ID: 1170856231

View in Genome Browser
Species Human (GRCh38)
Location 20:20058162-20058184
Sequence TTTATATTACATTCATCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 221}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170856231_1170856237 -1 Left 1170856231 20:20058162-20058184 CCCCCTGATGAATGTAATATAAA 0: 1
1: 0
2: 0
3: 13
4: 221
Right 1170856237 20:20058184-20058206 ATTGGCACAATTTTACTAGAGGG 0: 1
1: 0
2: 1
3: 17
4: 192
1170856231_1170856238 6 Left 1170856231 20:20058162-20058184 CCCCCTGATGAATGTAATATAAA 0: 1
1: 0
2: 0
3: 13
4: 221
Right 1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG 0: 1
1: 0
2: 2
3: 11
4: 110
1170856231_1170856236 -2 Left 1170856231 20:20058162-20058184 CCCCCTGATGAATGTAATATAAA 0: 1
1: 0
2: 0
3: 13
4: 221
Right 1170856236 20:20058183-20058205 AATTGGCACAATTTTACTAGAGG 0: 1
1: 0
2: 0
3: 29
4: 172
1170856231_1170856239 7 Left 1170856231 20:20058162-20058184 CCCCCTGATGAATGTAATATAAA 0: 1
1: 0
2: 0
3: 13
4: 221
Right 1170856239 20:20058192-20058214 AATTTTACTAGAGGGCAGTAGGG 0: 1
1: 0
2: 1
3: 20
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170856231 Original CRISPR TTTATATTACATTCATCAGG GGG (reversed) Intronic
906386672 1:45375589-45375611 TTTATATTTTAATCAGCAGGGGG - Intronic
906443804 1:45875538-45875560 TTGATATAACATTAATCAAGGGG + Intronic
911441373 1:97930432-97930454 TTCTTATTATATTCTTCAGGGGG - Intergenic
912282972 1:108336748-108336770 TTTAATTTACATTCTCCAGGTGG + Intergenic
913121121 1:115741781-115741803 TTTATTTAACATTCCTAAGGAGG - Intronic
913294634 1:117307177-117307199 TTTATATTATATTTTTCAGCTGG - Intergenic
913978350 1:143484594-143484616 TTTTTGTTACAATCACCAGGTGG + Intergenic
914072758 1:144310242-144310264 TTTTTGTTACAATCACCAGGTGG + Intergenic
914106396 1:144656118-144656140 TTTTTGTTACAATCACCAGGTGG - Intergenic
915860679 1:159441016-159441038 TTTCTATTGCCTTCATTAGGTGG - Intergenic
916152697 1:161810991-161811013 TTGATAATCCATTCATCAGTTGG + Intronic
916279804 1:163037251-163037273 TTTATATTTCATGAATCATGAGG - Intergenic
918262339 1:182807279-182807301 TTTTTTATACATTCATCAGAAGG - Intronic
919321883 1:196052693-196052715 TTTTTGTAACTTTCATCAGGTGG + Intergenic
919573577 1:199279037-199279059 TTTTTAGTACATTCACCAAGTGG + Intergenic
920023274 1:202971799-202971821 TTTATGTGACATTCATAAAGAGG - Intergenic
921311607 1:213849853-213849875 TTTAAATTACATTACTCTGGTGG + Intergenic
922590945 1:226775969-226775991 TTTATGTTACATTAATTAGTTGG - Intergenic
923094699 1:230765813-230765835 TTTATATTCCATCCTTGAGGAGG + Intronic
923369636 1:233296969-233296991 TCTACTTTACATTCATCAGTAGG + Intergenic
923581231 1:235215883-235215905 TAAATATTATATTCATCAGGTGG - Intronic
924288706 1:242514639-242514661 TCTATATTTTATTCAACAGGAGG - Intronic
1063901191 10:10733907-10733929 TTTGTATTACATTCTTAAAGAGG - Intergenic
1064737241 10:18394819-18394841 TTTATATTATACTCATAATGAGG - Intronic
1064746683 10:18485426-18485448 ATTATATTAAATGCCTCAGGTGG - Intronic
