ID: 1170855239

View in Genome Browser
Species Human (GRCh38)
Location 20:20047040-20047062
Sequence AAGAGGACACCAACTCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170855236_1170855239 10 Left 1170855236 20:20047007-20047029 CCCAACAAAGGTGTTTTTATTCT 0: 1
1: 0
2: 4
3: 39
4: 464
Right 1170855239 20:20047040-20047062 AAGAGGACACCAACTCTCAAAGG 0: 1
1: 0
2: 1
3: 7
4: 183
1170855237_1170855239 9 Left 1170855237 20:20047008-20047030 CCAACAAAGGTGTTTTTATTCTT 0: 1
1: 0
2: 4
3: 60
4: 587
Right 1170855239 20:20047040-20047062 AAGAGGACACCAACTCTCAAAGG 0: 1
1: 0
2: 1
3: 7
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170855239 Original CRISPR AAGAGGACACCAACTCTCAA AGG Intronic
901175302 1:7294386-7294408 AAAAGGACAGCAGCTCTCACTGG + Intronic
905494075 1:38370771-38370793 AAGAGGTCACAAACTCTAACTGG - Intergenic
907455194 1:54571224-54571246 AAGAGGACAGCAAGGCCCAAGGG - Intronic
908779694 1:67678886-67678908 ATGAGGAAAACAACTCTGAAAGG - Intergenic
914987091 1:152470324-152470346 AAGAGAACACTTCCTCTCAAAGG + Intergenic
915790130 1:158659976-158659998 AAAAGGACTCCAAATCACAATGG + Intronic
917651648 1:177083741-177083763 AAGTGGACAACTACTCTCAGTGG + Intronic
919497600 1:198294660-198294682 AATGGGACACCGTCTCTCAAAGG - Intronic
920212066 1:204335486-204335508 AAGGGGATCCCATCTCTCAAAGG + Intronic
920421968 1:205841009-205841031 AAGAGGGAACCAGCTCCCAAAGG - Intronic
1064619146 10:17196924-17196946 AAGAGGCATCCACCTCTCAAGGG + Intronic
1066408226 10:35140722-35140744 TCGAGGACACCAACTTTCAAAGG - Intronic
1067919737 10:50441524-50441546 AAAAGGAAACCAAAACTCAAAGG + Intronic
1069635039 10:69919899-69919921 AAGAGCACACCCACTCTCCTGGG + Intronic
1070105163 10:73424750-73424772 AAGAGGATACCAACTCCTGATGG + Exonic
1071098625 10:82009699-82009721 AAGAGGACTCCATCTTTCTAGGG + Intronic
1071882921 10:89918865-89918887 AAGAGAAAACCAAGGCTCAAAGG - Intergenic
1072644882 10:97245872-97245894 CAGAGGACACCATCTATCAGTGG + Intronic
1072894914 10:99358604-99358626 AAGAAGAGATCAACTCTAAAAGG + Intronic
1073952063 10:108821290-108821312 AAGAGAAAACCAACTCCCACAGG - Intergenic
1074429131 10:113378322-113378344 CAGAGAACACAAACTCTCCAGGG + Intergenic
1074565326 10:114572513-114572535 GAGAGGACACCACCTCTCCTCGG - Intronic
1074858101 10:117488333-117488355 AAAAGGAAATCCACTCTCAATGG - Intergenic
1077477865 11:2799091-2799113 AAGAGGACACCAGCTGGCGAGGG + Intronic
1081523591 11:43907299-43907321 ATGAGGACTCCAACTCCTAAGGG - Intronic
1082832455 11:57628863-57628885 AGGATGACACAAACCCTCAAGGG + Intergenic
1083348691 11:62012151-62012173 AAGGGGCCATCAACTCTCCACGG - Intergenic
1084197222 11:67530332-67530354 ATGAGGACACCAAGGCTCAGAGG - Intergenic
1085031936 11:73277017-73277039 ATGAGGAAACCAACTCTTCAGGG + Intronic
1086086577 11:82961551-82961573 AACTAGACACCATCTCTCAATGG + Intronic
