ID: 1170856230

View in Genome Browser
Species Human (GRCh38)
Location 20:20058161-20058183
Sequence TTATATTACATTCATCAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170856230_1170856237 0 Left 1170856230 20:20058161-20058183 CCCCCCTGATGAATGTAATATAA 0: 1
1: 0
2: 2
3: 8
4: 169
Right 1170856237 20:20058184-20058206 ATTGGCACAATTTTACTAGAGGG 0: 1
1: 0
2: 1
3: 17
4: 192
1170856230_1170856236 -1 Left 1170856230 20:20058161-20058183 CCCCCCTGATGAATGTAATATAA 0: 1
1: 0
2: 2
3: 8
4: 169
Right 1170856236 20:20058183-20058205 AATTGGCACAATTTTACTAGAGG 0: 1
1: 0
2: 0
3: 29
4: 172
1170856230_1170856239 8 Left 1170856230 20:20058161-20058183 CCCCCCTGATGAATGTAATATAA 0: 1
1: 0
2: 2
3: 8
4: 169
Right 1170856239 20:20058192-20058214 AATTTTACTAGAGGGCAGTAGGG 0: 1
1: 0
2: 1
3: 20
4: 151
1170856230_1170856238 7 Left 1170856230 20:20058161-20058183 CCCCCCTGATGAATGTAATATAA 0: 1
1: 0
2: 2
3: 8
4: 169
Right 1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG 0: 1
1: 0
2: 2
3: 11
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170856230 Original CRISPR TTATATTACATTCATCAGGG GGG (reversed) Intronic
906443805 1:45875539-45875561 TGATATAACATTAATCAAGGGGG + Intronic
907734180 1:57095627-57095649 TTTTATTACAGTCAAGAGGGAGG + Intronic
907791047 1:57663765-57663787 TAATATTACATTCTTCTGGTTGG + Intronic
908782554 1:67704535-67704557 TTTCATTCCAATCATCAGGGTGG + Exonic
909015529 1:70375894-70375916 TTATATTAGAATCTTCAGTGTGG + Intronic
915205950 1:154270463-154270485 CTATAATACATACAACAGGGTGG - Exonic
915864022 1:159478652-159478674 TTATATCACATTCAACACAGTGG + Intergenic
916176898 1:162049114-162049136 ATATATTACTTTCATCAGTAAGG - Intergenic
918428916 1:184438206-184438228 CTATATTACCTTCATCAGGAAGG - Intronic
923162969 1:231333232-231333254 TTATGTTACATTCCTCAAAGTGG - Exonic
923581230 1:235215882-235215904 AAATATTATATTCATCAGGTGGG - Intronic
923657922 1:235934470-235934492 TTCTAATACATTCAACAGAGTGG + Intergenic
923882902 1:238123168-238123190 TTATATTATTATGATCAGGGTGG + Intergenic
924650658 1:245924157-245924179 TTATAAAACATGGATCAGGGAGG - Intronic
924846702 1:247781734-247781756 TTACATCACATTTATCAGGATGG - Intergenic
1064746682 10:18485425-18485447 TTATATTAAATGCCTCAGGTGGG - Intronic
1066328295 10:34388992-34389014 TTATCTTAGATTCATAAGGAAGG - Intronic
1071678271 10:87677779-87677801 TTATATTACATGCATGCGTGTGG + Intronic
1073956798 10:108882057-108882079 TTATATTATAATCAACAGGAGGG - Intergenic
1073958722 10:108901769-108901791 TTATCTCACATTCATCTGGTGGG + Intergenic
1074409774 10:113217343-113217365 TCAAATTACATTCACCTGGGAGG - Intergenic
1076857803 10:133126186-133126208 TTAGATGAAATTCTTCAGGGTGG - Intronic
1080258895 11:30323834-30323856 TGATAGTACTTTCCTCAGGGTGG + Intronic