1065982112 10:30909605-30909627 CTTTTATTACTTTCATCAAGAGG - Intronic
1066340161 10:34524608-34524630 TTTATATTATATTTGGCAGGTGG - Intronic
1068205688 10:53849281-53849303 TTTATATTACATCTCTCAGATGG + Intronic
1068244025 10:54341378-54341400 TGTATCTTACATGCAGCAGGAGG - Intronic
1069224711 10:65928455-65928477 TTAACATTAGATTCATCAGAAGG + Intronic
1071366089 10:84901951-84901973 TTTCAATTCAATTCATCAGGTGG + Intergenic
1073956799 10:108882058-108882080 TTTATATTATAATCAACAGGAGG - Intergenic
1073958721 10:108901768-108901790 TTTATCTCACATTCATCTGGTGG + Intergenic
1077769157 11:5196023-5196045 TTTTTATTTCCTTCATCTGGAGG + Intergenic
1079439552 11:20496722-20496744 TCTATATTACAGTTACCAGGTGG + Intronic
1080129281 11:28774358-28774380 TATATATTATTTTCATCATGTGG + Intergenic
1080409859 11:32013396-32013418 TTTATATTACCTTTATTAGAAGG - Intronic
1080933648 11:36839209-36839231 TTTATATTACACTCAATTGGAGG + Intergenic
1081023064 11:37971195-37971217 TTTATTTTACACTCATAATGTGG - Intergenic
1081025057 11:38001889-38001911 TTTAAATTAGATTTATCAGCAGG - Intergenic
1082654855 11:55841435-55841457 TAAATATTACAATTATCAGGGGG - Intergenic
1084917918 11:72444243-72444265 TTTATATTTCATTTCTCATGAGG - Intergenic
1087932729 11:103997285-103997307 TTTCTGTTACAATCATCAGAAGG + Intronic
1091465013 12:676526-676548 TTTATATTCTATTTATCAGTCGG - Intergenic
1093256975 12:16880862-16880884 TTTAAATTGCCTTAATCAGGTGG - Intergenic
1095816897 12:46432825-46432847 TTTAAATTAGATTCAGCAGTAGG + Intergenic
1095939021 12:47713619-47713641 TCTATATTACATTCCACTGGAGG + Intronic
1097478235 12:60086170-60086192 TATAAAATCCATTCATCAGGTGG + Intergenic
1098027931 12:66224904-66224926 TTTAGATTATATACATCAGAAGG - Intronic
1098635093 12:72773788-72773810 TTAATGTTACTTTCAGCAGGGGG - Intergenic
1101842340 12:108337231-108337253 TTAATAGTACCTTCATCATGTGG + Intronic
1102083977 12:110121103-110121125 TTTATGTTAAATGAATCAGGCGG + Intergenic
1103464299 12:121129548-121129570 TTTATATTCCTTCCATCACGAGG + Intergenic
1104875510 12:132031520-132031542 TTTGTATTCCATTCAACACGAGG - Intronic
1105220993 13:18326863-18326885 TTTTTGTTACAATCACCAGGTGG - Intergenic
1106968615 13:35106131-35106153 TATATATTACTTTCATGTGGTGG - Intronic
1107814752 13:44234322-44234344 TTTCTTCTACATTCATCACGTGG + Intergenic
1107982882 13:45750321-45750343 CTTATATTACCTTCTTCAGAGGG + Intergenic
1109215913 13:59589873-59589895 TTTATATTTTATTAATAAGGGGG - Intergenic
1109591514 13:64490087-64490109 TGCATATTATATTCAGCAGGTGG - Intergenic
1109631382 13:65052788-65052810 TTTATCTTATATGCTTCAGGTGG - Intergenic
1109787229 13:67194008-67194030 TTTCTATTACATAAATCAAGAGG + Intronic
1111169011 13:84501107-84501129 TTTAAATTAAATCCACCAGGTGG + Intergenic
1111358991 13:87148837-87148859 TTTATATTATATTCAAGAGCAGG - Intergenic
1111667622 13:91289167-91289189 TTTATATTACAATTATCTGAGGG + Intergenic
1116552275 14:46256525-46256547 TTTATCTTATCTTCATCATGGGG - Intergenic
