ID: 1170857867

View in Genome Browser
Species Human (GRCh38)
Location 20:20074092-20074114
Sequence TTGTGAGTAAGGAGGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 309}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170857863_1170857867 -6 Left 1170857863 20:20074075-20074097 CCTGTTTCCTTAAATAATTGTGA No data
Right 1170857867 20:20074092-20074114 TTGTGAGTAAGGAGGACAGAAGG 0: 1
1: 0
2: 1
3: 34
4: 309
1170857862_1170857867 -5 Left 1170857862 20:20074074-20074096 CCCTGTTTCCTTAAATAATTGTG 0: 1
1: 0
2: 1
3: 27
4: 357
Right 1170857867 20:20074092-20074114 TTGTGAGTAAGGAGGACAGAAGG 0: 1
1: 0
2: 1
3: 34
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170857867 Original CRISPR TTGTGAGTAAGGAGGACAGA AGG Intronic
901167308 1:7229693-7229715 CTGTGAGCCAGGAGCACAGAGGG + Intronic
904081293 1:27873906-27873928 GGGTGAGTGCGGAGGACAGATGG + Intronic
906106732 1:43299162-43299184 TTGAGAGTGGGGAGGGCAGATGG + Intergenic
906343961 1:45003795-45003817 GTGTGGGGAGGGAGGACAGAAGG + Intronic
906647539 1:47486502-47486524 GTGTGAGTGAGGAGGAGGGAGGG + Intergenic
906974895 1:50559747-50559769 TTGTGAAGAGGGAGGAGAGAAGG - Intronic
907560003 1:55379555-55379577 TGGTGAGGAAGGAGGGCAAAGGG - Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908906437 1:69017295-69017317 TTGGGAATAAGGAGAAGAGAAGG - Intergenic
910934602 1:92477111-92477133 TTTTTAGCAAGGAGGACAGAGGG - Intronic
911540832 1:99156363-99156385 ATTTGAGCAAGGAGAACAGATGG - Intergenic
913072017 1:115307957-115307979 TTGTGAGTAGAAAGGACACAAGG + Intronic
913100412 1:115558913-115558935 TAGTGAGTAAGTAGAAAAGAGGG - Intergenic
916290558 1:163161646-163161668 ATGCAAGTAAGCAGGACAGATGG + Intronic
916378309 1:164180333-164180355 TTCTGAGTAAAGAGGACAGCAGG + Intergenic
918586766 1:186197169-186197191 CAGAGAGTAAGGAGGACAAAAGG + Intergenic
919587487 1:199456864-199456886 CTGGGAGTAAGGAGGAGAGCAGG + Intergenic
919724816 1:200874614-200874636 TTGTGAGTGAGAAGGGCAGGGGG - Intergenic
919727802 1:200895206-200895228 TGGTGTGTAGGGATGACAGAGGG + Intronic
919825122 1:201498182-201498204 TAGTGAGTGTGGAGAACAGATGG + Intronic
920267329 1:204733811-204733833 TTTGGAGTAAAGAGGGCAGAGGG + Intergenic
920394811 1:205637166-205637188 TTGAGAGTTAGGAGGAAAGCTGG - Intergenic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
922152397 1:223017371-223017393 TTGTGAGAAAGTAGGGGAGAGGG - Intergenic
922272612 1:224048012-224048034 CCGGGAGTTAGGAGGACAGAGGG + Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922974031 1:229768866-229768888 TTGTGTGAAATGAGGACAGGTGG + Intergenic
923258051 1:232238941-232238963 TTGAGAGGCAGGAGGAAAGAAGG + Intergenic
924089951 1:240492043-240492065 TTCGGAGTAAGGATGACAGCAGG - Exonic
924928119 1:248703269-248703291 TAGTGAGCAAGGAGGACAGCTGG - Intergenic
1063356043 10:5399328-5399350 TTGTGAGTAATTAGGTCATAAGG + Intronic
1063495967 10:6508645-6508667 TTGTGAATAAGGAGTAAAGATGG + Intronic
1063665406 10:8057834-8057856 CTGTGAGTGAGGAGGCCTGAAGG - Intronic
1063823771 10:9869561-9869583 TTGACAGTATGGGGGACAGATGG + Intergenic
1064298586 10:14101518-14101540 TTTTGAGATAGGAGGAGAGAGGG + Intronic
1065341730 10:24713104-24713126 TTGTGAGTAAGGAGAAAATCAGG + Intronic
1065890285 10:30115532-30115554 TAGTCAGTAGGGAGGAGAGATGG + Intergenic
1066725314 10:38385931-38385953 TTGTGGGGATGGAAGACAGAGGG - Intergenic
1067300689 10:45006060-45006082 GTGTGTGGAAGGAGGAAAGAGGG + Intergenic
1067517812 10:46968553-46968575 AACTGAGTGAGGAGGACAGAAGG - Intronic
1067644438 10:48083276-48083298 AACTGAGTGAGGAGGACAGAAGG + Intergenic
1070503100 10:77089960-77089982 TTAAGAGGAAGCAGGACAGAAGG - Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1074240662 10:111635510-111635532 TTGTGTGAAAGGAGGTCAGTAGG - Intergenic
1074359936 10:112817596-112817618 TTGTGAGGAAGCTGGTCAGAAGG + Exonic
1074405659 10:113178375-113178397 TTGTGAGAAAGAGGGAGAGAAGG + Intergenic
1074483774 10:113853960-113853982 TTTTGAGTCAGGTGGACAGAGGG - Exonic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1078118910 11:8486111-8486133 TTGAGAGTATGGAGATCAGATGG - Intronic