1089557064 11:119320658-119320680 AAGAGGCCAGCAGCTCTCAGGGG - Intronic
1092543141 12:9432608-9432630 GAGAGGACAGCAACTGTCCACGG + Intergenic
1093416719 12:18928769-18928791 CAGAGAACCCCAACTCACAAAGG + Intergenic
1094509880 12:31089830-31089852 GAGAGGACAGCAACTGTCCACGG - Intronic
1095593067 12:43926621-43926643 AAGAGAACACCATGTCTAAATGG - Intronic
1096613961 12:52821249-52821271 AAGAGGAGACCAAGGCTCAGAGG - Intergenic
1096626372 12:52898577-52898599 AACAGGACCCCAAGTCCCAAGGG + Intronic
1099345328 12:81492660-81492682 AAGAGGAGACCACATCTCAGAGG + Intronic
1100489794 12:95068217-95068239 AAGAGGACACAGACACTCAGAGG - Intronic
1102061208 12:109932972-109932994 AAGAGAACAACAACTGACAAGGG - Exonic
1107008305 13:35640368-35640390 TAGAGGACACCTTCTCTAAATGG + Intronic
1107567649 13:41622406-41622428 TAGATGAAACCAGCTCTCAAAGG - Intronic
1110075705 13:71239565-71239587 AAGAGGAAACCAGCACTCACTGG - Intergenic
1111039471 13:82726720-82726742 AAGAGGAGAACAACTCACACAGG - Intergenic
1112581354 13:100678911-100678933 TAGAGGTCTCCAACTCTCCAGGG + Intergenic
1115502608 14:34062851-34062873 AAGAGGACAACACCTGTGAAAGG - Intronic
1117621214 14:57588918-57588940 AAGAGGACACAAATTCAGAAAGG - Intronic
1118639898 14:67782634-67782656 AAGAGGAGACCAGGTCTCAGAGG - Intronic
1119232614 14:72992848-72992870 AACATGACACCAACTCACCAGGG + Intronic
1120501028 14:85297530-85297552 AAAAGGACTCCAAATCTCAATGG + Intergenic
1120984368 14:90320846-90320868 AAGAGGAAACTAAGACTCAAAGG + Intronic
1121560454 14:94871178-94871200 AAGAGGACACAACATTTCAACGG - Intergenic
1121661761 14:95640432-95640454 CAGAGTACACCAACTATAAAAGG + Intergenic
1122765882 14:104069565-104069587 AAGAGGGAACCAACCCACAAAGG - Intergenic
1125333398 15:38604089-38604111 AAAAGGACTTCAACTCTCTAGGG - Intergenic
1125372818 15:38996710-38996732 AACAGGAAACTACCTCTCAATGG + Intergenic
1127851969 15:62921166-62921188 AAGTTGACAGCATCTCTCAAGGG - Intergenic
1129136700 15:73559285-73559307 AAGAGGCCACAGACTCCCAAAGG - Intronic
1130123801 15:81075207-81075229 AAGAGGAAAGCAACTTACAAAGG + Intronic
1130688312 15:86058514-86058536 ATGAGGAAACCAAGTCTCAGAGG + Intergenic
1132405820 15:101541422-101541444 GAGAGGACACCAAATCCCACAGG - Intergenic
1133707462 16:8368789-8368811 AAGAGCACACCAACTCTCATAGG + Intergenic
1135934318 16:26766734-26766756 AAGAGGACACACCCTCTCCAGGG - Intergenic
1139337174 16:66240987-66241009 AAGAGAACAGCCCCTCTCAATGG + Intergenic
1140963033 16:79935502-79935524 ATGAGGTCAGCACCTCTCAAAGG + Intergenic
1145192406 17:20855122-20855144 AAGAGGATATCAACGCCCAATGG - Intronic
1145402924 17:22558176-22558198 AAGAGGAAATCAACGCCCAATGG - Intergenic
1148353480 17:46958081-46958103 GAGAGGAGACCCACTCTCCATGG - Intronic
1151429660 17:74053739-74053761 AAGAGGCCACCATCTCAAAACGG + Intergenic
1151783256 17:76261723-76261745 AAAAGGACACCAGCTCTCTTGGG - Intergenic
