ID: 1170856232

View in Genome Browser
Species Human (GRCh38)
Location 20:20058163-20058185
Sequence ATTTATATTACATTCATCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 304}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170856232_1170856239 6 Left 1170856232 20:20058163-20058185 CCCCTGATGAATGTAATATAAAT 0: 1
1: 0
2: 1
3: 26
4: 304
Right 1170856239 20:20058192-20058214 AATTTTACTAGAGGGCAGTAGGG 0: 1
1: 0
2: 1
3: 20
4: 151
1170856232_1170856238 5 Left 1170856232 20:20058163-20058185 CCCCTGATGAATGTAATATAAAT 0: 1
1: 0
2: 1
3: 26
4: 304
Right 1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG 0: 1
1: 0
2: 2
3: 11
4: 110
1170856232_1170856236 -3 Left 1170856232 20:20058163-20058185 CCCCTGATGAATGTAATATAAAT 0: 1
1: 0
2: 1
3: 26
4: 304
Right 1170856236 20:20058183-20058205 AATTGGCACAATTTTACTAGAGG 0: 1
1: 0
2: 0
3: 29
4: 172
1170856232_1170856237 -2 Left 1170856232 20:20058163-20058185 CCCCTGATGAATGTAATATAAAT 0: 1
1: 0
2: 1
3: 26
4: 304
Right 1170856237 20:20058184-20058206 ATTGGCACAATTTTACTAGAGGG 0: 1
1: 0
2: 1
3: 17
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170856232 Original CRISPR ATTTATATTACATTCATCAG GGG (reversed) Intronic
901269209 1:7937817-7937839 ACTTATATTAAGTTCATCACAGG - Intronic
905338137 1:37259515-37259537 ATTTTTATTCCATTGATCTGGGG + Intergenic
905842837 1:41199363-41199385 ATTTATATAACATTCAAAACAGG - Intronic
906386673 1:45375590-45375612 ATTTATATTTTAATCAGCAGGGG - Intronic
906443803 1:45875537-45875559 ATTGATATAACATTAATCAAGGG + Intronic
906813933 1:48858219-48858241 TTTTATATTCCCATCATCAGTGG - Intronic
907084221 1:51654667-51654689 ATTTTTTATCCATTCATCAGTGG - Intronic
909262671 1:73513130-73513152 ATTTATATTATATTCATAGAGGG + Intergenic
909390394 1:75113467-75113489 ATTTATATTACATGAATGAAAGG - Intergenic
909409449 1:75332272-75332294 ATTGAAATTAAATTTATCAGTGG - Intronic
909751058 1:79161501-79161523 ATTGATATCACATTCACTAGGGG + Intergenic
909894156 1:81045309-81045331 ATTTCTGTTACAGTCATCATAGG + Intergenic
909970836 1:81986797-81986819 ATTTTTTTTATATTCATCAAGGG - Intronic
913064262 1:115235553-115235575 ATAAATATTACAGTAATCAGAGG - Intergenic
913312067 1:117510063-117510085 AATTATAAAACATTCCTCAGTGG - Intronic
913668550 1:121072721-121072743 ATTTTTATTGTATTCATCAAAGG - Intergenic
914020294 1:143860164-143860186 ATTTTTATTGTATTCATCAAAGG - Intergenic
914658794 1:149768076-149768098 ATTTTTATTGTATTCATCAAAGG - Intergenic
916631755 1:166622428-166622450 TTTTAAATAACATTCATCACTGG + Intergenic
916664207 1:166950776-166950798 AGTTATATTACATAGATAAGTGG - Intronic
917300916 1:173573325-173573347 ATTTCTATTTCATTCATCCTAGG - Exonic
917804934 1:178604989-178605011 ATTTATATGGCATTTATCTGGGG - Intergenic
918033406 1:180840309-180840331 ATTTATATTACATTTACAAAAGG + Intronic
918590835 1:186239252-186239274 AATTATATTAAATAAATCAGTGG - Intergenic
918657014 1:187039766-187039788 ACTTATATTAAACTCATTAGAGG + Intergenic
918787258 1:188777829-188777851 ATTTTTATTAAATTAATCACTGG + Intergenic
921084417 1:211775341-211775363 ATTTATTTAACATTAATCAGTGG - Intronic
