTTGG - Intronic
902716491 1:18276346-18276368 GGTCCCCCTCCTTCTCCAGGTGG + Intronic
902805551 1:18859312-18859334 CATGCCCCTAGTCCTCAGGGAGG - Intronic
905395032 1:37661359-37661381 CATCCCCTTGGTTCTCCCAGAGG - Intergenic
906143794 1:43548453-43548475 TCTCCCCCTCGTTCTATGGGTGG + Intronic
906211588 1:44015348-44015370 CTTCCCCCTCCTGCTCTGGGTGG + Intronic
907596701 1:55726931-55726953 CATCTCCCTCATTCTCCTTGTGG + Intergenic
911063589 1:93768516-93768538 CATCCCCCTCCTTCAAAGGGTGG - Intronic
915731251 1:158056019-158056041 CATCCCCCTCCCTCTCTGGCTGG + Intronic
917438555 1:175045394-175045416 CATCCTCCTCCTTATCCAGGAGG + Intergenic
923022513 1:230175667-230175689 CCTCCCCCTCCTTCTCCTTGGGG + Intronic
1071573706 10:86711462-86711484 CCTCCACCTCCCTCTCCGGGAGG + Intronic
1071778034 10:88810924-88810946 CATCCTCTTAGTTCTCAGGGAGG - Intronic
1074324270 10:112432666-112432688 CATCCACCTAGTTCCCTGGGAGG + Intronic
1076994992 11:293474-293496 CATACCCATCGAACTCCGGGTGG - Exonic
1085034621 11:73292610-73292632 CATCCCCCTCTTTCCCCTGCTGG + Intronic
1091413522 12:260054-260076 CATCCCACTTGTTTTCCAGGTGG - Exonic
1097710789 12:62914813-62914835 CATACCCTTCTTTCTCCGTGTGG - Intronic
1101706913 12:107229238-107229260 CATTCCCCTTGTTCTACTGGGGG - Intergenic
1102470978 12:113159798-113159820 CATTCTTCTAGTTCTCCGGGAGG + Intronic
1117958622 14:61142050-61142072 TCTCCCCCTCTTTCTCCTGGAGG - Intergenic
1119484415 14:74978516-74978538 CATCCCCCTCCTTGTCCGACTGG - Intergenic
1125896014 15:43302248-43302270 CATCTCCCTCCTTCTCCTGTCGG + Exonic
1132533754 16:467167-467189 CATCCCAGACGTTCTCAGGGAGG - Intronic
1132681674 16:1144975-1144997 CAGCACCTTCGTTCCCCGGGAGG - Intergenic
1133255620 16:4514096-4514118 CCTCCCCCTCCTTATCCTGGGGG - Exonic
1133976292 16:10601836-10601858 CAGCCCCCTCGATATCTGGGTGG + Intergenic
1136173096 16:28499878-28499900 CCTCCTCCTCCTCCTCCGGGAGG + Exonic
1139254911 16:65531469-65531491 CATAACCCCCGTTCTCTGGGGGG + Intergenic
1143361478 17:6375019-6375041 CTTCTCCCACCTTCTCCGGGTGG - Intergenic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1151570279 17:74922460-74922482 CAGCACCCACGTTCTCCGGCAGG - Intronic
1152446502 17:80347821-80347843 CATCCCCCTCATTAACCGGCTGG + Exonic
1152923375 17:83076923-83076945 CCTCCCCCTGGTCCTCTGGGAGG - Intergenic
1160755927 19:757192-757214 CATCCTCCCTGTTCTCCGAGTGG - Exonic
1160972302 19:1775049-1775071 CCTCCTCCTCATCCTCCGGGCGG + Intronic
1161361084 19:3850147-3850169 CATGCCCCTCCTTCTCCCAGAGG - Intronic
1161778323 19:6275928-6275950 TATCTCCCACGTTCTCCAGGGGG + Intronic
1164475023 19:28569113-28569135 CATCTCTCTCTTTCTCCAGGGGG - Intergenic
1166361348 19:42254105-42254127 CCTCCCCCTCGGTCGGCGGGCGG - Intronic
1166729890 19:45052998-45053020 CATCCCCCTCAGGCTCAGGGCGG - Intronic
1167043351 19:47035942-47035964 CATTCCCCTCCTTCGCCGGCAGG + Exonic
1167258436 19:48444133-48444155 CCGCCCCCTCGTTCTCAGGCTGG - Exonic