1117657959 14:57975646-57975668 TCTAGATTACATTCATTTGGTGG - Intronic
1117690619 14:58301561-58301583 TTTATGTTCCTTTCACCAGGCGG + Exonic
1119363994 14:74075912-74075934 TTTATATTGCATGTATCAGCAGG - Intronic
1120399172 14:84006611-84006633 TTTTTATTCCCTTCATCAAGTGG + Intergenic
1121586047 14:95063869-95063891 TTTATATTACACCCAGCATGGGG - Intergenic
1125221396 15:37340152-37340174 ATTATATCACATTAATGAGGTGG - Intergenic
1125228535 15:37425137-37425159 TTTCTATTGCATACAGCAGGTGG + Intergenic
1126388285 15:48117367-48117389 TTTATTCTTCATTCATCAGTCGG - Intergenic
1127528850 15:59822111-59822133 TTTATATTAAAATGTTCAGGTGG + Intergenic
1128593569 15:68924642-68924664 TGTATATTGCCTACATCAGGTGG + Intronic
1129585782 15:76863205-76863227 TTGATATGACATTCATTAGTGGG - Intronic
1131547513 15:93328210-93328232 TTTACAATACACTCATCAAGAGG + Intergenic
1131908566 15:97171016-97171038 GTTGTATTACATACAACAGGGGG + Intergenic
1132940578 16:2505578-2505600 TTTTTATTACATTCATTGAGAGG - Intronic
1133699633 16:8296988-8297010 TGTTGATTACAGTCATCAGGGGG - Intergenic
1133746367 16:8689912-8689934 TTTAAACTACATTCAACAGCTGG + Intronic
1135952050 16:26923755-26923777 TTTATTTTTAATTCATCAGGTGG + Intergenic
1140278293 16:73530784-73530806 TTTATATTACAATCTTTATGAGG + Intergenic
1140641270 16:76976324-76976346 TTTATATCACTTTCATGTGGTGG + Intergenic
1140862662 16:79032044-79032066 TATATATTACATACAGAAGGAGG - Intronic
1140962676 16:79931656-79931678 TTTATATCATTTTCATCTGGTGG + Intergenic
1141208305 16:81952803-81952825 TTCATTTTGCATTCATCAGTAGG - Intronic
1144341584 17:14314515-14314537 TTTATATTAGATTCAACAACAGG - Intronic
1145029487 17:19493855-19493877 TTTATTTTCCATTCATCAGTTGG - Intergenic
1146033139 17:29383669-29383691 TTAATATTACCTTCTTCAGAGGG + Intergenic
1146890385 17:36502787-36502809 TTCAGATTACATTTATCATGTGG + Intronic
1146954646 17:36930434-36930456 TTTATATCCTATACATCAGGAGG - Intergenic
1149535125 17:57427527-57427549 TATACATTTCATTCATCAGCGGG - Intronic
1156035384 18:32760826-32760848 TTTATATTTCATTCTTCAAAAGG - Intronic
1157561122 18:48647225-48647247 TTTATATAACATTCTTGAGAGGG + Intronic
1162888484 19:13714539-13714561 TTTATACTGCATTCATTATGTGG + Intergenic
1168609965 19:57791138-57791160 TTTTTCTTTCATTCACCAGGGGG + Intronic
924972793 2:144745-144767 TTTCTATTACATTTAGAAGGTGG - Intergenic
928873548 2:36010813-36010835 TATATATTGCATTCTTCAGCTGG - Intergenic
930445154 2:51461386-51461408 TATATAGCACATTCATGAGGAGG - Intergenic
930517653 2:52428728-52428750 TTTCTATTACATTCAGTAGCAGG + Intergenic
932829553 2:74975854-74975876 TTTATATGACATTCTGGAGGTGG - Intergenic
932950858 2:76291334-76291356 TTTATGTGACATTCTTCTGGGGG - Intergenic
933022534 2:77211815-77211837 TTTATATTACATTCAGCATAAGG - Intronic
933658960 2:84910915-84910937 TTTATATTACATTCAAAAACAGG - Intergenic
933796425 2:85923657-85923679 TTTATATGACATTCAACAAAAGG + Intergenic
934293348 2:91719784-91719806 TTTTTGTTACAATCACCAGGTGG + Intergenic
935066417 2:99652326-99652348 TGTGCATTACATTCATGAGGGGG + Intronic