921750581 1:218788494-218788516 ATTGATATTATTTTCCTCAGGGG - Intergenic
922471228 1:225878523-225878545 ATTTCTATTAGCTTCACCAGGGG - Intronic
923247804 1:232150133-232150155 ATGTATATTAAATTCTTGAGTGG - Intergenic
923762674 1:236861212-236861234 ATTTTCATTCCATTCATCAGGGG - Exonic
924127867 1:240874437-240874459 ATTTTTATTACATTTTTCATTGG + Intronic
1063829664 10:9937344-9937366 ATTTATATAACATTCTTGAAAGG - Intergenic
1064615850 10:17155284-17155306 ATTTATATTTCATCATTCAGTGG - Intronic
1065244086 10:23740142-23740164 AATGATATGAGATTCATCAGTGG + Intronic
1066218164 10:33309039-33309061 ATTTTTATTACATTAAAAAGTGG - Intronic
1066577013 10:36837118-36837140 ATTTTCATTACATTAGTCAGTGG - Intergenic
1068197904 10:53743271-53743293 AATAATAGTACATTCTTCAGTGG + Intergenic
1070584530 10:77752315-77752337 ATTTTTATTACAGTCATAAATGG - Intergenic
1071084553 10:81854302-81854324 ATTTATCTCAGGTTCATCAGAGG + Intergenic
1072393953 10:95019123-95019145 CTTTTTATTTCATTCAGCAGTGG + Intergenic
1073400942 10:103257140-103257162 ACTAATATTAGCTTCATCAGTGG + Intergenic
1073657918 10:105437275-105437297 ATTTATATTTCTTTATTCAGAGG - Intergenic
1073807609 10:107116152-107116174 ATTTACATTCCAATCAACAGTGG - Intronic
1073874495 10:107906483-107906505 CTTTTGATTACAATCATCAGAGG - Intergenic
1074075795 10:110123101-110123123 ATTTATATCCCATCCATCAATGG + Intronic
1075089840 10:119437530-119437552 AGTTACATTACACTCCTCAGGGG + Intronic
1077769737 11:5203289-5203311 ATTTCCATTAGATTCATTAGAGG + Intergenic
1077964407 11:7112658-7112680 ATTTATATTTTTTTCATCTGTGG + Intergenic
1079019223 11:16895340-16895362 CTTTATGTTACCTTCTTCAGAGG - Intronic
1079492366 11:21002994-21003016 ATTAATATTTCATCCATTAGTGG + Intronic
1079746624 11:24139937-24139959 ATTTATATTTCTTTCTGCAGGGG - Intergenic
1079750812 11:24194345-24194367 ATTTCTTATATATTCATCAGAGG - Intergenic
1080923864 11:36735819-36735841 ATCTATATTAAAATCATAAGAGG - Intergenic
1081304707 11:41497624-41497646 ATTTATATCATATTCATTAGAGG + Intergenic
1081440487 11:43075728-43075750 ATTAATAATAAATTCAGCAGAGG + Intergenic
1082654856 11:55841436-55841458 ATAAATATTACAATTATCAGGGG - Intergenic
1083500540 11:63103652-63103674 ATTTACATTGTCTTCATCAGGGG - Intronic
1084843448 11:71878244-71878266 ATTTAAAGTACATTTATCAAAGG - Intronic
1085595582 11:77806173-77806195 ATTTATATGATCTTCACCAGGGG - Intronic
1086039762 11:82462056-82462078 ACATAAATAACATTCATCAGAGG + Intergenic
1086989666 11:93289127-93289149 CTTTCCATTACATACATCAGAGG - Intergenic
1087112357 11:94484372-94484394 ATTAATTTTAGATTCATCAGTGG - Intronic
1087280553 11:96204913-96204935 ATTCTTATTACATTGATCGGAGG + Intronic
1087879728 11:103402164-103402186 ATCTGTATTACTTGCATCAGGGG - Intronic
1091288877 11:134425745-134425767 ATTTGTCTCACATTCACCAGTGG + Intergenic
1092751286 12:11721750-11721772 ATTTATAAGACATCCAGCAGAGG + Intronic
1093543330 12:20314941-20314963 TTTTATATTAAATTATTCAGTGG - Intergenic
1097245037 12:57603211-57603233 AGTTTTATTGCATTCATCGGGGG - Exonic
1098163281 12:67668071-67668093 ATTTATTGTACATGCATCAATGG - Intergenic
