ID: 1170856233

View in Genome Browser
Species Human (GRCh38)
Location 20:20058164-20058186
Sequence AATTTATATTACATTCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 2, 2: 1, 3: 50, 4: 433}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170856233_1170856236 -4 Left 1170856233 20:20058164-20058186 CCCTGATGAATGTAATATAAATT 0: 1
1: 2
2: 1
3: 50
4: 433
Right 1170856236 20:20058183-20058205 AATTGGCACAATTTTACTAGAGG 0: 1
1: 0
2: 0
3: 29
4: 172
1170856233_1170856238 4 Left 1170856233 20:20058164-20058186 CCCTGATGAATGTAATATAAATT 0: 1
1: 2
2: 1
3: 50
4: 433
Right 1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG 0: 1
1: 0
2: 2
3: 11
4: 110
1170856233_1170856237 -3 Left 1170856233 20:20058164-20058186 CCCTGATGAATGTAATATAAATT 0: 1
1: 2
2: 1
3: 50
4: 433
Right 1170856237 20:20058184-20058206 ATTGGCACAATTTTACTAGAGGG 0: 1
1: 0
2: 1
3: 17
4: 192
1170856233_1170856239 5 Left 1170856233 20:20058164-20058186 CCCTGATGAATGTAATATAAATT 0: 1
1: 2
2: 1
3: 50
4: 433
Right 1170856239 20:20058192-20058214 AATTTTACTAGAGGGCAGTAGGG 0: 1
1: 0
2: 1
3: 20
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170856233 Original CRISPR AATTTATATTACATTCATCA GGG (reversed) Intronic
900085233 1:890335-890357 AATTGATTTCACATCCATCACGG + Intergenic
900281121 1:1869766-1869788 TATTTATATTCCATTTATCAAGG + Intronic
902122571 1:14179656-14179678 AATTAATATTTCTTTCCTCATGG - Intergenic
904452899 1:30627865-30627887 AATCTTTATAACATTAATCAGGG - Intergenic
905338136 1:37259514-37259536 AATTTTTATTCCATTGATCTGGG + Intergenic
905444687 1:38019014-38019036 ACTTTATATTAGATTCTTCTAGG - Intronic
906386674 1:45375591-45375613 AATTTATATTTTAATCAGCAGGG - Intronic
906443802 1:45875536-45875558 CATTGATATAACATTAATCAAGG + Intronic
906575260 1:46883554-46883576 AATTTATATGACTTTTATCATGG + Intergenic
906596716 1:47084342-47084364 AATTTATATGACTTTTATCATGG - Intronic
906831877 1:49041345-49041367 AATCTCTAGTACCTTCATCAAGG + Intronic
908445300 1:64194220-64194242 ATTTTTTATAACATTGATCACGG + Intergenic
908464254 1:64376080-64376102 AATTCATATTACTAACATCAAGG + Intergenic
908731831 1:67234195-67234217 TATGTAGATTACATTCTTCATGG - Intronic
909214768 1:72872740-72872762 AATTTAAGTTACATGCAACAAGG - Intergenic
909262670 1:73513129-73513151 AATTTATATTATATTCATAGAGG + Intergenic
909272376 1:73639913-73639935 AAATTAGATTTCTTTCATCATGG + Intergenic
909818112 1:80023253-80023275 AATTCATACTACTTTCATCAAGG - Intergenic
909970837 1:81986798-81986820 TATTTTTTTTATATTCATCAAGG - Intronic
911422393 1:97660486-97660508 AATTAATTTTACATTTATGATGG - Intronic
911515378 1:98861807-98861829 AATTATTATTATAGTCATCATGG - Intergenic
911690881 1:100833063-100833085 AATTTTTATTATGTTCATCAAGG + Intergenic
911952321 1:104190920-104190942 AATTTATATTTCTCTCCTCAGGG + Intergenic
912157622 1:106941622-106941644 AATTAATTTTAAATTCATCAGGG + Intergenic
916886548 1:169074135-169074157 AATTTATTGTGCATTCATTAGGG - Intergenic
917189755 1:172402372-172402394 AATTTAGTTTACATACATCTAGG - Intronic
917804935 1:178604990-178605012 AATTTATATGGCATTTATCTGGG - Intergenic
919100190 1:193086712-193086734 AGTTAATATTAAATCCATCAAGG + Intronic
919153034 1:193723987-193724009 AATTTAAAATACATACATTATGG - Intergenic
919219207 1:194604270-194604292 AATTTATAAAACATTCATGATGG + Intergenic
919939545 1:202276825-202276847 GATTTATATTCCAGTTATCAAGG - Intronic
921560562 1:216653405-216653427 AGTTTATATTTCATTCAGGAAGG - Intronic
921750582 1:218788495-218788517 AATTGATATTATTTTCCTCAGGG - Intergenic
923762675 1:236861213-236861235 AATTTTCATTCCATTCATCAGGG - Exonic
923908476 1:238412896-238412918 AATTTATATTTGTTCCATCATGG - Intergenic
923992662 1:239456153-239456175 AATTTATATTTGTTTTATCAAGG - Intronic
924910219 1:248502825-248502847 GATCTATATTACATTCTCCAAGG + Intergenic
924913882 1:248545213-248545235 GATCTATATTACATTCTCCAAGG - Intergenic
1063508197 10:6620777-6620799 ATTTTATTTTACATTGAACATGG + Intergenic
1064451127 10:15442879-15442901 AATTTATTTTACATGCATAGTGG + Intergenic
1064950471 10:20843394-20843416 AATTCAGAATACATGCATCAGGG - Intronic
1068900240 10:62260305-62260327 AATTTACATAACTTTCTTCAAGG + Intronic
1069041699 10:63702517-63702539 CATTTATATTACATTTTTCATGG + Intergenic
1071038431 10:81276797-81276819 AATTTAGAGTCCATTCAGCATGG + Intergenic
1071189873 10:83087073-83087095 AATTTTTACCACATTGATCAAGG + Intergenic
1072035297 10:91557632-91557654 GATTTATGTTAAATTCATCATGG - Intergenic