1152144959 17:78562758-78562780 AAGAGCACTGCCACTCTCAAGGG + Intronic
1156961866 18:43042096-43042118 GACAGGACATCAATTCTCAAAGG - Intronic
1158548447 18:58415271-58415293 AAGAGGACCGGAACTCACAATGG + Intergenic
1158794420 18:60825989-60826011 AAGAGGAAAGATACTCTCAAAGG + Intergenic
1160353517 18:78206249-78206271 AAGAGTAAACCAACTGTCAAAGG + Intergenic
1164298979 19:23942277-23942299 AACTGGAAATCAACTCTCAAAGG - Intronic
1164314987 19:24079507-24079529 AAGGGGACACCTCCTCTCACAGG - Intronic
1164530904 19:29047514-29047536 AAGAGGACACTAGCTGTGAAAGG + Intergenic
1168347356 19:55656980-55657002 AAGAGAAAACCAAGTCTTAAAGG + Intronic
927962575 2:27250169-27250191 AAGAGTACTCCAACTATAAAAGG + Intergenic
928699599 2:33885091-33885113 ATAAAGACACCATCTCTCAATGG + Intergenic
929932216 2:46267049-46267071 ATGAGCACACCAACTCTCACAGG + Intergenic
932221981 2:70006556-70006578 AAGAGGACACCAAGACTCATGGG + Intergenic
932356136 2:71069718-71069740 AAGAGGACATGAAATTTCAAGGG - Intronic
934543666 2:95196717-95196739 AGGAGGACACCATGTCTCATAGG - Intergenic
934576254 2:95403270-95403292 AAGAGGACACTGAGACTCAAAGG - Intronic
934638437 2:96011103-96011125 AAGAGGACACTGAGACTCAAAGG - Intergenic
934795218 2:97094308-97094330 AAGAGGACACTGAGACTCAAAGG + Intronic
935665016 2:105503662-105503684 AAGATAACACCAACTTTCACAGG - Intergenic
935807832 2:106766513-106766535 AAGACGACACTCACTCTCACAGG - Intergenic
936404509 2:112190513-112190535 AAGAAGAAAACAACTCTCACAGG - Intergenic
942169343 2:173274593-173274615 AAGAAGACACCAAATTACAATGG - Intergenic
945886088 2:215377390-215377412 AAGAGGGCACCAAGCCACAAGGG - Intronic
946575585 2:221071920-221071942 CAGAGGGCACCAAGTCCCAAAGG + Intergenic
948307862 2:236963127-236963149 ATGAGGACACGAACACACAAAGG - Intergenic
948307996 2:236963936-236963958 AGGAGGACACCAACTGTGCAGGG - Intergenic
1169482417 20:5996655-5996677 AAGAGGAAAATAAGTCTCAAAGG + Intergenic
1170855239 20:20047040-20047062 AAGAGGACACCAACTCTCAAAGG + Intronic
1170994545 20:21339389-21339411 AAGAGTACAGTAACTTTCAAGGG - Intronic
1171325876 20:24292123-24292145 AAGAGAACACACACTGTCAATGG - Intergenic
1173329200 20:42060266-42060288 AAGAGGAGGCCAAATCTGAAAGG + Intergenic
1173476563 20:43364001-43364023 AAGAGGAAACTAACACTCCAAGG + Intergenic
1175006624 20:55690188-55690210 AAGAGAACAGAAGCTCTCAAAGG + Intergenic
1179093008 21:38285419-38285441 ATGAGGAAACCGAGTCTCAAAGG + Intronic
1183792533 22:40084576-40084598 GAGAGGCCACCAAGTCTAAAAGG - Intronic
1183813636 22:40279843-40279865 AAGACGAGACAAACTCTCATTGG - Intronic
1185164288 22:49251109-49251131 GAGACTACACCAACTCCCAAAGG + Intergenic
951579218 3:24144221-24144243 AAAAGGACCCCAACTCTTCATGG + Intronic
951724084 3:25736576-25736598 AAGAGAACACTAACTATTAATGG + Intronic
952724121 3:36564151-36564173 GAAAGAACACCAACTCTAAAAGG - Intergenic
952986635 3:38791524-38791546 AAGAGCACACATAGTCTCAATGG - Intronic