1098725782 12:73964625-73964647 AATCATATTATATTCATAAGGGG + Intergenic
1098770056 12:74540446-74540468 ATTTAGATTACATACTTTAGAGG + Exonic
1099266127 12:80450040-80450062 TTTTATATTTCATTGAGCAGTGG + Intronic
1099647296 12:85374881-85374903 ATTTATAATACATTCATGAGTGG + Intergenic
1100000640 12:89830833-89830855 ATTTATTTTACTTTCATGAGAGG - Intergenic
1100465222 12:94838538-94838560 ATTAATTTTATCTTCATCAGTGG - Intergenic
1107763022 13:43702059-43702081 ATTTATATAACATTCTTGAAAGG - Intronic
1107982881 13:45750320-45750342 GCTTATATTACCTTCTTCAGAGG + Intergenic
1108432270 13:50366201-50366223 ATCTATATTTCACTCAGCAGAGG + Intronic
1108522047 13:51255358-51255380 ATTTAAATTTCATTCCTCACTGG + Intronic
1108938090 13:55911519-55911541 ATTTAAATTACAATCATGAATGG + Intergenic
1109461580 13:62666430-62666452 ATTTTGATTACCTTGATCAGAGG - Intergenic
1111049245 13:82857530-82857552 ATTTATTTTATATTGATCATAGG - Intergenic
1111185067 13:84723722-84723744 AATTATATCACATTGATAAGAGG - Intergenic
1111634843 13:90890963-90890985 ATTTGGAATACCTTCATCAGAGG + Intergenic
1111667621 13:91289166-91289188 ATTTATATTACAATTATCTGAGG + Intergenic
1112804302 13:103146025-103146047 ATACATATTACATTCATCCAAGG - Intergenic
1114414351 14:22530327-22530349 ATTTATAGCACATTCATCTTTGG + Intergenic
1116167676 14:41354329-41354351 AAGAATATTTCATTCATCAGTGG + Intergenic
1116298480 14:43143648-43143670 ATTTTTATTAGATACATCATTGG + Intergenic
1117100743 14:52344040-52344062 AGTTATATTACTTTCATGAATGG + Intergenic
1117577195 14:57111440-57111462 ATTTATATGAAACTAATCAGTGG + Intergenic
1117856846 14:60042958-60042980 TTTTCTATTTCTTTCATCAGAGG + Intronic
1118899711 14:69976271-69976293 CTCTACATTACATTCTTCAGGGG - Intronic
1119257418 14:73210209-73210231 AATAATATAAAATTCATCAGTGG + Intronic
1119912348 14:78361206-78361228 ATTTTTATTTCATTGATCTGGGG - Intronic
1120146661 14:80986149-80986171 TTTTATCTAACATTTATCAGTGG + Intronic
1120693528 14:87619537-87619559 ATTTATTTAAAACTCATCAGTGG + Intergenic
1120795537 14:88629124-88629146 ATTTATATAATATTTATCACTGG - Intronic
1202870275 14_GL000225v1_random:156597-156619 TTTTATATTAAGTTTATCAGAGG + Intergenic
1125874992 15:43136170-43136192 ATTTATATGACATTCAGGAAAGG + Intronic
1129585783 15:76863206-76863228 TTTGATATGACATTCATTAGTGG - Intronic
1130726153 15:86441739-86441761 ATTATTATTACATTCATCTCTGG - Intronic
1131770206 15:95728977-95728999 AATGATATTAGATGCATCAGTGG + Intergenic
1131777798 15:95821503-95821525 ATTTATATAGCATTAATCTGAGG - Intergenic
1133772662 16:8876623-8876645 ATTTAAATGTCATTCATCAGTGG - Intergenic
1138844743 16:60552239-60552261 ATTTATATCACTTTAATCATTGG - Intergenic
1138913159 16:61427815-61427837 ATTATTAGTACATTCTTCAGAGG + Intergenic
1139234745 16:65325719-65325741 ATTTTTAATACATTGCTCAGTGG + Intergenic
1140687401 16:77446757-77446779 ATTTATATTACCTGTCTCAGAGG - Intergenic
1140951177 16:79818985-79819007 ATTTATTTTTAATTGATCAGAGG + Intergenic
1141405495 16:83789230-83789252 ATTTATATGACATTGAGAAGAGG + Intronic
1142064007 16:88049921-88049943 ATTTAGATTACATACAGCATAGG + Intronic