1082297920 11:50466352-50466374 TTATTTTTCATTCATCAGTTTGG + Intergenic
1082573220 11:54768102-54768124 TTTTTTTTCATTCAGCAGGGTGG + Intergenic
1083485898 11:62982851-62982873 TTATTTTACATTAATCAAAGAGG + Intronic
1083577102 11:63799973-63799995 TTATATTACAGCCATCCTGGTGG - Intergenic
1087722007 11:101676986-101677008 TTAAATTGTATTCAGCAGGGTGG - Intronic
1089270419 11:117298104-117298126 TTTTACTACATTCACCAGGCTGG - Intronic
1091534919 12:1397439-1397461 TTATAGTATATCCATCAGAGTGG + Intronic
1092269953 12:7016077-7016099 TTGTATTACATTCATTAGTTAGG - Intronic
1092298684 12:7224056-7224078 CTATATTATATTCATCAGAATGG + Intergenic
1094272704 12:28634924-28634946 TTACATGACATTCAACAGGCAGG - Intergenic
1094627972 12:32143221-32143243 TTCTATTTCCTTCATCTGGGTGG - Intronic
1096929312 12:55188014-55188036 GTAGAGTACATTCATAAGGGTGG - Intergenic
1098197543 12:68017647-68017669 TTATATTATATTCCCCAGAGAGG - Intergenic
1104873008 12:132014212-132014234 TTAGTTTCCATTCATCCGGGAGG + Intronic
1106955635 13:34935574-34935596 TTAGATCACTTTCATCTGGGTGG + Intergenic
1107451108 13:40510467-40510489 TTTTATTATATTCATCCTGGTGG - Intergenic
1107982883 13:45750322-45750344 TTATATTACCTTCTTCAGAGGGG + Intergenic
1109504031 13:63275049-63275071 TTAATTTACATTCATTAGGATGG - Intergenic
1109924210 13:69113356-69113378 TTATTTTATATACATCAGGAAGG - Intergenic
1111452438 13:88436941-88436963 TTAAATGACATTCATGAGGCTGG + Intergenic
1112064384 13:95777063-95777085 TTATAGTAGTTTCCTCAGGGAGG + Intronic
1112106366 13:96244452-96244474 CTATATTAAATTAATCAAGGAGG + Intronic
1112421871 13:99259669-99259691 TTATATTTCATTCATCACACAGG + Intronic
1117905472 14:60581045-60581067 TTATTATCCATTCATGAGGGTGG - Intergenic
1118850972 14:69583262-69583284 TTAAAGTACAGTCATCAGGGTGG - Intergenic
1120522949 14:85546068-85546090 TTATTTTCCATTCATCAATGTGG - Intronic
1120733452 14:88027876-88027898 TTATATAAGTATCATCAGGGTGG + Intergenic
1121162819 14:91760776-91760798 TAATTTTACCTTCATTAGGGTGG - Intronic
1123672105 15:22669104-22669126 TTATAGTACAATCATCTGGCAGG - Intergenic
1124324152 15:28742315-28742337 TTATAGTACAATCATCTGGCAGG - Intergenic
1124528038 15:30475564-30475586 TTATAGTACAATCATCTGGCAGG - Intergenic
1124770619 15:32532142-32532164 TTATAGTACAATCATCTGGCAGG + Intergenic
1125153029 15:36555069-36555091 ATAAATTACCTTCATCAGGCTGG - Intergenic
1128030859 15:64478779-64478801 TTATATTACCTTTCTCTGGGAGG + Intronic
1128851021 15:70955998-70956020 TTATTTTATATTGATCAGTGAGG - Intronic
1129585781 15:76863204-76863226 TGATATGACATTCATTAGTGGGG - Intronic
1144600755 17:16610718-16610740 ATATATTACATTCATTTAGGAGG - Intergenic
1146521282 17:33527470-33527492 TTAAATGAGATACATCAGGGTGG + Intronic
1149730115 17:58937233-58937255 TTATATGACATTTATCATGTAGG + Intronic
