ID: 1170856238

View in Genome Browser
Species Human (GRCh38)
Location 20:20058191-20058213
Sequence CAATTTTACTAGAGGGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170856234_1170856238 3 Left 1170856234 20:20058165-20058187 CCTGATGAATGTAATATAAATTG No data
Right 1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG 0: 1
1: 0
2: 2
3: 11
4: 110
1170856231_1170856238 6 Left 1170856231 20:20058162-20058184 CCCCCTGATGAATGTAATATAAA 0: 1
1: 0
2: 0
3: 13
4: 221
Right 1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG 0: 1
1: 0
2: 2
3: 11
4: 110
1170856233_1170856238 4 Left 1170856233 20:20058164-20058186 CCCTGATGAATGTAATATAAATT 0: 1
1: 2
2: 1
3: 50
4: 433
Right 1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG 0: 1
1: 0
2: 2
3: 11
4: 110
1170856230_1170856238 7 Left 1170856230 20:20058161-20058183 CCCCCCTGATGAATGTAATATAA 0: 1
1: 0
2: 2
3: 8
4: 169
Right 1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG 0: 1
1: 0
2: 2
3: 11
4: 110
1170856232_1170856238 5 Left 1170856232 20:20058163-20058185 CCCCTGATGAATGTAATATAAAT 0: 1
1: 0
2: 1
3: 26
4: 304
Right 1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG 0: 1
1: 0
2: 2
3: 11
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170856238 Original CRISPR CAATTTTACTAGAGGGCAGT AGG Intronic
900372054 1:2336538-2336560 CAATCTTTCTAGAAGGCAGGCGG - Exonic
903575541 1:24337568-24337590 GAAGTCTCCTAGAGGGCAGTGGG - Intronic
904750759 1:32740544-32740566 CAGGATTACTAGAGTGCAGTGGG - Intergenic
911779525 1:101858744-101858766 CAATTATAGTAGAAGGCAGAGGG - Intronic
917341875 1:173988067-173988089 CAATTTCACTAAAGGGGTGTAGG - Intronic
917701299 1:177584248-177584270 CAATTTTACCATAGGCAAGTGGG - Intergenic
918118538 1:181517395-181517417 TACTTTAACCAGAGGGCAGTGGG + Intronic
919204745 1:194407486-194407508 CACTTTTAAAAGAGGGCTGTTGG + Intergenic
1065270055 10:24020257-24020279 TAGTTTTACAAGAGGGAAGTTGG + Intronic
1065553242 10:26889469-26889491 CATTTATACTAGGGGGCACTAGG - Intergenic
1066073900 10:31852545-31852567 CAATATTACTACAGTGCAGACGG - Exonic
1068982827 10:63079225-63079247 CACTTAGACTAGAGTGCAGTGGG - Intergenic
1069268934 10:66499573-66499595 CAATTTTAATAGAGAACAATAGG + Intronic
1080405293 11:31973317-31973339 CAATTTGCCTAGAGGGCCGAGGG - Intronic
1080483278 11:32675483-32675505 CGCTATTACTAGAGGACAGTTGG - Intronic
1083395262 11:62386857-62386879 CCATTCTACTGGAGGGCAGGTGG + Intronic
1086616289 11:88824493-88824515 CAATTTTTCCACAGGACAGTGGG + Intronic
1087417019 11:97870301-97870323 CACTTTTACTAAAGGACAATAGG - Intergenic
1087741439 11:101892089-101892111 GAATTTTTCTTGAGGGCATTTGG - Intronic
1094123286 12:26996636-26996658 CAATTTTACTACAGAGAATTAGG + Intronic
1095841901 12:46702421-46702443 CAGTTTTACTACAGAGGAGTAGG - Intergenic
1097432054 12:59521845-59521867 CAACTTTTCTAAAGGTCAGTGGG - Intergenic
1099824369 12:87756119-87756141 AAATTTTACTAAATAGCAGTTGG + Intergenic
1101239357 12:102823239-102823261 CAATCTTACTAGTGGGCACTTGG + Intergenic
1101282242 12:103270304-103270326 CATTTCTACTAGATGGAAGTAGG + Intronic
1102715075 12:114963520-114963542 CAATATTAGCAGAGGGCACTTGG + Intergenic
1103471009 12:121181071-121181093 TACTTTTAAGAGAGGGCAGTTGG - Intronic
1105923391 13:24985192-24985214 CATTTTTTCTAGATGGCTGTGGG - Intergenic