1073238992 10:102042074-102042096 AATTTACATTGTATTGATCATGG + Intronic
1073732761 10:106310146-106310168 AATTTCTATTACATTTTTTATGG - Intergenic
1074070849 10:110067770-110067792 AGTTTATATTTCTTTCCTCAAGG + Intronic
1074733740 10:116405885-116405907 AATTTCTGTTACATTTATAAAGG - Intergenic
1074749398 10:116569376-116569398 CATTTATTTCACATTCAACAAGG + Intergenic
1075552730 10:123404251-123404273 CATTTAAAAGACATTCATCAGGG - Intergenic
1075771381 10:124939950-124939972 ATTTTATATTACTTGGATCAGGG + Intergenic
1077260228 11:1614353-1614375 AATCTATACTGCATTAATCAGGG - Intergenic
1077954159 11:6995524-6995546 AATTTCTGATATATTCATCATGG + Intergenic
1078957785 11:16221346-16221368 AATTTTTATTGGTTTCATCAAGG - Intronic
1080321460 11:31014896-31014918 GATTTAAATTTCATTCATTATGG + Intronic
1080524105 11:33096212-33096234 AAATTATAATACATTCAAGAAGG + Intronic
1081162278 11:39763906-39763928 AATTTATATTATACTCTTGAAGG - Intergenic
1081219693 11:40445324-40445346 CATGTTTATTACATTCATAAGGG + Intronic
1082654857 11:55841437-55841459 AATAAATATTACAATTATCAGGG - Intergenic
1082685094 11:56228374-56228396 AATTTTTATTACATTAGTCTTGG + Intergenic
1086028835 11:82327892-82327914 AGTTTAAAGAACATTCATCATGG - Intergenic
1086519056 11:87649412-87649434 AATTTATATAAAATTAATTATGG + Intergenic
1086568197 11:88250981-88251003 CATTTATATCACCCTCATCAGGG - Intergenic
1087727207 11:101734591-101734613 AATTTAGACTACATTCGGCATGG + Intronic
1088023073 11:105143400-105143422 AAATTATTTTAAATTCCTCAAGG - Intergenic
1088586491 11:111364346-111364368 ATTTTATTATACTTTCATCAAGG - Intronic
1088676918 11:112203209-112203231 AATGTATATTACATAATTCAAGG - Intronic
1088944966 11:114502673-114502695 AATTCATATGAGAGTCATCATGG - Intergenic
1089761699 11:120730594-120730616 AATATCAATTACATTCTTCACGG - Intronic
1089949663 11:122513680-122513702 AATTTATTTTAGATTCATGTTGG - Intergenic
1092295283 12:7192136-7192158 AATTTTTATTATCATCATCATGG - Intronic
1093052181 12:14516484-14516506 AATTCATATTTCATTGATCTGGG - Intronic
1093154376 12:15663627-15663649 AAATTATATTAGGTTCAGCAGGG + Intronic
1093155771 12:15683324-15683346 AGTTTATATTACTTTTATAATGG - Intronic
1093256957 12:16880520-16880542 AAATTCAATTACATTTATCAAGG + Intergenic
1093492357 12:19719582-19719604 AATTTACAATACTTTCATCCCGG + Intronic
1094096741 12:26713453-26713475 AAGTTATATGAAATTCATTACGG + Intronic
1095265182 12:40147786-40147808 AAATTATATTACATACATATAGG + Intergenic
1095784393 12:46093694-46093716 AATGGAAATTGCATTCATCATGG + Intergenic
1096772461 12:53944692-53944714 AATTGATATTTTGTTCATCATGG + Intronic
1097386113 12:58951607-58951629 TATTTAAATTACTTTCATAATGG + Intergenic
1097460205 12:59852423-59852445 AATTTATATTTCAATTATCCTGG - Intergenic
1097537054 12:60885605-60885627 TATTTTTATTATGTTCATCAGGG + Intergenic
1098021441 12:66160369-66160391 AATTTATAGTAAAGTCATAATGG + Intronic
1099459751 12:82907715-82907737 ACTTTAGATTATATTTATCACGG + Intronic
1099465124 12:82975193-82975215 AATTTATATTTCATGCGTTAAGG - Intronic
1099625568 12:85068725-85068747 AGTATATATTACATTTATCTAGG + Intronic
1100884331 12:99053097-99053119 AAATTAAATTTCATTTATCAAGG + Intronic
1100921084 12:99487595-99487617 AATTTATAAGACATTCAATATGG + Intronic
1101215776 12:102580499-102580521 AATTAAATTTACATTCATCCAGG + Intergenic
1102871796 12:116419623-116419645 AAATAATGTTGCATTCATCAGGG + Intergenic
1103743359 12:123106215-123106237 AATGTATTTTACTTTCAACAAGG - Intronic
1104003593 12:124876201-124876223 AATAAATATTATATTCCTCATGG + Intronic
1108124580 13:47227765-47227787 AATTTATATTACATTTATTGTGG + Intergenic
1108846845 13:54688778-54688800 TTTTTATTTTACCTTCATCAAGG - Intergenic
1109729450 13:66392396-66392418 AATATTTATTAAATTCATCCTGG + Intronic
1110737851 13:78959294-78959316 AATTTTTATTATATTTTTCAAGG + Intergenic
1110752779 13:79135297-79135319 GAATTTTATTACATTCATTATGG + Intergenic
1111172469 13:84545546-84545568 TATTTATATTTCTTTCATGATGG + Intergenic
1111233911 13:85383023-85383045 AATTTATGTTACTTTCTTCTTGG - Intergenic
1111262822 13:85764546-85764568 AATTGATATCACATTAATGATGG - Intergenic
1111840775 13:93448210-93448232 AAGCTATATTACAATCATCTGGG - Intronic
1111977461 13:94981611-94981633 AATTTATAATGAATTCATCTTGG + Intergenic
1112136545 13:96584714-96584736 AATTTTTATTACATTTCTCCAGG - Intronic
1112768226 13:102769240-102769262 AATTTATCTTACATTTATTAAGG + Intronic
1112905306 13:104411063-104411085 AATTCATATTACATTAAAAAGGG + Intergenic