1146033138 17:29383668-29383690 GTTAATATTACCTTCTTCAGAGG + Intergenic
1146953942 17:36925236-36925258 TTTCATATTATTTTCATCAGAGG + Intergenic
1149535126 17:57427528-57427550 TTATACATTTCATTCATCAGCGG - Intronic
1149642862 17:58215727-58215749 ATATAGATAAAATTCATCAGGGG - Intronic
1150447048 17:65234372-65234394 ATTGATATTACATTTTTTAGTGG - Intergenic
1151544572 17:74784900-74784922 ATTTAAAGTACACACATCAGTGG - Intronic
1156412810 18:36850839-36850861 ATTTCTAGTACATTGATTAGTGG + Intronic
1156807271 18:41200445-41200467 ATTTATATTAGATTCAGAATTGG - Intergenic
1157155553 18:45262155-45262177 ATTTATTTTGGATTCATCACTGG - Intronic
1157561121 18:48647224-48647246 ATTTATATAACATTCTTGAGAGG + Intronic
1158302221 18:56064978-56065000 TTCTATATTGCAATCATCAGAGG - Intergenic
1158760303 18:60377202-60377224 AATTATATTAGATTCATCTATGG + Intergenic
1159707946 18:71716639-71716661 ACTAAAATTACATTCATGAGAGG - Intergenic
1162188878 19:8929070-8929092 ATTTTTATTCCATTCCACAGAGG + Intronic
1162730130 19:12713470-12713492 ATTTATTTATCATTCATTAGAGG - Intronic
1163959785 19:20678156-20678178 ATATATATTCCAGTTATCAGGGG - Intronic
1167332473 19:48864953-48864975 ATTTATATTACATTCCAGATTGG - Intronic
927268198 2:21176795-21176817 ATTTACCTTACTTTCAGCAGTGG + Intergenic
930272523 2:49273460-49273482 TTTTTTATTACACTCTTCAGGGG + Intergenic
933031960 2:77339678-77339700 ATGCATATTACATTCAAGAGAGG - Intronic
933493109 2:83013866-83013888 AAATATATGACATTCATAAGAGG + Intergenic
935259249 2:101340897-101340919 TTTTTTATTGTATTCATCAGTGG - Intergenic
935858993 2:107306952-107306974 TTTTAAATTACATTTATCATTGG - Intergenic
937629301 2:124082033-124082055 TTTTATATAACATTCATAATAGG - Intronic
938309384 2:130277585-130277607 ATCTGTATTACTTGCATCAGGGG + Intergenic
938367810 2:130749039-130749061 ATATATTTAACATTCATCATGGG - Intergenic
939948526 2:148440135-148440157 ATTTACATTTCATTCAACAATGG + Intronic
940841092 2:158582751-158582773 ATTTATATTCCATTTAACAATGG - Intronic
941143434 2:161814020-161814042 ATTTAAATTTAGTTCATCAGGGG + Intronic
941181136 2:162260797-162260819 TTTTATTTTACCTTTATCAGTGG + Intergenic
941210355 2:162629980-162630002 ATTTATATTTCAGTTTTCAGAGG + Intronic
941315855 2:163991497-163991519 AGTTATATTACATTTATCCTTGG - Intergenic
941356221 2:164495605-164495627 ATTCATATTGGATTCACCAGTGG - Intronic
941552254 2:166931872-166931894 ATTTACATTTCCATCATCAGTGG + Intronic
942423148 2:175829427-175829449 ATTTACATGACATTCATTAAAGG + Intergenic
943535372 2:189142540-189142562 ATTTAAATTATATTCTTTAGTGG - Intronic
944697197 2:202212629-202212651 ATTGAGATGAAATTCATCAGGGG - Intronic
945419644 2:209618671-209618693 ATTTATATTTCCATCAACAGTGG - Intronic
945586172 2:211666319-211666341 ATTTATATTATCTTCATCCTTGG - Intronic
947846416 2:233247687-233247709 ATTTATCTTACATCCATTATAGG + Intronic
1169819549 20:9694135-9694157 ATTTATCTTAAATTCCTCATTGG - Intronic
1169868624 20:10227829-10227851 ACATATATTACATTCACCAGTGG + Intronic
1169998231 20:11583495-11583517 ATTTGTATTACATAAATCATTGG + Intergenic
1170856232 20:20058163-20058185 ATTTATATTACATTCATCAGGGG - Intronic