953152185 3:40334577-40334599 AAGAGGATACCTGCTCTCCAGGG - Intergenic
955026246 3:55170486-55170508 ATGAGGAAACCAAGGCTCAATGG - Intergenic
955837129 3:63068404-63068426 AACAGGAGACCAACTGTAAATGG - Intergenic
956293702 3:67689367-67689389 TAGAGGACACCAACATTCCATGG + Intergenic
961078222 3:124001400-124001422 AAGAGGACAACAACCTCCAAAGG - Intergenic
961305300 3:125955371-125955393 AAGAGGACAACAACCTCCAAAGG + Intergenic
961409208 3:126706111-126706133 AACAGGAGACCAAATCACAAGGG - Intronic
964060947 3:152522209-152522231 TAGATGCCACCCACTCTCAAAGG + Intergenic
964130899 3:153285355-153285377 AAGAGGAAACAAACACTCACAGG - Intergenic
964913960 3:161816932-161816954 AAGTTGACACCAATTCTGAATGG - Intergenic
970390308 4:15603043-15603065 AAGTTGATTCCAACTCTCAATGG - Intergenic
970779821 4:19723396-19723418 TAGAGGAGACCAAATCTCAGAGG + Intergenic
971641696 4:29142245-29142267 AAGAGGACACCAACTTTACTTGG - Intergenic
972646020 4:40968126-40968148 AAGATGACACCAACCTTAAAGGG - Intronic
972694552 4:41432920-41432942 AACAAGACAGCATCTCTCAAAGG + Intronic
974673442 4:65060234-65060256 AAGAGGACAGAAACCTTCAAAGG + Intergenic
975667037 4:76742179-76742201 AGGAAGTCACCACCTCTCAATGG + Intronic
977550829 4:98441348-98441370 AAGAGGACAAAAAATCTAAAAGG + Intronic
978048451 4:104164749-104164771 AAGAGGCCACCCTCTCTGAAAGG + Intergenic
979884308 4:126005314-126005336 AAGAGGAATCCAACTAACAATGG + Intergenic
983319050 4:166171929-166171951 AAAATGACACCCATTCTCAAGGG - Intergenic
984172925 4:176382593-176382615 ATGAGGAGGCCAACACTCAAGGG - Intergenic
985529068 5:423259-423281 AAGGGGCAACCAACTCTGAATGG - Intronic
987879568 5:23725650-23725672 ATGAGGACACTAACATTCAAAGG + Intergenic
987927847 5:24364981-24365003 TAGAGGCCACCAACTCACAGAGG + Intergenic
988087888 5:26495313-26495335 AAGAGGATAAAATCTCTCAAAGG + Intergenic
989755218 5:44944189-44944211 CAAAGTACACCAAATCTCAATGG - Intergenic
990866081 5:60381561-60381583 AAGATGACACCAAATTTCCAAGG + Intronic
993069521 5:83142294-83142316 ATGAGGAAACTAACTCTCAGTGG + Intronic
993069523 5:83142324-83142346 ATGAGGAAACTAACTCTCAGTGG + Intronic
996355387 5:122590659-122590681 AAGCACACACCAACACTCAAAGG + Intergenic
998932129 5:147193057-147193079 AAAATGTCATCAACTCTCAATGG - Intergenic
998959482 5:147469732-147469754 AAGAGGTCACCCATTCTCACTGG + Intronic
1001800849 5:174542710-174542732 TGGAGGACACCAAGTCTGAAAGG - Intergenic
1001844861 5:174912849-174912871 AAGAGGACAGCAACTGAGAAGGG - Intergenic
1002596276 5:180325527-180325549 AAGAGGACAATAACTGTCACAGG + Intronic
1004999195 6:21223896-21223918 AAGAGGACAGCAAACCTCCACGG - Intronic
1009817153 6:68751011-68751033 AAGAGGAAACCTGCACTCAAGGG - Intronic
1010592814 6:77730481-77730503 AAGAGGAAACCATCTCTCTTTGG - Intronic
1012205289 6:96453752-96453774 AAGAGAACTCCAAGTCTCAGAGG + Intergenic
1013228447 6:108138785-108138807 AATAGAACACCAACTCAAAATGG - Intronic