926395434 2:12436971-12436993 AATCTCCCTCGTTTTCCTGGAGG + Intergenic
934666405 2:96174332-96174354 CATCACCCTCCTGCTCCTGGAGG - Intergenic
938496705 2:131801682-131801704 CATCGCCCTCCTCCGCCGGGGGG + Intergenic
1169879142 20:10328028-10328050 CATCCCTCTCATTCTCCAGCAGG + Intergenic
1170578871 20:17682965-17682987 CATCGCCCTCGTTGTTAGGGAGG + Intergenic
1170854563 20:20039261-20039283 CATCCCCCTCGTTCTCCGGGTGG + Intronic
1174749431 20:53097140-53097162 CATCCCCCTCCTTGTCCCAGGGG - Intronic
1178867288 21:36339849-36339871 CCTACCCCTCCTTCTCCTGGAGG + Intronic
1179526075 21:41976714-41976736 CAGCCCCCAGGCTCTCCGGGGGG + Intergenic
1180626843 22:17199276-17199298 CTTCCCCCTTGTTCTGCAGGTGG - Intronic
1182135396 22:27897745-27897767 AATCCCTCTCATTCTCAGGGTGG + Intronic
1184265121 22:43342614-43342636 CCTCCTCCTCCTTCCCCGGGCGG + Intronic
949550056 3:5105116-5105138 CATCCCCCTCCCCCTCCTGGGGG + Intergenic
954364251 3:50137898-50137920 CAGCCCCTTCTTTCTCCAGGTGG - Intergenic
954420228 3:50415036-50415058 CATGACCCGCGTTCTCCGGGAGG - Intronic
956073372 3:65478625-65478647 CCTCCTCCTCATTCTCCGCGTGG + Exonic
960096608 3:113696247-113696269 CACCCCCTTCCTGCTCCGGGAGG - Intronic
969576677 4:8040128-8040150 CATCCCCTTCCTTCACCGTGAGG - Intronic
969728667 4:8940428-8940450 CAGCCCCCTGGTTCTCCGGGAGG - Intergenic
972382369 4:38531299-38531321 CCACCCCCTCTTTCTCCGGAGGG - Intergenic
973643929 4:52931514-52931536 CACCCCCCTCCGCCTCCGGGTGG + Intronic
977951453 4:102975487-102975509 CATTCCCCTCCTTTTCCTGGAGG - Intronic
981579360 4:146236587-146236609 CATCCTCCTCATTCCCAGGGTGG - Intergenic
986839400 5:11679056-11679078 CATCCCTTTCGTTCTCATGGGGG + Intronic
993111029 5:83657498-83657520 CATCCCTGTCTTTCTCCAGGAGG - Intronic
1001395841 5:171419409-171419431 CCTCCTCCTCCTTCTCCTGGCGG - Intergenic
1002123767 5:177026076-177026098 CGTCTCCCTGGTTCTCCTGGAGG + Intronic
1008990474 6:57595887-57595909 CAGCCCCCTCCTTTTCCTGGAGG + Intronic
1009179048 6:60494433-60494455 CAGCCCCCTCCTTTTCCTGGAGG + Intergenic
1017818020 6:158028973-158028995 CATCCCCCTGCTTCTGCGTGCGG - Exonic
1022140818 7:27491819-27491841 CCTTCCGCTCGTTCTCCAGGCGG + Intergenic
1033115318 7:138619913-138619935 CAGCACCCTGGTTCTCAGGGAGG + Intronic
1034590950 7:152138426-152138448 CATCCCCGTCCTTCTCCAAGGGG - Intronic
1040509899 8:48084451-48084473 CATCCCCATATTTCTCCTGGGGG - Intergenic
1043481486 8:80657132-80657154 CCTCCTCCTCCTTCTCCTGGTGG - Intronic
1044068239 8:87723889-87723911 CCTCCCCCATGTTCCCCGGGGGG + Intergenic
1049632483 8:143666081-143666103 CATCCCCCGCGCTGTCAGGGAGG - Intergenic
1049853262 8:144845736-144845758 CATCACCCTTGTACACCGGGAGG - Intronic
1054765038 9:69036066-69036088 CACCCCGCTCCTTCTCAGGGCGG + Intronic
1189234924 X:39479412-39479434 CATCTCCCTCGTTCTCAGACAGG + Intergenic
1200125708 X:153813427-153813449 CATCCTCCTGGTCCTCCTGGTGG - Intronic