1171317031 20:24204369-24204391 ATTAATTCTACACTCATCAGAGG - Intergenic
1171888691 20:30685690-30685712 ATTCATATTACTTTTATTAGAGG - Intergenic
1171917859 20:31074462-31074484 CTTTACATTACATTCACCTGGGG - Intergenic
1174798830 20:53545625-53545647 ATGTATGTTTCATTCATCAGTGG + Intergenic
1175323301 20:58104894-58104916 ATTTTTATAACATTTATCATGGG - Intergenic
1176997166 21:15568956-15568978 ATTTATATCCTATTCTTCAGAGG + Intergenic
1177038550 21:16076197-16076219 ATATATATTACATTCATTAATGG + Intergenic
1177145760 21:17405322-17405344 ATTTAGAGTACATTCATTATTGG - Intergenic
1177553229 21:22653703-22653725 ATTTATATTACTCTAATGAGAGG + Intergenic
1177670408 21:24217827-24217849 ATTTTAATAACCTTCATCAGGGG + Intergenic
1178562356 21:33650696-33650718 ATATAGCTTTCATTCATCAGTGG - Intronic
1179312936 21:40212835-40212857 TCTTATATGACATTCTTCAGTGG - Intronic
1180570585 22:16713986-16714008 ATTTAGATAACATACATCAGTGG - Intergenic
1182241503 22:28919942-28919964 ACTCATGTTATATTCATCAGTGG + Intronic
1183330288 22:37216421-37216443 ATTTACATTGCATTAATCATGGG - Intergenic
1183751961 22:39726165-39726187 TTTTATATTACATTGCACAGTGG - Intergenic
1185073873 22:48672436-48672458 ATTTTCCTTACATTTATCAGGGG + Intronic
950982363 3:17320917-17320939 CTTTATAATACATTTACCAGTGG + Intronic
952549731 3:34462940-34462962 TTTTATATTAATTTCAGCAGGGG + Intergenic
955553950 3:60115490-60115512 ATTTATATTCAAGTCTTCAGAGG + Intronic
955575328 3:60356121-60356143 TTTTATGTTACATTTATGAGTGG + Intronic
956287125 3:67622538-67622560 ATTAATATCACAGTCATCTGTGG - Intronic
956863351 3:73346329-73346351 CTTTCTATCACATTCCTCAGCGG - Intergenic
957107984 3:75915705-75915727 ATTTAGATAACATACATCAATGG + Intronic
957233002 3:77545124-77545146 ATCCATGCTACATTCATCAGAGG + Intronic
960226088 3:115170462-115170484 ATTGATATTAAATTCTTCAGTGG - Intergenic
960637717 3:119800553-119800575 ATTTATTTTTCATTAATCATAGG + Intronic
962117451 3:132526180-132526202 TTTTTCATTCCATTCATCAGTGG - Exonic
962427980 3:135290395-135290417 ATTTATAATGCTTTCATAAGTGG + Intergenic
963337022 3:143986882-143986904 ACTCATATTACTTTTATCAGGGG - Intronic
964007066 3:151843818-151843840 ATTTCTATTACATTCATGACAGG - Intergenic
964727420 3:159828515-159828537 ATTTATATTACAGTTATTAAAGG + Intronic
964941919 3:162168681-162168703 ATTTCTATTCCATTCTTCATAGG + Intergenic
966455373 3:180109170-180109192 ATCTAGGTTACAATCATCAGTGG + Intergenic
967543796 3:190699718-190699740 AATTAAATTTCATTCAACAGAGG - Intergenic
967738899 3:192983599-192983621 ATTTGTATTCCATTCCTCATGGG + Intergenic
969141258 4:5075790-5075812 ATTTATATGACATTGTTAAGTGG - Intronic
969784546 4:9444325-9444347 ATTTAAAGTACATTTATCAAAGG - Intergenic
970661949 4:18295156-18295178 ATTTATATTACCTTTATCTGAGG - Intergenic
971449339 4:26785881-26785903 ATTTGTATTCCACTCACCAGAGG + Intergenic
971700002 4:29960024-29960046 ATTAATATTACTTACATGAGAGG + Intergenic
972939179 4:44176453-44176475 ATATATATTAGACTGATCAGTGG - Intronic
974713833 4:65639904-65639926 ATTTATTTTTCATTTATAAGAGG + Intronic
975392052 4:73831942-73831964 ATTCATATTATATTAATCTGTGG + Intergenic