1113273302 13:108699521-108699543 TATTTATATTGCATGCATCCTGG + Intronic
1113389917 13:109885609-109885631 AATTTATAGTTCTTTCAACAAGG + Intergenic
1113629289 13:111870402-111870424 AATTTTGATTACATTTTTCAAGG - Intergenic
1113726903 13:112611021-112611043 AAATTCTATTACATTTATTAGGG - Intergenic
1114299606 14:21363199-21363221 ATTTTAAATTACATTGATCTCGG - Intronic
1115114261 14:29860804-29860826 AATTTAAATGACATTCCTAAGGG + Intronic
1115364451 14:32541610-32541632 ATTTTCTGTTACATTTATCATGG - Intronic
1115486642 14:33916991-33917013 AATTTATATTATCTTGATGAAGG - Intergenic
1115846963 14:37547565-37547587 TATTAAAATTACATTCATCAAGG + Exonic
1116322587 14:43489642-43489664 AATTTATGTTGCATTCTTCTGGG - Intergenic
1116552277 14:46256527-46256549 ACTTTATCTTATCTTCATCATGG - Intergenic
1117312784 14:54544853-54544875 AATTTATAGTCGATTCAACAAGG - Intergenic
1118081762 14:62369338-62369360 CATTTATAGTATGTTCATCATGG - Intergenic
1118707069 14:68490168-68490190 CATTTATATTACTTTCTTTAAGG - Intronic
1118850973 14:69583265-69583287 AAGTTAAAGTACAGTCATCAGGG - Intergenic
1120458032 14:84757229-84757251 AATTTATTTTATATTGACCAAGG + Intergenic
1121769021 14:96515198-96515220 TATTTAAATTATTTTCATCAAGG - Intronic
1123419599 15:20120741-20120763 ACTTTATGTTACTTTCACCATGG + Intergenic
1123446264 15:20332783-20332805 ACTTTATGTTACTTTCACCATGG - Intergenic
1123528821 15:21127279-21127301 ACTTTATGTTACTTTCACCATGG + Intergenic
1124368780 15:29091559-29091581 AATTTATAATACATTTATCATGG + Intronic
1124385139 15:29201698-29201720 TATCTATATTACATTAATAAGGG + Intronic
1125176137 15:36824043-36824065 AATTTATTTTAAAATTATCATGG + Intergenic
1125944549 15:43702511-43702533 AATGCATATCACAATCATCAAGG - Intergenic
1126847780 15:52777307-52777329 AATTTATATTAGAATCACCGGGG + Intronic
1127254827 15:57280856-57280878 CCTTTATATTATATTCATTAGGG + Intronic
1127574393 15:60275933-60275955 AATTTAAATAAAATTCATCTAGG - Intergenic
1127699303 15:61481762-61481784 AATTTATTTTACATTTAAGAAGG - Intergenic
1127744056 15:61945930-61945952 TATTTATAATACATTGATAAGGG - Intronic
1127774951 15:62257332-62257354 AATTTGTTTTAAATGCATCATGG - Intergenic
1128360837 15:66960640-66960662 AGTGTCTATTTCATTCATCATGG - Intergenic
1128531647 15:68454576-68454598 AATTTATAAAACATTGATGAAGG + Intergenic
1128824006 15:70692832-70692854 AATTTATGTTTTATTCATCTTGG + Intronic
1128893580 15:71352774-71352796 AATTCATTTTTCTTTCATCAGGG - Intronic
1128893787 15:71354532-71354554 AATTTATGTTAAATTAATAAAGG - Intronic
1128922336 15:71623183-71623205 AATTTCTATTATAATAATCAAGG + Intronic
1130838378 15:87673908-87673930 AATTTCTCATTCATTCATCAGGG + Intergenic
1132418405 15:101642336-101642358 CATTTATCTTACCTTTATCAAGG + Exonic
1132913302 16:2327048-2327070 CATTGATCTTACATTCACCAAGG - Intronic
1135066269 16:19312791-19312813 AATTTATGTTACATTTACAAAGG + Intronic
1135303226 16:21348277-21348299 AATTTATTTGACATTCACAATGG + Intergenic
1137226950 16:46522206-46522228 AATATCAATTACATTCCTCATGG - Intergenic
1140083754 16:71775641-71775663 AATTAATTATACATTCCTCATGG - Intronic
1140121129 16:72083791-72083813 TATATATATTACAATCAACAAGG + Intronic
1140720422 16:77766578-77766600 TATTGATATTTCATTTATCATGG - Intergenic
1140947920 16:79787775-79787797 AGTTTATATTACGTGCCTCATGG + Intergenic
1141415830 16:83872831-83872853 AAATTATATAACATTGATGAAGG - Intergenic
1141813235 16:86390700-86390722 TCTGTATAGTACATTCATCAAGG + Intergenic
1142721852 17:1781514-1781536 AAATGATCTTACATTCTTCACGG - Intronic
1144600756 17:16610721-16610743 GATATATATTACATTCATTTAGG - Intergenic
1147865707 17:43550752-43550774 AATATATATCACCTTCAACATGG + Intronic
1149049253 17:52285263-52285285 AAATTATAGTAATTTCATCAGGG - Intergenic
1149138982 17:53407002-53407024 GATTTATCTTACAATCAACATGG + Intergenic
1149414066 17:56440063-56440085 AATATACATTATATTTATCAAGG + Intronic
1149642863 17:58215728-58215750 AATATAGATAAAATTCATCAGGG - Intronic
1150295314 17:64004251-64004273 AATTTATATTTCATTTCTGAAGG - Intronic
1150609116 17:66719078-66719100 AATTAATGTTTCATTCATCCAGG + Intronic
1151039854 17:70846547-70846569 AATATATATTACAATGATGAAGG + Intergenic
1153111275 18:1591256-1591278 AATTTATATTAAATTCTTGCTGG + Intergenic
1153648292 18:7214972-7214994 AATTTATTTTATAATCATGATGG - Intergenic
1155738904 18:29261143-29261165 GATTTATCTTGCATTCAACAAGG - Intergenic
1155773278 18:29726730-29726752 AATTTATATTATATTTAAAAAGG + Intergenic
1159301993 18:66585227-66585249 AATTTATATTATATATATCCAGG - Intronic