1110589158 13:77234401-77234423 AAATTTTATTAGAGGGCAGTAGG - Intronic
1112839205 13:103554885-103554907 CTATTTCCCTAGAGGGCATTTGG + Intergenic
1113158575 13:107353216-107353238 CAATTTTATTAGTGTGCAGGAGG - Intronic
1113598519 13:111551477-111551499 CAATTTAATTAGAGGGCAGTGGG + Intergenic
1114599008 14:23939134-23939156 CAGCTTTTCTAGAGGGCAATAGG + Intergenic
1118677262 14:68200618-68200640 CAATTTTACTTGAAGGAAGTTGG + Intronic
1121390604 14:93570283-93570305 CAATTTCAAAATAGGGCAGTTGG - Intronic
1121576681 14:94994650-94994672 CATTTCCATTAGAGGGCAGTAGG + Intergenic
1121877191 14:97464214-97464236 CAATTTTCCTAGGGTGCAGCAGG - Intergenic
1131339895 15:91589048-91589070 CATTTTTCCTAATGGGCAGTAGG - Intergenic
1132774685 16:1586487-1586509 CAGCTTTCCTAGAGGCCAGTTGG + Intronic
1138118624 16:54380283-54380305 GAAGTTAACTAGAGGGAAGTGGG + Intergenic
1138726553 16:59146829-59146851 CAGATATTCTAGAGGGCAGTGGG - Intergenic
1146032943 17:29381930-29381952 CAATATTAGTAGAGGGGGGTGGG + Intergenic
1149485038 17:57036084-57036106 CAATTTGTCCAGAGGGCACTTGG - Intergenic
1150168990 17:62971902-62971924 CAATTTTTCCAGAGGGTAGGGGG - Intergenic
1150996183 17:70320283-70320305 CAATTTGGCTAGTGGGCAGTTGG - Intergenic
1157436343 18:47672668-47672690 TAATTTGACTAGAGGGCAGCAGG + Intergenic
1165099456 19:33430231-33430253 CAACTTTTCTAGATGGCACTGGG + Intronic
1166072591 19:40395642-40395664 CAATTTCAACAGAGGGCACTCGG + Exonic
1166865965 19:45837692-45837714 AAATTTTACTTGAAGGAAGTTGG + Intronic
930215845 2:48696371-48696393 CAAGTTTCCCTGAGGGCAGTAGG + Intronic
930807185 2:55502851-55502873 AAATTTGACTAGAAGCCAGTCGG - Intergenic
931636083 2:64341739-64341761 GAACTTTACTGGAAGGCAGTTGG - Intergenic
935419488 2:102852766-102852788 TAATCTTGCCAGAGGGCAGTTGG + Intergenic
936647159 2:114385082-114385104 CTACTTTAGTAGAAGGCAGTTGG + Intergenic
938309710 2:130281016-130281038 CTATATTACTAGAGTGGAGTAGG - Intergenic
938761171 2:134427489-134427511 CGATTTTATTTGAGGGGAGTAGG - Intronic
940534005 2:154915210-154915232 CAAAGTTTCTACAGGGCAGTAGG + Intergenic
941867136 2:170346641-170346663 CACTTTTACTACTGTGCAGTTGG - Intronic
943182970 2:184567327-184567349 AAAGTTTTCTAGAAGGCAGTAGG - Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1174099809 20:48118671-48118693 CAAGCTTTCTAGAGGGCAATTGG - Intergenic
1174148141 20:48466864-48466886 CAACCTTTCTAGAGGGCAATTGG - Intergenic
1177340040 21:19786375-19786397 AAATTATACTAGAGGTCAATGGG + Intergenic
1178118212 21:29439188-29439210 CAGTTTTACTTTAGGGCATTAGG - Intronic
1178884736 21:36476242-36476264 CACTTTTTCTAGATGGCAGAAGG - Intronic
1179106538 21:38405508-38405530 CAATTAGGCTGGAGGGCAGTTGG + Intronic
1181135615 22:20763952-20763974 CTATTTTACTAGAGGGTTGGTGG + Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183116391 22:35695581-35695603 CATTTTTCCTAAAGGGCAGAGGG - Intergenic
949482956 3:4511334-4511356 CAATTTCAATAGAGGGCAAAGGG + Intronic
949948301 3:9207774-9207796 CAATTCTCCAAGAGGGCAGGCGG + Intronic
953356563 3:42261118-42261140 CAATTCTATTGGAGGGCAGTGGG - Intronic
955506252 3:59636118-59636140 CTATTTAGCTAGAAGGCAGTAGG + Intergenic
955764737 3:62330272-62330294 CAATCTAAGTAGAGGGCTGTTGG - Intronic
958987703 3:100801651-100801673 CAATTTTCCTAGAGGCAAGATGG - Intronic
965880173 3:173379792-173379814 CAATTTTGCCAAAGGTCAGTTGG + Intergenic