938832710 2:135069471-135069493 TTTATATGAAATTCATTAGAAGG - Intronic
939472838 2:142646435-142646457 ATTATATTCCATTATTCAGGAGG + Intergenic
939810019 2:146820076-146820098 ATTATATTACATTCAAGTGGTGG + Intergenic
942100004 2:172571337-172571359 TTTCTATTACATTGTTCAGGTGG + Intronic
945494411 2:210492149-210492171 ATTATATAACATTCATCATTTGG + Intronic
947110012 2:226708439-226708461 TTCATATTGCCTTCATCTGGAGG - Intergenic
1168855776 20:1006809-1006831 ACTATATTACATTCATACGGTGG - Intergenic
1168926689 20:1587507-1587529 TTTATTTTCCCTTCCTCAGGAGG - Intronic
1169868625 20:10227830-10227852 CATATATTACATTCACCAGTGGG + Intronic
1170560735 20:17556204-17556226 TTTAAAATACAATCATCAGCCGG + Intronic
1170647047 20:18206973-18206995 TTTATATGAGATTCAAAAGGGGG - Intergenic
1170856231 20:20058162-20058184 TTTATATTACATTCATCAGGGGG - Intronic
1171472313 20:25381971-25381993 TTAATATTATAATCATCATGGGG + Intronic
1173049638 20:39546813-39546835 TATGTATTATATTCATCAAGGGG - Intergenic
1174124509 20:48293191-48293213 TTTATATTGTTTTCATCAAGTGG + Intergenic
1179816863 21:43911923-43911945 TTTGAATTACATTCACCAAGAGG - Intronic
1183600398 22:38836758-38836780 TTTATATTACATTCAAGATACGG - Intronic
1184621817 22:45685122-45685144 TTTACAGTTCAATCATCAGGTGG - Intronic
1185379223 22:50499797-50499819 TGTATATTACACTCATTAGCTGG - Intergenic
949284225 3:2382478-2382500 TTTAGATTACTTACACCAGGAGG + Intronic
949893440 3:8750763-8750785 TTTATTTCCCATTCATCAGTTGG + Exonic
950982364 3:17320918-17320940 TTTATAATACATTTACCAGTGGG + Intronic
951484115 3:23193166-23193188 TTTATATTACATTTAGCAGCTGG + Intergenic
953114971 3:39983836-39983858 TTTAGATTAAATTTATCATGTGG - Intronic
956517579 3:70066191-70066213 TTTATGTAACATTCAGCAGATGG - Intergenic
957821237 3:85376451-85376473 TTTATATTACATTCTTAACATGG - Intronic
958600804 3:96294244-96294266 TTTATTTCTCATTCATCTGGAGG + Intergenic
959318649 3:104842562-104842584 TTTATATTACTTACTTCAGGAGG + Intergenic
960077876 3:113508862-113508884 TTATTAATACATTCATCAGTTGG - Intronic
962117450 3:132526179-132526201 TTTTCATTCCATTCATCAGTGGG - Exonic
963337021 3:143986881-143986903 CTCATATTACTTTTATCAGGGGG - Intronic
966247870 3:177829124-177829146 AATAAACTACATTCATCAGGAGG + Intergenic
966980167 3:185125607-185125629 TTTGTTTAACATTCATCAGCTGG - Intronic
970665515 4:18332269-18332291 TTTATATTACATTCTTTGGATGG - Intergenic
970682279 4:18523718-18523740 TTTCTATTACATTCATTACTTGG + Intergenic
971154088 4:24063915-24063937 TGTGTATTACAAACATCAGGGGG + Intergenic
972245254 4:37240482-37240504 TTAATATTACATTCATACAGTGG - Intergenic
974726316 4:65803363-65803385 TTTTTATTATATTCACCAAGTGG - Intergenic
976254913 4:83089894-83089916 TTTACACTGCATTCCTCAGGAGG - Intergenic
976410653 4:84709638-84709660 TATATATTACATTCATCCCAAGG - Intronic
978194168 4:105951187-105951209 TTTATTTTACATGAGTCAGGTGG - Intronic
979128797 4:117012600-117012622 GTTTTTTTATATTCATCAGGTGG - Intergenic