1159488526 18:69098672-69098694 AGTTTCTATTATATTCAGCATGG - Intergenic
1164537829 19:29099485-29099507 ACATTATATAACATTCACCAAGG - Intergenic
1166082927 19:40456143-40456165 AAGTTAGCTTACATACATCATGG - Intronic
925607084 2:5670546-5670568 CATTTATATTTCATTCATTGTGG + Intergenic
925709019 2:6719551-6719573 AATTTGTCTTACTTTCATTACGG - Intergenic
925940964 2:8818033-8818055 AATTTATATTACAGTAATGGTGG - Intronic
926806187 2:16713940-16713962 ATTTTATCTAACAGTCATCATGG - Intergenic
926857899 2:17276976-17276998 AAATTATATGACCCTCATCAGGG - Intergenic
927126434 2:20015791-20015813 AATTTCTATTTCATTCAAGATGG - Intergenic
927376757 2:22425695-22425717 AAATTATATTACCTTTATCGAGG + Intergenic
927456368 2:23253043-23253065 AATTTATTTTACTTTTCTCAAGG - Intergenic
928037502 2:27838644-27838666 AATTTATGTTTCTTTCATCATGG - Intronic
930118500 2:47740493-47740515 AAGTTATAATCCAATCATCATGG + Intronic
930241747 2:48942701-48942723 AAATTATATTACATTCTACATGG - Intergenic
930945007 2:57062616-57062638 AATTTTTATTACTTTCCACATGG - Intergenic
931817391 2:65918285-65918307 AATTTATATTCCAAGCTTCAGGG - Intergenic
931962976 2:67502379-67502401 AATTTTTATTGTTTTCATCACGG + Intergenic
933122934 2:78565168-78565190 AATTTCTATAATTTTCATCATGG - Intergenic
933299012 2:80521785-80521807 AATTTATCTTACATTTCTGAAGG - Intronic
933453027 2:82481106-82481128 AATTTTTATTCTATTTATCATGG + Intergenic
933481723 2:82866361-82866383 AATTTAAATACCATTCATAATGG - Intergenic
936672666 2:114676169-114676191 AACTTATATTACAGTCATATAGG - Intronic
937539928 2:122936770-122936792 TATTTTTATTATATCCATCATGG - Intergenic
937611326 2:123865097-123865119 AATTCATTTTATATTCATCCTGG - Intergenic
938284408 2:130097046-130097068 CATTTCTAGTCCATTCATCATGG - Intronic
938335047 2:130485610-130485632 CATTTCTAGTCCATTCATCATGG - Intronic
938354778 2:130635058-130635080 CATTTCTAGTCCATTCATCATGG + Intronic
938367811 2:130749040-130749062 CATATATTTAACATTCATCATGG - Intergenic
938431199 2:131241845-131241867 CATTTCTAGTCCATTCATCATGG + Intronic
938598418 2:132812286-132812308 AATGCATATCACCTTCATCACGG - Intronic
938640060 2:133268361-133268383 AATTAAAACTACATACATCATGG + Intronic
939333355 2:140791945-140791967 AATTTATATCACCTTCAGAAAGG - Intronic
939386932 2:141512826-141512848 AATCCATATTACATTCAGCCAGG - Intronic
940082881 2:149824630-149824652 AATTTTTATAACATACTTCATGG - Intergenic
940107009 2:150112686-150112708 ACTTTTTATTACCTTCATTAAGG + Intergenic
940250942 2:151675623-151675645 AATTTACCTTCCATTCATCTTGG - Intronic
940543584 2:155053977-155053999 AATTTAAACTACATTTATTATGG + Intergenic
941218502 2:162744231-162744253 AATTTATATTGCATTTAACAAGG - Intronic
941498235 2:166234880-166234902 ACTCTATATTCCATTCATGAAGG - Intronic
941520910 2:166541272-166541294 AAGGTATATCACATTCATGATGG + Intergenic
942225673 2:173813238-173813260 ATTTTTTGTAACATTCATCATGG + Intergenic
944181240 2:196897045-196897067 AAATTACATTAAATCCATCATGG + Intronic
944697198 2:202212630-202212652 AATTGAGATGAAATTCATCAGGG - Intronic
944742196 2:202623498-202623520 AATTTTTAAAACATTTATCATGG + Intergenic
944797196 2:203199403-203199425 TAATTACTTTACATTCATCAAGG + Exonic
945599778 2:211846345-211846367 AAATGCAATTACATTCATCAGGG + Intronic
946997106 2:225405935-225405957 AAGTAAAATTACATTTATCAAGG + Intronic
947453336 2:230229075-230229097 AATATATATTACAAACTTCAGGG - Intronic
947780682 2:232758874-232758896 AATTTATATTACATTATTTTAGG + Intronic
947922697 2:233892118-233892140 AATTTACATTATCTTCAGCAGGG - Intergenic
1170396945 20:15936003-15936025 AAGTAATAGTACATGCATCATGG + Intronic
1170749779 20:19135325-19135347 AATTGATATTACATGACTCAAGG + Intergenic
1170856233 20:20058164-20058186 AATTTATATTACATTCATCAGGG - Intronic
1171816334 20:29788869-29788891 AATTGATTTCACATCCATCACGG - Intergenic
1171902038 20:30867193-30867215 AATTGATTTCACATCCATCACGG + Intergenic
1173074928 20:39808842-39808864 AATTTTGATTATTTTCATCATGG + Intergenic
1173933195 20:46838971-46838993 AATTCATTTAACACTCATCATGG + Intergenic
1174245343 20:49175435-49175457 TATTCATATTACTCTCATCAGGG - Intronic
1175323302 20:58104895-58104917 CATTTTTATAACATTTATCATGG - Intergenic
1176270014 20:64231429-64231451 AATTTATGTTATTTTCATAAGGG + Intronic
1177316538 21:19469411-19469433 AATTTCTGTTACATTCTTCTTGG + Intergenic
1177548571 21:22592012-22592034 AATATATATTTAAATCATCAAGG + Intergenic
1177600711 21:23309156-23309178 AATTTATTTTAATTTCATAAGGG - Intergenic