976509943 4:85896763-85896785 ATTTATGGGACATTCAACAGAGG - Intronic
977637307 4:99314280-99314302 ATGCATATTAGATTCATCTGGGG + Intronic
979053042 4:115958867-115958889 ATGTATATTACATTTATGTGAGG + Intergenic
979164153 4:117504892-117504914 AATAATATTACTTTCCTCAGAGG - Intergenic
979928911 4:126604793-126604815 ATTTATTTTAAATTCATAATAGG - Intergenic
980254536 4:130361427-130361449 ATTTATTTTACATTAGTAAGAGG - Intergenic
981175483 4:141677996-141678018 CTCTATACCACATTCATCAGAGG + Intronic
981221194 4:142237354-142237376 ACATATATTACTTTCATCTGTGG - Intronic
981641899 4:146953980-146954002 ATTTATCTTATAAACATCAGTGG + Intergenic
983076745 4:163335619-163335641 ATGTATATGACATTGATAAGGGG + Intronic
983113999 4:163789551-163789573 ATGTATATTAGAGTCATCTGAGG + Intronic
983300169 4:165915073-165915095 TTTTATATTACCTTTATCATAGG + Intronic
983413617 4:167427399-167427421 AGTTTTGTTACATACATCAGTGG + Intergenic
983872670 4:172840319-172840341 ATTAGTTTTAAATTCATCAGTGG + Intronic
984076051 4:175181359-175181381 ATTTTTACAATATTCATCAGTGG + Intergenic
984667645 4:182446397-182446419 ATTTACATAGCATTCATCTGGGG + Intronic
984831333 4:183977402-183977424 ATTTATAGTACAGTTATAAGTGG - Intronic
985442703 4:189995468-189995490 ATTTATTTTTCATTTATAAGTGG - Intergenic
986209843 5:5661581-5661603 ATTTATAGAACATTCATTATAGG + Intergenic
986979807 5:13434358-13434380 ATTTATATTCCAAGGATCAGAGG + Intergenic
988208290 5:28169575-28169597 ATTTATATTATAATTTTCAGAGG - Intergenic
988366130 5:30302426-30302448 ATTTAGATGGCAGTCATCAGTGG - Intergenic
988735284 5:34014274-34014296 ATTGATATTAAAGTTATCAGTGG - Intronic
988885421 5:35552139-35552161 ATTTATATTATAAATATCAGGGG + Intergenic
989296790 5:39837774-39837796 ATTTTTATTATATTTAGCAGAGG + Intergenic
990810921 5:59722318-59722340 AGTTAAATTACATTCATCCTTGG + Intronic
990842528 5:60099366-60099388 ATATTCATTACATTCATTAGTGG - Intronic
991188945 5:63845855-63845877 ATTTATATTTCATACATCTGTGG - Intergenic
991411509 5:66350465-66350487 ATTTATTCTACATTTATCAGAGG - Intergenic
991478693 5:67052270-67052292 ATTTACATTACAGTCATCCTGGG - Intronic
993291254 5:86074323-86074345 ATTTATAATACATTAATTGGAGG + Intergenic
993318288 5:86439537-86439559 ATTAATAATACCTACATCAGGGG - Intergenic
993712655 5:91242382-91242404 ATATATATTACATTCAAGTGGGG - Intergenic
994548929 5:101206605-101206627 TGTTATATTACATGCATCAGAGG + Intergenic
995007003 5:107211172-107211194 ATTTATTTTACATTTTTCAGTGG - Intergenic
995844060 5:116474196-116474218 ATTTATATTACTTGCAATAGTGG - Intronic
995855252 5:116584849-116584871 GTTTATAGTACATGCCTCAGTGG - Intergenic
995987439 5:118195834-118195856 ATTTATAATACTTACATCACTGG - Intergenic
999921208 5:156323047-156323069 ATTTATATTAGAATCACCTGGGG - Intronic
1000413038 5:160954160-160954182 ACTACTATTACATTCATTAGTGG + Intergenic
1000705784 5:164510330-164510352 TTTTATATCACATTTGTCAGTGG - Intergenic
1000954269 5:167523741-167523763 ATTTATTTTAGATTGACCAGGGG + Intronic
1001831684 5:174794284-174794306 ATTATTATTACAATCACCAGTGG + Intergenic
1003705884 6:8528588-8528610 ATTCATTTTACATTGATTAGTGG - Intergenic