980676544 4:136090855-136090877 TTGATATTGCATTCATGAGGAGG - Intergenic
981175484 4:141677997-141678019 TCTATACCACATTCATCAGAGGG + Intronic
981369525 4:143943931-143943953 TTTATTTAACATTCATTTGGGGG + Intergenic
982538230 4:156633974-156633996 TTTATATTCCATTCATCCTTTGG + Intergenic
983076746 4:163335620-163335642 TGTATATGACATTGATAAGGGGG + Intronic
983248554 4:165318012-165318034 TTAATATAACATTCATAATGAGG - Intronic
984135605 4:175934047-175934069 TTTATATTAAATTCTACAGCAGG + Intronic
986922453 5:12704104-12704126 TTTATATAACATTGATTATGTGG + Intergenic
991188944 5:63845854-63845876 TTTATATTTCATACATCTGTGGG - Intergenic
993318287 5:86439536-86439558 TTAATAATACCTACATCAGGGGG - Intergenic
994319552 5:98376965-98376987 ATTATATGGGATTCATCAGGTGG - Intergenic
994402033 5:99292784-99292806 TTTATTTTATATTTATCTGGAGG + Intergenic
994548930 5:101206606-101206628 GTTATATTACATGCATCAGAGGG + Intergenic
995440799 5:112190331-112190353 TTTTTATCAGATTCATAAGGGGG - Intronic
995801755 5:116004037-116004059 ATTATATTTTATTCATCATGAGG + Intronic
997129160 5:131259396-131259418 TTTATATAACATTGGTCAAGTGG + Intronic
997784641 5:136698839-136698861 TTTTTATTCCATGCTTCAGGTGG - Intergenic
1000157789 5:158568871-158568893 TATGTATTACGTTAATCAGGAGG - Intergenic
1000473380 5:161674580-161674602 TTTATATGAAATTTCTCAGGTGG + Intronic
1000510684 5:162178234-162178256 TTTAAATAATATTCATCAGCAGG - Intergenic
1001192571 5:169644260-169644282 TTTATGGTGCATTAATCAGGGGG + Intronic
1003963485 6:11231228-11231250 TTTCTATTATCTTCATCAGTAGG - Intronic
1004551154 6:16648458-16648480 GTTACAGTTCATTCATCAGGAGG - Intronic
1004826623 6:19428737-19428759 TTTATATCACTTTCAACAGTTGG - Intergenic
1005569234 6:27128548-27128570 TTTAAATTACATTCATTTGCTGG - Intronic
1005970756 6:30759616-30759638 TTTGTTTGACATTCATCATGGGG - Intergenic
1006292019 6:33145593-33145615 TTTATATAATAGTAATCAGGAGG + Intergenic
1008598632 6:53066612-53066634 TTTTTATTAAATTAATCTGGAGG + Intronic
1008607413 6:53153552-53153574 TTTATATTAATTTCATGAAGTGG - Intergenic
1010347794 6:74833097-74833119 TATATACTACTTTCTTCAGGCGG + Intergenic
1010792617 6:80081907-80081929 TTTATATGACATTCAAAAGTAGG - Intergenic
1012403441 6:98865545-98865567 TTCATATTAAAATCATCAGCTGG + Intergenic
1012452412 6:99366681-99366703 TTTATTTTACATCTTTCAGGAGG - Intergenic
1013043426 6:106459907-106459929 TATATATAACATTCATAAAGTGG - Intergenic
1016558152 6:145363145-145363167 ATTATATTACATTCATAACTTGG - Intergenic
1017958618 6:159202188-159202210 TTTATATTACATGCTTCAAGTGG - Intronic
1024812277 7:53226148-53226170 TTTAAATTACTCTCTTCAGGTGG + Intergenic
1026431995 7:70356944-70356966 TTTATACAACATTCCTCAAGGGG - Intronic
1028051501 7:86193467-86193489 TGTAGATTACATTCTTCAGTAGG - Intergenic
1030305686 7:108016917-108016939 TTTATCTCACATTCACTAGGTGG - Intergenic
1030327091 7:108231396-108231418 TTTATACTACATACATCATCAGG + Intronic
1030513184 7:110510169-110510191 TTTATATTACATTCAAGCTGAGG - Intergenic