1153361628 18:4204449-4204471 TTATAAAACATTCATAAGGATGG + Intronic
1156632161 18:38983254-38983276 TTATATTACACTATTCAGGTAGG + Intergenic
1157204958 18:45689853-45689875 TTCTAAGACATTCATGAGGGAGG - Intergenic
1159536528 18:69722176-69722198 TCTTAATACATTCTTCAGGGAGG + Intronic
1162621287 19:11846597-11846619 CTTTATCAAATTCATCAGGGAGG - Intergenic
1162625064 19:11878839-11878861 CTTTATCAAATTCATCAGGGAGG - Intronic
1162630300 19:11922595-11922617 CTTTATCAAATTCATCAGGGAGG - Intergenic
1162635222 19:11962865-11962887 CTTTATCAAATTCATCAGGGAGG - Intronic
1164129895 19:22352006-22352028 TTATATTATATGCATGAGTGTGG - Intergenic
1164169652 19:22714007-22714029 TTATATTATATACATGAGTGTGG + Intergenic
1166910343 19:46150055-46150077 GTTTATTACAGTCATCTGGGTGG + Intronic
1166923408 19:46248523-46248545 GTTTATTACAGTCATCTGGGTGG - Intergenic
1167859821 19:52273629-52273651 TGATATTACCTTCTTCATGGAGG + Intronic
1168521624 19:57055692-57055714 TTATATAAGCTTCATAAGGGTGG - Intergenic
928037501 2:27838641-27838663 TTATGTTTCTTTCATCATGGTGG - Intronic
930887798 2:56347959-56347981 TTATAATAAACTCATCAGGTAGG - Intronic
931115985 2:59167450-59167472 GTAAATAACATTGATCAGGGAGG + Intergenic
931579260 2:63755096-63755118 TTAGATTACTTTCCTGAGGGAGG - Intronic
933126348 2:78612168-78612190 TTATATTACTTACATGAGGTAGG - Intergenic
933285103 2:80376892-80376914 TTTGATTACAATCATCAGTGAGG + Intronic
941128887 2:161621950-161621972 TTTTATTTCATTCTTCAGAGAGG + Intronic
941218501 2:162744228-162744250 TTATATTGCATTTAACAAGGTGG - Intronic
942138575 2:172954611-172954633 TTATTTTAATTTCATCTGGGCGG + Intronic
942774635 2:179566834-179566856 TTTAATTACATTCATTGGGGAGG + Intronic
944419645 2:199515953-199515975 GTATATTAAATACATTAGGGTGG + Intergenic
947561893 2:231161790-231161812 TTAAATAAAATTCATCAGAGTGG - Intronic
948501871 2:238400596-238400618 TTATATTACATACATTTTGGGGG + Exonic
1168742369 20:202864-202886 TTAAATTAAGTTCATCAAGGAGG + Intergenic
1168878717 20:1187885-1187907 TTTACTTACATTCATCAGTGAGG - Intronic
1169868626 20:10227831-10227853 ATATATTACATTCACCAGTGGGG + Intronic
1170856230 20:20058161-20058183 TTATATTACATTCATCAGGGGGG - Intronic
1170911349 20:20573033-20573055 TTATACTACAGTCATCTGTGAGG + Exonic
1172592164 20:36125536-36125558 TTATCTTCCATTCAACAGTGGGG + Intronic
1179059775 21:37968996-37969018 TTTTATTACAATCAACAGGAAGG - Intronic
1180133014 21:45839463-45839485 TTATATTATGTTCTTCAGGATGG + Intronic
1182697729 22:32207751-32207773 TTAAATTTCATGAATCAGGGAGG + Intergenic
1182817540 22:33179097-33179119 TTAGATAAGATTCTTCAGGGTGG - Intronic
1184032693 22:41904288-41904310 TTATATCTCAGTCTTCAGGGAGG - Intronic
949810380 3:8000978-8001000 TTAGGTCACATTCATCTGGGAGG + Intergenic
949813038 3:8028228-8028250 TCATATTACATTTATGAGAGTGG - Intergenic