1004687445 6:17960711-17960733 TTTTATATGTCATTCCTCAGAGG + Intronic
1004832105 6:19487954-19487976 ATTTATATTTCATTTATAATTGG + Intergenic
1005970757 6:30759617-30759639 ATTTGTTTGACATTCATCATGGG - Intergenic
1006986606 6:38179771-38179793 AGTAATATTTCATACATCAGAGG + Intronic
1007146047 6:39633068-39633090 ATTTACAATAAATTCCTCAGAGG + Intronic
1008273229 6:49514249-49514271 ATTTATGTTACATTCAAAACAGG - Intronic
1008560261 6:52717120-52717142 ATTTATATTACAAGGAGCAGAGG + Intergenic
1009702107 6:67197800-67197822 ATTTATATTACACTCACAATTGG - Intergenic
1009797499 6:68490763-68490785 ATTTATATAAGAATCATCAAAGG - Intergenic
1009840804 6:69072032-69072054 ATTTAGAATCCATTCATCATTGG + Intronic
1010602665 6:77850117-77850139 ATTTTTATTTCATTGAGCAGTGG + Intronic
1011563000 6:88642331-88642353 ATTTATATAACATTTATTTGGGG - Intronic
1012442087 6:99270301-99270323 ATTTAAATAAGATTCATCTGAGG - Intergenic
1013046928 6:106495768-106495790 ATTTATAGTACACTCAACAATGG - Intergenic
1013668619 6:112374323-112374345 AATTATATTTCAGTCATCATTGG - Intergenic
1013670042 6:112391723-112391745 ATATATTTTGCCTTCATCAGTGG + Intergenic
1015126367 6:129759530-129759552 ATGGATATTACATTTGTCAGTGG - Intergenic
1015828302 6:137339714-137339736 ATTTAAATAACATTCAACAGTGG + Intergenic
1016770947 6:147850392-147850414 ACTTATATTACTTTCACTAGAGG + Intergenic
1017088912 6:150741149-150741171 ATTTATATCACATTCAAAATGGG - Intronic
1017293054 6:152763557-152763579 ATGTAGAGTACATTTATCAGGGG + Intergenic
1018163498 6:161071117-161071139 ATTTAAAATTCATTCATAAGAGG + Intronic
1019046563 6:169153812-169153834 CTTTATCATACATTCATCAGTGG + Intergenic
1019691138 7:2413564-2413586 ATTTATATGACATTTAAAAGAGG - Intronic
1019851853 7:3567254-3567276 ATTTATCCTCCATTCCTCAGCGG + Intronic
1021000653 7:15326578-15326600 ATGAATATTTCATTAATCAGTGG - Intronic
1022340876 7:29466886-29466908 AATTATATTACATTTATAAATGG - Intronic
1025226397 7:57168274-57168296 ATCTGTATTACTTGCATCAGGGG + Intergenic
1025229452 7:57191547-57191569 ATCTGTATTACTTGCATCAGGGG + Intergenic
1026431996 7:70356945-70356967 ATTTATACAACATTCCTCAAGGG - Intronic
1027429976 7:78101748-78101770 ATTTATATTCCCATCAACAGTGG - Intronic
1027457883 7:78416374-78416396 ATTTATGTTACATACATGATTGG + Intronic
1027533131 7:79361200-79361222 GTTTCTATTACATTCATTAAAGG - Intronic
1027915377 7:84311569-84311591 ATTTATAGTACACCCTTCAGGGG + Intronic
1028687626 7:93609998-93610020 ATTCATAATACTTTCAGCAGGGG + Intronic
1029935955 7:104424478-104424500 ATTTATATTACATCTTTCTGTGG - Intronic
1030080391 7:105773160-105773182 ATTTACATGACAATTATCAGGGG + Intronic
1031711708 7:125055434-125055456 ATTCATATTACATTGACTAGAGG + Intergenic
1035857841 8:2995826-2995848 ATTTATATAACATTCTTGAAGGG + Intronic
1036834491 8:12049812-12049834 ATTTAAAGTACATTTATCAAAGG + Intergenic
1036856334 8:12296376-12296398 ATTTAAAGTACATTTATCAAAGG + Intergenic
1042121737 8:65495790-65495812 ACTTATTTAACATTGATCAGGGG - Intergenic
1042501930 8:69517940-69517962 ATATATTTTACATTTATCATAGG + Intronic