1178458868 21:32782629-32782651 TATTTATATTACATTCACAATGG + Intergenic
1179392183 21:41003960-41003982 CACTTATGTTACATGCATCAGGG - Intergenic
1180335416 22:11573126-11573148 AATTGATTTCACATCCATCACGG + Intergenic
1181325003 22:22038232-22038254 AATTTATTTTACTTCCATGATGG + Intergenic
1182213993 22:28700708-28700730 AATTTTTATAACAACCATCAAGG - Intronic
1183330289 22:37216422-37216444 TATTTACATTGCATTAATCATGG - Intergenic
1184619175 22:45661251-45661273 ATTGTATATTACATTCCTTAGGG - Intergenic
1184891972 22:47385410-47385432 AATTGATATGAAATTCATCTAGG - Intergenic
949179116 3:1105483-1105505 AATTTATAAAACATTTTTCAAGG - Intronic
949276186 3:2284715-2284737 AATTTATATTACCTTTAAGAAGG - Intronic
951421778 3:22494817-22494839 TATATCTATTACATTGATCATGG - Intergenic
951512101 3:23513736-23513758 TATTTATATCAGATTCATAAAGG - Intronic
951636450 3:24783744-24783766 TATTTACATTACATTGTTCATGG + Intergenic
953946334 3:47151124-47151146 ATTCTATAATATATTCATCATGG + Intronic
954858874 3:53670716-53670738 AACTTATATCAAAGTCATCAAGG - Intronic
955350976 3:58192750-58192772 AATTTAAACTACAGTCTTCAAGG - Exonic
955558780 3:60166029-60166051 AATTTTTCTCACATTCATCAAGG + Intronic
956424193 3:69116150-69116172 AATTTATAGTACATGCAGAAAGG + Intronic
958550071 3:95600721-95600743 TATGTATATTACATACATAAAGG + Intergenic
958642127 3:96817703-96817725 AAATTATATGACATCCTTCATGG + Intronic
958876490 3:99623469-99623491 AATTTATTTTACATAGATGAAGG + Intergenic
963002886 3:140699724-140699746 TATTTATACTACTTTTATCAGGG + Intronic
963240354 3:142996928-142996950 AATTTCTATTATTTTCAACATGG + Intronic
964425924 3:156554070-156554092 ACTTCAAATTTCATTCATCAGGG + Intronic
964606947 3:158570446-158570468 TATTTGCATTACATTTATCAGGG - Intergenic
965024698 3:163285779-163285801 ACATTATATTATTTTCATCATGG - Intergenic
965870609 3:173260054-173260076 AATTTACATTACATTCATCAGGG - Intergenic
966328206 3:178781035-178781057 AATTTACATTACTTTCACAAAGG - Intronic
966774904 3:183535421-183535443 TATTTATATGACATTCACGAGGG - Intronic
967738898 3:192983598-192983620 TATTTGTATTCCATTCCTCATGG + Intergenic
968786328 4:2624672-2624694 AATTTATATTAAATTTAAAAAGG - Intronic
969415769 4:7057295-7057317 AATTAATTATACATTCATTATGG - Exonic
970424903 4:15937061-15937083 AATTTAAATAGCATTGATCAGGG + Intronic
970818106 4:20181802-20181824 AATTGAGAATATATTCATCATGG - Intergenic
970902650 4:21177529-21177551 AAATTATATTACATTTGGCAAGG + Intronic
970916038 4:21336454-21336476 CATTTTTATTCTATTCATCAAGG + Intronic
970955048 4:21801238-21801260 AATTTATGTTAAAATCGTCAAGG + Intronic
971906139 4:32728330-32728352 TAGTTATATTACATCCATTAGGG + Intergenic
971962843 4:33511208-33511230 CATTTATATTCCATCCATCAAGG - Intergenic
971989603 4:33874688-33874710 AATTTATATTTCATGCTTTATGG - Intergenic
972001701 4:34044647-34044669 AATATATATTACATAAATTAAGG + Intergenic
972032634 4:34480389-34480411 AATAATTATTACATGCATCATGG + Intergenic
972103685 4:35455291-35455313 CATTTATATGTCATTCATGAGGG + Intergenic
974111118 4:57526732-57526754 AAATTTTATTACAGTCATTAGGG - Intergenic
974146752 4:57957700-57957722 TTTTTATATTGGATTCATCAAGG - Intergenic
974895519 4:67933407-67933429 AATTTACATCACATTTAACAGGG - Intronic
975570222 4:75808898-75808920 AAATGGTATTAAATTCATCAAGG - Intronic
975905717 4:79209743-79209765 AGTTTAGATTACATTGGTCAGGG + Intergenic
976336853 4:83898608-83898630 AATTTCTTTTACATTAATCTAGG + Intergenic
977954670 4:103012890-103012912 CTTTTATAATACATTCATGAGGG + Intronic
978389018 4:108205034-108205056 ACTCTATATTACAGCCATCATGG + Intergenic
978685066 4:111431013-111431035 TATTTATATTATCTTCAGCATGG - Intergenic
979039669 4:115773518-115773540 AATTTAAATTACATTTATAATGG + Intergenic
979446374 4:120817545-120817567 AATTTACATTACTTTCATATTGG + Intronic
979529012 4:121748828-121748850 AATTTATAATCCAATCAACATGG - Intergenic
979751486 4:124284794-124284816 AATTTATGTTAAAATCAGCACGG - Intergenic
979834868 4:125352958-125352980 AATTAAAAACACATTCATCAAGG - Intronic
980167490 4:129246683-129246705 TTTTTATATTCCATTCTTCATGG - Intergenic
980414907 4:132474021-132474043 TAATTATATTACATTCATGTAGG + Intergenic
980493736 4:133563677-133563699 AATTTATATTTGAATCAGCAAGG - Intergenic
980624117 4:135350071-135350093 AATTTACATTCCCATCATCAGGG - Intergenic
980764397 4:137281205-137281227 AAATTAAATTTCATACATCATGG + Intergenic
980812961 4:137906357-137906379 AAATTATATAGAATTCATCATGG - Intergenic
981114021 4:140968859-140968881 TATTTATATTAATTTCATTAGGG + Intronic