951671865 3:25192380-25192402 TTCCCTTCCATTCATCAGGGAGG - Intronic
951877111 3:27439757-27439779 TTATATAAAAGTCATCAGAGAGG + Intronic
952619466 3:35319989-35320011 TTATATCCCATTGACCAGGGTGG + Intergenic
953259437 3:41323297-41323319 ATATATTAAATTCATTAGAGTGG + Intronic
957014515 3:75047350-75047372 TTCTGTTAAATTCATCAGGCTGG + Intergenic
957718665 3:83967029-83967051 TTTTAATACCTTCATGAGGGAGG + Intergenic
959603626 3:108218501-108218523 TAAAATTACTATCATCAGGGTGG + Intronic
960348070 3:116559389-116559411 TGATATTACATTCAAAAGGATGG - Intronic
960480751 3:118186139-118186161 TTTTATTAGAATCATCAGGAAGG + Intergenic
963247462 3:143076001-143076023 GTAGATTACATTCATGATGGAGG - Intergenic
963249637 3:143091177-143091199 TTTTATTAGATTCATTAGGATGG - Intergenic
963486953 3:145946911-145946933 ATATATTAAATACATCAAGGTGG - Intergenic
967149942 3:186639262-186639284 GCATATTCCATTCATGAGGGTGG + Intronic
967543794 3:190699716-190699738 TTAAATTTCATTCAACAGAGGGG - Intergenic
971650403 4:29264068-29264090 TTATACTACACTGATAAGGGAGG - Intergenic
971709226 4:30090142-30090164 TTTTATTGCATTCCTCAGAGTGG + Intergenic
971860949 4:32104662-32104684 TTAAATTACACTCCACAGGGTGG - Intergenic
974579720 4:63780732-63780754 TTATTTTACATTGATAAGGCAGG - Intergenic
974895518 4:67933404-67933426 TTACATCACATTTAACAGGGTGG - Intronic
977094167 4:92717396-92717418 TTATCTTACATTCTACAGGTAGG + Intronic
980543905 4:134231926-134231948 TTATTTTATATTCAGCATGGAGG - Intergenic
980676543 4:136090854-136090876 TGATATTGCATTCATGAGGAGGG - Intergenic
981895331 4:149792181-149792203 TTATATTAATTACATCAGAGGGG + Intergenic
982063971 4:151635177-151635199 TTATCTCATATTCATTAGGGTGG + Intronic
983390324 4:167122608-167122630 TTGTATTATATTCATCAGAATGG - Intronic
984388814 4:179100761-179100783 TTATATTATATTCATAAGAAAGG - Intergenic
984449727 4:179884083-179884105 TCATACTACAGTCATCAGGGTGG + Intergenic
986478034 5:8155691-8155713 TTATATTACTAACATCAGTGAGG + Intergenic
989160918 5:38390677-38390699 TCATTTTACATTCATCAGATTGG - Intronic
989734284 5:44684753-44684775 TTATATTGCATACTTTAGGGAGG - Intergenic
993886604 5:93422493-93422515 TTACAATACATTCATTAGGCTGG + Intergenic
995351426 5:111180598-111180620 TTATAATATATAGATCAGGGTGG - Intergenic
999002448 5:147939321-147939343 TTATATTATTCTCTTCAGGGTGG + Intergenic
1005337075 6:24807985-24808007 TTATATTAGAATCACCTGGGAGG + Intronic
1005706772 6:28462816-28462838 TTTTATTACATTCACCAGGGAGG - Intergenic
1008229541 6:48967891-48967913 TTATATTACATGCAACAGTTTGG + Intergenic
1009502398 6:64431323-64431345 TTAAAATAAATTCATCAGGGTGG - Intronic
1011694172 6:89897271-89897293 ATACATTACAGTCATCTGGGAGG + Intergenic
1013320432 6:108982661-108982683 TTACCTCACACTCATCAGGGTGG - Intergenic