1042709679 8:71702927-71702949 ATTTATATTAAATTTAACACAGG + Intergenic
1043766956 8:84147643-84147665 ATTTTTGCCACATTCATCAGTGG - Intergenic
1045235391 8:100348127-100348149 ATTTATTTTCCATTCAGCAAGGG - Intronic
1046339970 8:112841150-112841172 TTAGATATCACATTCATCAGTGG + Intronic
1046517685 8:115284613-115284635 ATTTTTATTAATTTCATCTGAGG - Intergenic
1047056019 8:121165853-121165875 ATTTTTTTTACTTTTATCAGGGG + Intergenic
1047165119 8:122430070-122430092 ATTTACATTCCCATCATCAGTGG - Intergenic
1049928322 9:431381-431403 ATTTAAAAGACATTCCTCAGGGG + Intronic
1050780895 9:9333732-9333754 ATTTATAATACATTCATATGAGG + Intronic
1050894605 9:10871483-10871505 ATTTCTATTACATTCACTAAAGG + Intergenic
1051307708 9:15732511-15732533 ATTTATATGACATTCTGGAGAGG - Intronic
1051720438 9:20031501-20031523 ATTTATAATCCATTCATTGGTGG - Intergenic
1051771125 9:20581064-20581086 CTTTAAATTCCATTTATCAGTGG + Intronic
1052753009 9:32511262-32511284 ATGTATATTCTATTCATCTGGGG - Intronic
1053449518 9:38181311-38181333 TTTTCTATCACATTCAGCAGAGG - Intergenic
1054832376 9:69640566-69640588 ATATATATAACATTCAGCATAGG - Intronic
1054897901 9:70334715-70334737 ATTTTTATAGCATCCATCAGGGG - Intronic
1057112045 9:92482079-92482101 ATTTAAAATACATTCATTATAGG + Intronic
1057634173 9:96747442-96747464 ATTTATATAACATTCAAGAAAGG - Intergenic
1057772296 9:97979393-97979415 ATTAATATAACTTTCTTCAGTGG - Intergenic
1058737953 9:107912594-107912616 ATATTTATTACATTGAACAGTGG + Intergenic
1186178036 X:6945524-6945546 ATTTAGATTTTATTCATCAATGG - Intergenic
1186814231 X:13220002-13220024 ATTTTTATATCTTTCATCAGTGG + Intergenic
1187598850 X:20804484-20804506 TTTTAGTTTACATTGATCAGTGG + Intergenic
1188782120 X:34298325-34298347 ATTTATTTGACATTCATCTGTGG - Intergenic
1188963279 X:36519448-36519470 TATTATATTACATTCATCTGTGG + Intergenic
1189102844 X:38209060-38209082 TGTTAAAGTACATTCATCAGAGG + Intronic
1190438104 X:50448020-50448042 ATTTATTTTACATTTAACAAAGG - Intronic
1191711979 X:64159531-64159553 ATTTATTTTACAGAAATCAGAGG - Intergenic
1192346849 X:70317078-70317100 AATTGTGGTACATTCATCAGTGG - Intronic
1192469494 X:71385319-71385341 ATTTATAGTAAATTCATCCTAGG - Intronic
1193034725 X:76936903-76936925 ATGTATATTACATTGATTTGGGG - Intergenic
1195350296 X:103989263-103989285 AGTTAAATTACATTCATTAGGGG + Intergenic
1195603743 X:106778054-106778076 ATTTATATAACATACAACATAGG + Intronic
1196202823 X:112905353-112905375 ATTTATATTACAAACACCACAGG + Intergenic
1196210220 X:112987709-112987731 ATTTATATGATATTCATGAAAGG + Intergenic
1196286412 X:113886088-113886110 ACTTATATTACAATCACCAAGGG + Intergenic
1196320695 X:114336073-114336095 ACTCATACTACATTCTTCAGTGG - Intergenic
1196616033 X:117768532-117768554 TTTAATTTTACATTCATCAGGGG + Intergenic
1196617413 X:117783076-117783098 ATTTTGATTATATTCATCATGGG - Intergenic
1197371627 X:125633842-125633864 ATTTATATTCCCATCAGCAGTGG - Intergenic
1197401092 X:125991960-125991982 AATTGTATTAGATTCATCTGTGG - Intergenic
1200420899 Y:2966217-2966239 AGTTATATTACATTGTTCAAAGG + Intronic
1201451728 Y:14122882-14122904 ATTAATAATACATTTATCATGGG - Intergenic