1030806111 7:113921668-113921690 ATAATATTGCATTCATCTGGGGG - Intronic
1037933838 8:22901123-22901145 TTTATTTTACGTTCATAAGAAGG - Intronic
1038762823 8:30400485-30400507 TATATATTAGATTCATTTGGAGG + Intronic
1039127859 8:34223907-34223929 AGTTTATTACATTCATTAGGTGG - Intergenic
1039230006 8:35434687-35434709 TTCATATACCATTCATTAGGAGG + Intronic
1040740974 8:50575374-50575396 CTGTTATTACCTTCATCAGGAGG - Intronic
1041019966 8:53628608-53628630 TTTATATAACATTCAACACTAGG - Intergenic
1041459099 8:58092130-58092152 TTGGTATTACACTCATCTGGAGG + Intronic
1041996779 8:64071255-64071277 TCTAAATTACATTCACCAGTAGG + Intergenic
1042448626 8:68919286-68919308 TATATATTACATTAACCTGGTGG + Intergenic
1042873362 8:73418133-73418155 TTTATATTCCTTCCATCAGCTGG - Intergenic
1043103566 8:76079649-76079671 TCTATTTTACATTCCTAAGGAGG - Intergenic
1043123218 8:76358204-76358226 TTCCTATTACATTCATCATGAGG + Intergenic
1044917944 8:97136105-97136127 TTTTTATAATATTCATCAGATGG + Intronic
1046317070 8:112518178-112518200 TTTATATAACATTCTTGAAGTGG + Intronic
1047766993 8:127998181-127998203 TTTATATTAAACTCTTCAGAAGG + Intergenic
1053449517 9:38181310-38181332 TTTCTATCACATTCAGCAGAGGG - Intergenic
1055456272 9:76474912-76474934 TTTATAATATATTTATCTGGAGG + Intronic
1056500808 9:87207222-87207244 TGTATATTACAGTCAGGAGGAGG + Intergenic
1056858451 9:90156971-90156993 ATTATACTACATTCTTCAAGAGG + Intergenic
1057551244 9:96052471-96052493 TTGACATTCCATTCATCTGGAGG - Intergenic
1059261949 9:112985627-112985649 TTTAGATTAGATTCACAAGGAGG - Intergenic
1185941807 X:4329942-4329964 TCTATATTCCGTTCAGCAGGAGG - Intergenic
1186081419 X:5937583-5937605 TCTTTATTACATTCATTATGAGG + Intronic
1188137807 X:26511185-26511207 TTTATATTACATTCCTGAAAAGG - Intergenic
1188685683 X:33066853-33066875 TTTACATTTCATTCTTTAGGGGG - Intronic
1188782119 X:34298324-34298346 TTTATTTGACATTCATCTGTGGG - Intergenic
1189015405 X:37091724-37091746 TATATATTAGATTCATTTGGAGG + Intergenic
1189920524 X:45899062-45899084 TTTGTAATATATTCTTCAGGAGG - Intergenic
1190368795 X:49722418-49722440 TTTACATTGCTTTCATCAAGGGG - Intergenic
1190443860 X:50503331-50503353 TTTAAATCACAGTTATCAGGAGG + Intergenic
1190554465 X:51618968-51618990 TTTACATCACATTCAACAAGTGG - Intergenic
1193696568 X:84714012-84714034 TTTATTATAAATTCATTAGGTGG + Intergenic
1195373428 X:104202264-104202286 TAGATATTCCATTCTTCAGGAGG - Intergenic
1196617412 X:117783075-117783097 TTTTGATTATATTCATCATGGGG - Intergenic
1196856455 X:119989892-119989914 TTTATTTGACATTTATCAGTAGG + Intergenic
1196857988 X:120001246-120001268 TTTATTTGACATTTATCAGTAGG - Intergenic
1198493394 X:137166208-137166230 TATCTATTACATTAATCAAGTGG - Intergenic
1199738405 X:150707997-150708019 TTTATATGACATTCTTCAAATGG + Intronic
1200326976 X:155250807-155250829 TTGATATTACTTAAATCAGGTGG + Intergenic
1201726950 Y:17163919-17163941 TCTACATTTCATTCAGCAGGAGG - Intergenic
1202016920 Y:20418728-20418750 TTTATAAAACATTCATCAAATGG - Intergenic