981594905 4:146408870-146408892 CATTTCTATTGCATTCTTCATGG + Intronic
982800745 4:159703336-159703358 AGTTTATATCACATTGATTATGG + Intergenic
983036074 4:162867344-162867366 AATGTACATTCCATTCATCAGGG + Intergenic
983076744 4:163335618-163335640 AATGTATATGACATTGATAAGGG + Intronic
983307758 4:166014966-166014988 AATTTATATGCCATTAACCATGG - Intronic
983367500 4:166813109-166813131 GGTTTATGTTACATTAATCATGG - Intronic
984168824 4:176336569-176336591 AATTTATGTTGCTTTCATTAAGG + Intergenic
984242868 4:177238751-177238773 AAATTCTCTCACATTCATCAAGG - Intergenic
984667644 4:182446396-182446418 AATTTACATAGCATTCATCTGGG + Intronic
985032366 4:185802350-185802372 CATTTATTATACATCCATCAAGG - Intronic
985137871 4:186806326-186806348 AATTTGTATTAAATTTTTCAAGG + Intergenic
985938597 5:3115647-3115669 AATTTATGCTAATTTCATCAAGG + Intergenic
985987635 5:3530065-3530087 ATATCCTATTACATTCATCAAGG - Intergenic
986212539 5:5687839-5687861 ATTTAAAATTACATCCATCAAGG + Intergenic
986858173 5:11895990-11896012 AATTTATATTTCTCTCAGCAAGG - Intronic
987496746 5:18654768-18654790 AAAATATATTACAGTCATGATGG - Intergenic
987630771 5:20468884-20468906 AATTTAAAATACATTAATCGAGG + Intronic
987854005 5:23394696-23394718 TATTTATGTTCCATTAATCAAGG + Intergenic
989351542 5:40492803-40492825 AATTTATATTCCCTTCTTCTAGG + Intergenic
989572753 5:42960215-42960237 CAGTGATATTACATTCAACATGG - Intergenic
990060053 5:51636611-51636633 AATTTAAATTCCATTTATAAGGG + Intergenic
990882217 5:60552003-60552025 ACATTACATTGCATTCATCAAGG - Intergenic
991318030 5:65333819-65333841 AATTTATATAATATTTATGATGG + Intronic
991358305 5:65792946-65792968 AATTTATATCAAATTCCTAAAGG - Intronic
991478694 5:67052271-67052293 GATTTACATTACAGTCATCCTGG - Intronic
991899058 5:71438594-71438616 AATTTATATTACCATAATGATGG + Intergenic
991899059 5:71438605-71438627 AATTTATATTACCATCATTATGG - Intergenic
993318289 5:86439538-86439560 AATTAATAATACCTACATCAGGG - Intergenic
993800962 5:92336220-92336242 AATTTATATTTTATTAATAAAGG - Intergenic
994009423 5:94883397-94883419 AATATATAGGACATTCCTCAAGG - Intronic
994495316 5:100504793-100504815 ATTTTACATTACTTTCAGCATGG + Intergenic
995193027 5:109339773-109339795 ACACTATATTAAATTCATCATGG + Intronic
995425137 5:112012707-112012729 ACTTAATACTACTTTCATCAAGG + Intergenic
995430983 5:112076985-112077007 ATTTTATATTACATTCATCAAGG + Intergenic
995641515 5:114262627-114262649 ATTTTAAATTAAATTCTTCATGG + Intergenic
995894080 5:116991036-116991058 AATTAATATTAAATTCATAAGGG - Intergenic
996182357 5:120434919-120434941 ATTTTAGATTAAGTTCATCAAGG - Intergenic
996329634 5:122313681-122313703 ATGTTAAATTACATTCAGCATGG + Intronic
996461264 5:123745953-123745975 TATTTATATCACATTCATAGTGG - Intergenic
997587948 5:135055046-135055068 AATTTTTATTACATTAATTATGG + Intronic
998640663 5:144006906-144006928 ACTTCATCTTCCATTCATCAAGG + Intergenic
998963918 5:147517216-147517238 AATTTATATTGGATACATGAAGG + Intergenic
998984966 5:147746548-147746570 TATTTATATATCATTTATCATGG + Intronic
999609533 5:153353912-153353934 AATTGATATTTTCTTCATCATGG - Intergenic
999812438 5:155140417-155140439 AATCAATATAACATTTATCAAGG - Intergenic
1000016712 5:157284347-157284369 AATTTATAAAACATACTTCAAGG - Intronic
1000058634 5:157632769-157632791 ATTTTATATTCCTTTTATCAAGG + Intronic
1000556126 5:162728417-162728439 AATATCTATTACATTGATTATGG - Intergenic
1003456410 6:6286735-6286757 GATTTCTATTACTTTCATCCCGG - Intronic
1004733183 6:18378986-18379008 AATTTGTTTTTCATCCATCAGGG - Intergenic
1005174680 6:23031293-23031315 AATTAATTATACATTCATTATGG + Intergenic
1005706773 6:28462819-28462841 CATTTTTATTACATTCACCAGGG - Intergenic
1005970758 6:30759618-30759640 CATTTGTTTGACATTCATCATGG - Intergenic
1006206878 6:32353411-32353433 AAATTATATTACATTATTGAAGG + Intronic
1006344380 6:33468193-33468215 ATTTTAGATTAAATTCATCAAGG + Intergenic
1007331520 6:41113827-41113849 AAATTATATTTCCTTCTTCAAGG + Intergenic
1008660568 6:53663348-53663370 AATTTATTTTACATTCAAAAAGG - Intronic
1009921482 6:70067004-70067026 AATCTATATTTTATTCATCACGG - Intronic
1010443341 6:75924134-75924156 AATTTATATTCCCACCATCAGGG - Intronic
1010891601 6:81319265-81319287 AATTTGTAAAACATTTATCAAGG - Intergenic
1011441417 6:87391221-87391243 AATTTCTATTTCCTTTATCAAGG - Intronic
1011563001 6:88642332-88642354 AATTTATATAACATTTATTTGGG - Intronic
1012831462 6:104208664-104208686 AACTAATATTATATTCATCAGGG + Intergenic