966739992 3:183223697-183223719 CAAGTTCACTAGAAGACAGTGGG + Intronic
971462978 4:26922684-26922706 CAGTTTTCCTGGAGGTCAGTGGG + Intronic
971761060 4:30765875-30765897 GAGGTTTACTAGAAGGCAGTCGG + Intronic
974211613 4:58783941-58783963 TAATTTTACTAAAGAGCATTTGG + Intergenic
977956819 4:103037334-103037356 CAATTTTACCATAGGCCAATTGG - Intronic
980606929 4:135104422-135104444 CAATTTTTTTAGATGGCAGTAGG - Intergenic
983273166 4:165587219-165587241 TAATTTTACTAGTGGGCTTTTGG - Intergenic
983797948 4:171889098-171889120 AAATTTTAATAGATGTCAGTAGG + Intronic
984689480 4:182708947-182708969 ACATTTTACTAGAAAGCAGTGGG + Intronic
988461735 5:31445002-31445024 CAATTTTTGTGGAGGCCAGTGGG + Intronic
989537792 5:42583444-42583466 CACTTCCACTAGAGGGCAGCAGG - Intronic
990206071 5:53430829-53430851 GAATTCCACTAGAGGGCAGTTGG - Intergenic
993073841 5:83201382-83201404 GCATTTTACTAGGGGCCAGTGGG - Intronic
997831141 5:137151104-137151126 CTATTTTACCAGATGGTAGTAGG + Intronic
998055043 5:139067531-139067553 CAATATTACTAGAGACCAGCTGG + Intronic
1002837237 6:875147-875169 CACCTTTTCTAGAGTGCAGTGGG - Intergenic
1002873844 6:1192600-1192622 TAATCTTCCTGGAGGGCAGTTGG + Intergenic
1004210534 6:13637564-13637586 TAACTTTACTAGAGGGAAGAAGG + Intronic
1007952020 6:45880955-45880977 TAATTTTACTAGAGGGAATGGGG + Intergenic
1009524996 6:64732600-64732622 CAATTTTACTATACGCCACTAGG - Intronic
1011134187 6:84081908-84081930 CAATTTTAGTGGAAGGCAGAGGG - Intronic
1012133637 6:95527549-95527571 CAATTTTCCTACAGGTAAGTTGG - Intergenic
1020799780 7:12719279-12719301 CAATTTTCAGAGAAGGCAGTTGG + Intergenic
1021377595 7:19927125-19927147 CAGGTTTACTAGAGGCAAGTAGG + Intergenic
1022616351 7:31934746-31934768 AAATTTTACTCAAGGTCAGTTGG + Intronic
1028649666 7:93137616-93137638 CAATTTTTCCACAGGGTAGTGGG - Intronic
1029012304 7:97274493-97274515 TATTTTTAGTAGAGGGCAGTGGG + Intergenic
1029025401 7:97411964-97411986 CAATATTCCAAGAGGGAAGTGGG + Intergenic
1032885098 7:136128988-136129010 CAATTTTATTAGCCTGCAGTTGG + Intergenic
1033243943 7:139703143-139703165 CAATTTCCCTAGAGGTCATTAGG + Intronic
1033647597 7:143317215-143317237 GAATTTGTCTAGAGGGCAGTTGG + Intronic
1038212427 8:25531978-25532000 CATTTTTACTAGAGTGAATTGGG - Intergenic
1038630415 8:29237938-29237960 TAATTTTATTAGAGTACAGTGGG - Intronic
1042274641 8:66991542-66991564 CAATTTTACTGGGGAGAAGTGGG + Intronic
1043450961 8:80366252-80366274 TAATTTTACTAAAGGGCAAATGG + Intergenic
1047507052 8:125488260-125488282 CCATTTTACCAAAGGGCAGACGG - Intergenic
1050285635 9:4099027-4099049 CACTTTGTCTTGAGGGCAGTGGG - Intronic
1051009013 9:12387258-12387280 CAGTTTGACCAGAGGCCAGTGGG - Intergenic
1051627862 9:19115196-19115218 AAATTTTACTAGGTGACAGTTGG - Intronic
1056426647 9:86484160-86484182 CACTTTTGCTAATGGGCAGTGGG + Intergenic
1057421634 9:94917654-94917676 CAGTGATACTATAGGGCAGTGGG - Intronic
1058566233 9:106288150-106288172 GACTTTTACTACAGGGCAGAAGG + Intergenic
1186748637 X:12597789-12597811 AAATTTTACTATAGGTCTGTTGG + Intronic
1186791028 X:12998900-12998922 AAATTTTTTTAGAGGGCAGTAGG + Intergenic
1190895864 X:54617391-54617413 CAATTATAGTAGAGGGCAGAGGG - Intergenic
1193971751 X:88063778-88063800 GAAAATTACTAGAGGGAAGTGGG + Intergenic
1197291375 X:124662522-124662544 TAATTTGACAAAAGGGCAGTTGG - Intronic
1201695691 Y:16822794-16822816 CAATGTGACTTGAGGGGAGTAGG - Intergenic