ID: 1170856234

View in Genome Browser
Species Human (GRCh38)
Location 20:20058165-20058187
Sequence CAATTTATATTACATTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170856234_1170856238 3 Left 1170856234 20:20058165-20058187 CCTGATGAATGTAATATAAATTG No data
Right 1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG 0: 1
1: 0
2: 2
3: 11
4: 110
1170856234_1170856239 4 Left 1170856234 20:20058165-20058187 CCTGATGAATGTAATATAAATTG No data
Right 1170856239 20:20058192-20058214 AATTTTACTAGAGGGCAGTAGGG 0: 1
1: 0
2: 1
3: 20
4: 151
1170856234_1170856237 -4 Left 1170856234 20:20058165-20058187 CCTGATGAATGTAATATAAATTG No data
Right 1170856237 20:20058184-20058206 ATTGGCACAATTTTACTAGAGGG 0: 1
1: 0
2: 1
3: 17
4: 192
1170856234_1170856236 -5 Left 1170856234 20:20058165-20058187 CCTGATGAATGTAATATAAATTG No data
Right 1170856236 20:20058183-20058205 AATTGGCACAATTTTACTAGAGG 0: 1
1: 0
2: 0
3: 29
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170856234 Original CRISPR CAATTTATATTACATTCATC AGG (reversed) Intronic
No off target data available for this crispr