1012884394 6:104828811-104828833 AATTTATATTACATTTTTTAAGG - Intronic
1013562604 6:111320465-111320487 AATTTAAATTATATTTAACAAGG + Intronic
1013652950 6:112214563-112214585 AACATATATTACATTAATGAGGG + Intronic
1013669111 6:112378933-112378955 AATTTATGTTTCATTCTTGATGG + Intergenic
1014392964 6:120886949-120886971 AATTTATAAAACATTTATAAGGG + Intergenic
1014403939 6:121025045-121025067 AATAAAAATTACATTCATAATGG + Intergenic
1015542555 6:134330369-134330391 AATTTATATTACATTTTAAAAGG - Intergenic
1016244093 6:141962627-141962649 AATGGAAATTGCATTCATCATGG + Intergenic
1016266301 6:142236040-142236062 AATTTGGATTACATTCATATAGG + Intergenic
1017088913 6:150741150-150741172 TATTTATATCACATTCAAAATGG - Intronic
1017869664 6:158476276-158476298 AATTTACATTAAATTAATTAGGG - Intronic
1017888194 6:158617942-158617964 AATGTATATTCCATTGATTAGGG + Intronic
1018421726 6:163646074-163646096 AATTTATATTGTATTCAGTAAGG + Intergenic
1018441361 6:163816458-163816480 AAATTATATGACAAACATCAAGG + Intergenic
1020535759 7:9395585-9395607 ATTTGATATTACATTCATGGAGG - Intergenic
1020931044 7:14394528-14394550 AAATTCTCTTAAATTCATCAAGG + Intronic
1021804593 7:24342675-24342697 AAAGTATCTTAAATTCATCATGG + Intergenic
1022273514 7:28833357-28833379 ACTTTATATCACATTTGTCAAGG + Intergenic
1022628060 7:32058659-32058681 AGTTTTTAATACATGCATCATGG - Intronic
1023217738 7:37882888-37882910 ATTTATTATTATATTCATCATGG + Intronic
1023642561 7:42274867-42274889 ATTCTATATTTCATTCCTCATGG - Intergenic
1023955035 7:44878657-44878679 AATATAAAATACATTCATAAAGG + Exonic
1024196298 7:47062198-47062220 AATTCATCTTCCATTCATGAGGG - Intergenic
1025738603 7:64177058-64177080 AATTGATATTAAAATGATCATGG + Intronic
1026182980 7:68058447-68058469 AATTTATACCACATTCAGGAAGG - Intergenic
1026431997 7:70356946-70356968 AATTTATACAACATTCCTCAAGG - Intronic
1027503572 7:78986203-78986225 AATTTTATTTACATTCTTCATGG - Intronic
1028661092 7:93276354-93276376 AATTTATATTTCCTTTATCTTGG + Intronic
1028972071 7:96870495-96870517 AAATAATATTACTTACATCATGG - Intergenic
1030080390 7:105773159-105773181 AATTTACATGACAATTATCAGGG + Intronic
1031125570 7:117770283-117770305 AATTTTTATTACATTCAGGTAGG + Intronic
1031445379 7:121847050-121847072 AAATTAAATTATATTCATAAAGG - Intergenic
1031621067 7:123934380-123934402 AATTTATATTCCCATCAACAAGG - Intronic
1031785999 7:126033605-126033627 TATATATACTACATTCATTATGG + Intergenic
1032372286 7:131369132-131369154 AAATTATAGAACATACATCATGG - Intronic
1033480402 7:141734718-141734740 AAGTTATATTACATCCATCTTGG + Intergenic
1033828575 7:145223780-145223802 AAATCATTTTACATTAATCATGG - Intergenic
1033839672 7:145359174-145359196 AATAAATATTATATTGATCAGGG - Intergenic
1035481299 7:159188692-159188714 AATTCATTTTAAATTCATTAAGG - Intergenic
1035823054 8:2615767-2615789 AATTTATACTGCATTCATCTAGG + Intergenic
1035857840 8:2995825-2995847 CATTTATATAACATTCTTGAAGG + Intronic
1036029244 8:4948123-4948145 AATTTATACTACTATCATCATGG + Intronic
1037024045 8:14010090-14010112 AGTTTATAATACCTTCATGAGGG + Intergenic
1037036501 8:14175452-14175474 AATTTATATTCCATTACTTATGG - Intronic
1037657463 8:20897651-20897673 AATTCTTAGTACATTCTTCAAGG + Intergenic
1038006914 8:23438909-23438931 TATTAAGATTACATTAATCAAGG + Intronic
1039178733 8:34839224-34839246 ATTCTGTATTACATACATCAAGG + Intergenic
1041006482 8:53501266-53501288 TATTTATCTTACCTTAATCAAGG - Intergenic
1041538317 8:58953810-58953832 AATTTATGTCACAATCAACATGG + Intronic
1042003510 8:64154511-64154533 AATTTATCTCTCAGTCATCAGGG + Intergenic
1042313738 8:67403575-67403597 AATATATATTATATACACCATGG + Intergenic
1042326420 8:67533684-67533706 CATTTATGTTGCATTCTTCATGG + Intronic
1044279924 8:90342547-90342569 AACATATATTAGGTTCATCACGG - Intergenic
1044436790 8:92173731-92173753 AAAATATTTTACATTAATCAAGG - Intergenic
1045235392 8:100348128-100348150 GATTTATTTTCCATTCAGCAAGG - Intronic
1046201289 8:110931397-110931419 AATTTATATGACTTTCTTTATGG - Intergenic
1046419272 8:113958516-113958538 AATTTATAATACTTTTATTATGG + Intergenic
1046734244 8:117759452-117759474 AAGTTAAGTTACATACATCATGG - Intergenic
1046762735 8:118038321-118038343 AATTTATATTTTATCCATTAAGG - Intronic
1048347935 8:133592049-133592071 ATTTTACAATACATTCAACAAGG + Intergenic
1048849310 8:138629460-138629482 ATTTTATATTTTATTCATCCTGG + Intronic
1050088164 9:1988656-1988678 CATTTATGTTCCATTCATGAGGG + Intergenic
1050163890 9:2744800-2744822 CATTTATATTACTTTCAGCATGG + Intronic