1015317695 6:131835094-131835116 AAGAGACCAGTAACTCTCAATGG - Intronic
1015962556 6:138665452-138665474 TAGAGGCCACCTACTCTCCAAGG + Intronic
1016244754 6:141968587-141968609 AGAGGGAGACCAACTCTCAATGG + Intergenic
1018130612 6:160729198-160729220 AAGATGTCACCAACACTTAATGG + Intronic
1018342877 6:162870034-162870056 AAGAGGACACCCAATCTCCCAGG - Intronic
1021148866 7:17124574-17124596 GAGTGGACCCCATCTCTCAATGG - Intergenic
1023555322 7:41416249-41416271 AAGAAAAAAACAACTCTCAAAGG + Intergenic
1023969454 7:44980182-44980204 ATGAGTACAACAAATCTCAAAGG - Intergenic
1025985310 7:66445582-66445604 ATGAGGACACCCAATCTAAATGG - Intergenic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1026683914 7:72491990-72492012 CAAGGGACTCCAACTCTCAAAGG + Intergenic
1027731040 7:81872910-81872932 AACAGGACACCATCCCTCAAGGG - Intergenic
1029360555 7:100085645-100085667 AAGGGGCCAGCAACCCTCAATGG - Intergenic
1029612004 7:101631397-101631419 CAGAGGACACTTACTCTCCAGGG - Intergenic
1030156673 7:106462213-106462235 AAGAAGACACCAGCTATAAATGG + Intergenic
1034311014 7:150087765-150087787 AAGAAAACACAAACTCTCAAAGG + Intergenic
1035327174 7:158072719-158072741 CAGGGGACACCAACTGCCAAGGG + Intronic
1039846693 8:41330517-41330539 AAGCGCACACCATCTCTGAATGG + Intergenic
1040366761 8:46725368-46725390 AAGGAGACTCCAACTCTCCATGG - Intergenic
1045931111 8:107627630-107627652 AAGAGGACGTCAACTTTCAGGGG + Intergenic
1046996402 8:120528990-120529012 AAGAGGCCTCCAAATTTCAATGG + Intronic
1048399985 8:134056420-134056442 CAGAGGAGACCATCCCTCAATGG - Intergenic
1049108337 8:140627451-140627473 CAGAGTACACTAACTCTCTAAGG + Intronic
1050206779 9:3204726-3204748 AAGAGGCCAGCATCTGTCAAGGG - Intergenic
1051604393 9:18906207-18906229 CAGCGGCCACCAAGTCTCAAAGG + Intronic
1054734099 9:68733008-68733030 AAGAGGGCACCAAAATTCAATGG - Intronic
1055067598 9:72134221-72134243 AAGATGACACTAGCTCTCTAAGG - Intronic
1057792684 9:98134510-98134532 AAGAGGAGAGCAACTATCATTGG - Intronic
1058390210 9:104487613-104487635 ACGACAACACCAACTCTCACTGG + Intergenic
1059143286 9:111874570-111874592 AATTAGACACCACCTCTCAAAGG + Intergenic
1059702111 9:116785291-116785313 GAGAGGACACAAACTCACTAGGG - Intronic
1060784850 9:126443089-126443111 AGGAGGACACAAACTCTTGATGG - Intronic
1061971663 9:134048587-134048609 GAGAGGACACCAAGGCTCAGGGG + Intronic
1191055407 X:56234785-56234807 CAAAGGTCAACAACTCTCAAGGG - Intronic
1191157871 X:57295406-57295428 AAGAGGGCACAAATTATCAAAGG + Intronic
1193416403 X:81229654-81229676 AAGAGCACACCAACAGTCACTGG - Intronic
1194309294 X:92284773-92284795 AATCTGGCACCAACTCTCAACGG + Intronic
1198875012 X:141215169-141215191 AAGAAGAAACCATATCTCAAAGG - Intergenic
1199912350 X:152300511-152300533 AAAATGTCACCAATTCTCAAGGG + Intronic
1200148051 X:153936866-153936888 AAGAATACACCAACTCTTATGGG - Intronic