1014894897 6:126890099-126890121 CTATATTTTATTCATCAGTGTGG + Intergenic
1016558151 6:145363144-145363166 TTATATTACATTCATAACTTGGG - Intergenic
1017258701 6:152363196-152363218 TTAAATTTCATTAATCAGGCCGG + Intronic
1021580962 7:22152970-22152992 TTAAATTAGATTCATCAGTATGG - Intronic
1023106761 7:36770531-36770553 TTATATTAGAATGCTCAGGGTGG + Intergenic
1024336022 7:48205950-48205972 TTATATTTCAATCATGATGGTGG - Intronic
1024411700 7:49050254-49050276 TTTTATTACATTCATGACAGGGG + Intergenic
1024982558 7:55169935-55169957 TTGTATTGCATTCAGCAGGCAGG + Intronic
1030154866 7:106444437-106444459 TTATATTAGATGGATCAAGGAGG - Intergenic
1031255305 7:119439820-119439842 TTTAAATACATTCACCAGGGAGG + Intergenic
1033217526 7:139504221-139504243 TTATATAACATGCATCTGGCTGG + Intergenic
1035569942 8:666153-666175 TTATATTAAAATCATCAGACAGG - Intronic
1037599674 8:20383634-20383656 TTTTATTACATTCCTCACCGCGG + Intergenic
1040344377 8:46474105-46474127 TTTCTTTACATTCATCAGGTTGG - Intergenic
1040344472 8:46475826-46475848 TTTTTTTACATTCAGCAGGTTGG - Intergenic
1040344814 8:46481373-46481395 TTTTTTTACATTCATCAGGTTGG - Intergenic
1040344889 8:46482418-46482440 TTTCATTAAATTCAGCAGGGTGG - Intergenic
1040345889 8:46493164-46493186 TTTTGTTACATTCAACAGGTTGG - Intergenic
1040347632 8:46523390-46523412 TTTTTTTACATTCATCAGGTTGG + Intergenic
1043487919 8:80716838-80716860 TTATATTAAATTCTACATGGAGG + Intronic
1046887992 8:119389759-119389781 TTACATTACCTTCATCATTGAGG + Intergenic
1047353869 8:124101633-124101655 TAATATTACATACTTCAGAGAGG + Intronic
1048288260 8:133159495-133159517 TTATTTTACATTCATCCAGCTGG + Intergenic
1050689292 9:8207390-8207412 TTAAAGTACATTCATCCAGGGGG - Intergenic
1056746258 9:89306434-89306456 TAAGATTAAAGTCATCAGGGTGG + Intergenic
1057624356 9:96664424-96664446 TTATATTTCATACATCAGATTGG + Intergenic
1058532591 9:105921513-105921535 ATATGTTATATTCAGCAGGGTGG + Intergenic
1059067033 9:111096220-111096242 TTAGATTAGAATCAGCAGGGGGG - Intergenic
1061732392 9:132625959-132625981 CTATTTTAAATTCATCAGAGAGG - Intronic
1188211439 X:27429913-27429935 TTAGATTACATGCATCATGAAGG + Intergenic
1188482019 X:30646070-30646092 TTATATTACATTTATAATCGTGG - Intergenic
1188994434 X:36865777-36865799 TAATATTACATTCATCCAAGTGG - Intergenic
1195342212 X:103917337-103917359 TTAAATTACATTCATTAGGGTGG - Intergenic
1196599646 X:117587050-117587072 TTAAATCACTTTCATCAGTGAGG + Intergenic
1196617411 X:117783074-117783096 TTTGATTATATTCATCATGGGGG - Intergenic
1198702734 X:139415151-139415173 TAATATTACATTAATTAGGATGG + Intergenic
1198759630 X:140018005-140018027 TTTTATTGCATTCATCAGCATGG - Intergenic
1198779156 X:140216045-140216067 TTTTATTGCATTCATCAGCATGG + Intergenic
1201219997 Y:11759409-11759431 TCATTTTACATAGATCAGGGAGG + Intergenic