1050636433 9:7617687-7617709 AAATTATACTACTTTTATCATGG + Intergenic
1050689295 9:8207393-8207415 AAGTTAAAGTACATTCATCCAGG - Intergenic
1051155106 9:14134126-14134148 AATTTATAGAACATTCTTTATGG - Intronic
1052207010 9:25854735-25854757 AATATATATTGCATTAATTATGG - Intergenic
1052753010 9:32511263-32511285 AATGTATATTCTATTCATCTGGG - Intronic
1053505019 9:38635823-38635845 AATTTCTATTTGATTCATTATGG + Intergenic
1053730425 9:41050071-41050093 AATTTCAATAACATTCTTCATGG - Intergenic
1054698073 9:68381995-68382017 AATTTCAATAACATTCTTCATGG + Intronic
1054834261 9:69659808-69659830 AATTTATTTTACATGTGTCATGG + Intronic
1054961993 9:70979562-70979584 AATTTAAATTACTTACACCAAGG - Intronic
1055652158 9:78417079-78417101 AAATTGGATTACATTCATTAAGG - Intergenic
1055838985 9:80479460-80479482 AACTTATACTATATTCTTCATGG + Intergenic
1056746257 9:89306431-89306453 AATTAAGATTAAAGTCATCAGGG + Intergenic
1057579729 9:96276219-96276241 AATTTATAAAACATTAATGAAGG + Intronic
1058328655 9:103729996-103730018 GATTTTTATTACATTTATCATGG - Intergenic
1059283199 9:113151727-113151749 AAATTCTATGACATTCTTCATGG - Intronic
1059677257 9:116551220-116551242 CATTTATATCAGAATCATCAGGG - Intronic
1060607718 9:124932167-124932189 AATTTAAATAACAGACATCATGG + Intronic
1060703108 9:125776851-125776873 TATTAATATTACTTTCATCATGG + Intronic
1186128837 X:6444697-6444719 AATTCTTATGACATTCCTCATGG + Intergenic
1187308780 X:18121273-18121295 ATTTGATATTATCTTCATCATGG - Intergenic
1187466717 X:19534094-19534116 AAATTATTTTGCATTCAGCATGG - Exonic
1188251954 X:27907691-27907713 CATTTAAATTACAGTCAGCAAGG - Intergenic
1188337347 X:28953251-28953273 AATTTATATTACAATCATTTTGG + Intronic
1188843842 X:35049113-35049135 AATTTAAATTACATTCACTCTGG - Intergenic
1189141844 X:38615289-38615311 ATTTTATATTACATTCTTATAGG - Intronic
1190505539 X:51122075-51122097 AATTTTTGCTTCATTCATCATGG + Intergenic
1193034726 X:76936904-76936926 AATGTATATTACATTGATTTGGG - Intergenic
1194115827 X:89896274-89896296 AATTTATATTACAATAATCTTGG - Intergenic
1194328404 X:92550387-92550409 AATTTATACTAAAATAATCATGG - Intronic
1194620758 X:96168249-96168271 AATTTACTTTACATTCCTAATGG + Intergenic
1194673177 X:96760868-96760890 TATTTAAAGTTCATTCATCATGG - Intronic
1194747008 X:97639422-97639444 TATTTCTACTACATTCACCAGGG - Intergenic
1194959337 X:100216987-100217009 AATTTCTATTACTTACATTAAGG + Intergenic
1195342213 X:103917340-103917362 AAGTTAAATTACATTCATTAGGG - Intergenic
1195349337 X:103982066-103982088 AAGTTAAATTACATTCATTAGGG - Intergenic
1195350295 X:103989262-103989284 AAGTTAAATTACATTCATTAGGG + Intergenic
1195356698 X:104046159-104046181 AAGTTAAATTACATTCATTAAGG - Intergenic
1195358106 X:104056773-104056795 AAGTTAAATTACATTCATTAGGG + Intergenic
1195457771 X:105088743-105088765 TATTGATGTTACATTCATTAAGG - Intronic
1195503093 X:105625977-105625999 AATTTATAGCACATTGATCTAGG + Intronic
1196232875 X:113244888-113244910 AATTCTTATTACATTCACCAGGG + Intergenic
1196286411 X:113886087-113886109 CACTTATATTACAATCACCAAGG + Intergenic
1196616032 X:117768531-117768553 TTTTAATTTTACATTCATCAGGG + Intergenic
1196617414 X:117783077-117783099 AATTTTGATTATATTCATCATGG - Intergenic
1196793438 X:119484041-119484063 AATTTAAATTACTTACTTCATGG - Intergenic
1197319772 X:125013463-125013485 AATTTATATTATAGTAACCATGG + Intergenic
1197499294 X:127224026-127224048 AAATTATATTACATTGGTTAGGG + Intergenic
1198574451 X:137994714-137994736 AATATACATTACATCCCTCAGGG - Intergenic
1199341057 X:146677931-146677953 AAGTTAAATTACATTCTTCAAGG + Intergenic
1199738924 X:150714002-150714024 TATTCATATTACATTGCTCAGGG - Intronic
1200382021 X:155847776-155847798 AATTTATTTCATATTCAGCATGG - Intergenic
1200468629 Y:3553401-3553423 AATTTATATTACAATAATCCTGG - Intergenic
1200637112 Y:5669610-5669632 AATTTATACTAAAATAATCATGG - Intronic
1200757290 Y:7001711-7001733 AATTTGTTTCACATTGATCAAGG + Intronic
1200891683 Y:8330757-8330779 AATTTATAACACCTTCATGAGGG - Intergenic
1200892716 Y:8340742-8340764 CATTTATACCACATGCATCAGGG - Intergenic
1201070687 Y:10145116-10145138 AATTGATTTCACATCCATCACGG + Intergenic
1201451729 Y:14122883-14122905 AATTAATAATACATTTATCATGG - Intergenic
1201713825 Y:17021321-17021343 AATATATATTGTGTTCATCAAGG - Intergenic
1202255095 Y:22912902-22912924 GATTTATATCACATTCACAATGG - Intergenic
1202408086 Y:24546651-24546673 GATTTATATCACATTCACAATGG - Intergenic
1202462696 Y:25123429-25123451 GATTTATATCACATTCACAATGG + Intergenic