1079574724 11:21989304-21989326 CAGTGAGTAGGGAGGACAAAAGG - Intergenic
1082757399 11:57091745-57091767 TGGTGAGGAAGGAGGAAGGATGG - Intergenic
1083465416 11:62842383-62842405 TTGTGAGAACTGAGGACATAGGG + Intergenic
1085730365 11:78992697-78992719 TTGTGAGTAGGAAGTAGAGAAGG + Intronic
1085744652 11:79104335-79104357 TTCTGAGTAGTGAGGACACAGGG - Intronic
1087306898 11:96499530-96499552 ATGTGAGTAATCAGGACAGGAGG - Intronic
1088499815 11:110472359-110472381 TTGAGAGGAAGGAGGACTGGAGG + Intergenic
1090251240 11:125253423-125253445 GTGTGAGTGAGGAGGAGAGGAGG + Intronic
1090403122 11:126461465-126461487 TTGTGAATGAGGATGCCAGAAGG + Intronic
1090991314 11:131819415-131819437 ATGTGAGTGAGCAGGACAGTAGG - Intronic
1093090311 12:14913093-14913115 TTGTGAGTATGGGGGAAAGATGG + Intergenic
1095254354 12:40017056-40017078 TGATGACTAAGTAGGACAGAGGG + Intronic
1096918862 12:55062500-55062522 TTGTTAGTAAGGGGAACAGCTGG - Intergenic
1097169585 12:57105340-57105362 CTGGGAGTGAGGAGGACACAAGG + Intronic
1098230031 12:68363846-68363868 GTGAGAGAAGGGAGGACAGATGG - Intergenic
1099224179 12:79949414-79949436 TAGAGAGGAAGGAGGACAGAGGG - Intergenic
1099362921 12:81728869-81728891 TTGAGAGATAGGTGGACAGATGG + Intronic
1099905946 12:88770072-88770094 TATTGATTAAGGAAGACAGAAGG + Intergenic
1100406250 12:94275134-94275156 TTCTGAGTAGGGAGGACAGTGGG - Intronic
1103660006 12:122506636-122506658 GTGTGTGTAGGGAGGACAGTGGG + Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1106606567 13:31234527-31234549 TTCAGGGTAAGGAGGACAGCAGG + Intronic
1106940900 13:34778114-34778136 TGGTGAGTCAGCAGTACAGAGGG - Intergenic
1107401815 13:40076839-40076861 TTGTGATTGAGGTGGACAAAAGG - Intergenic
1108475045 13:50807673-50807695 TTATGAGTAAAGAGGTGAGAAGG - Intronic
1108748061 13:53415760-53415782 TGGTGAGGAAGGATGAGAGATGG + Intergenic
1109053869 13:57520264-57520286 TTGTAAGCAAGGAGGAGACAGGG + Intergenic
1109095664 13:58112259-58112281 TTTTCAGTAAGGTGGAGAGAAGG + Intergenic
1109609446 13:64744141-64744163 TTGTGAAGATGGGGGACAGAGGG - Intergenic
1110511179 13:76352971-76352993 ATGAGAGAAAGGAGCACAGAAGG - Intergenic
1110610431 13:77481459-77481481 ATGTGAGTAGAAAGGACAGATGG + Intergenic
1111914576 13:94347668-94347690 TAGTGAGTAAGGAAAACAAAAGG - Intronic
1113541296 13:111111906-111111928 TTGGGAGAAAGGGAGACAGAGGG + Intergenic
1113941742 13:114021994-114022016 TTGTGGGCAAAGGGGACAGATGG - Intronic
1116146967 14:41086494-41086516 TTTAGAGTAAGGTGGACAAAGGG - Intergenic
1116371063 14:44132921-44132943 ATGCGCGGAAGGAGGACAGAGGG + Intergenic
1117099362 14:52331007-52331029 ATGTGTGTAAAGAGGTCAGAGGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117222946 14:53624701-53624723 TTCGGAGTAAGGAGGGCAGTAGG + Intergenic
1117761055 14:59028993-59029015 TTCTGAGCAGGGAAGACAGAAGG + Intergenic
1118191365 14:63583566-63583588 TGTTGAGAAAGTAGGACAGATGG - Intergenic
1120216526 14:81686567-81686589 CTGTTAGTAAGGAAAACAGAAGG + Intergenic
1120253178 14:82085227-82085249 TTGTGAGTAGGGATGCCTGAGGG + Intergenic
1121493897 14:94378821-94378843 TTGTCAGGAAGATGGACAGAGGG - Intronic
1122163396 14:99802681-99802703 TTGTGGGGTAGGAGGACATATGG + Intronic
1122276838 14:100594984-100595006 TGGTGAGGAAGGAGCCCAGATGG - Intergenic
1122440273 14:101727029-101727051 TTGGGAGTAAGGAGGCCTGGAGG - Intergenic
1124614426 15:31231285-31231307 ATGTGAGTGAGGGGAACAGATGG + Intergenic
1124879813 15:33631529-33631551 TTTTGAGCCAGGAGGTCAGATGG + Intronic
1125245845 15:37638169-37638191 TTGTGATTCAGGAGGACAATGGG - Intergenic
1125673704 15:41491366-41491388 ATGTGAATGAGGAGGATAGATGG + Intergenic
1127264436 15:57350107-57350129 AGTTGAGTAAGAAGGACAGAGGG - Intergenic
1128369523 15:67030180-67030202 TTGTCATTAAGGCTGACAGAGGG - Intergenic
1128523352 15:68390207-68390229 TTGTGAGTGAGGTGGGAAGAAGG + Intronic
1128670541 15:69571674-69571696 TTGTGAGTAGTGGTGACAGAGGG + Intergenic
1128916963 15:71571810-71571832 TTGTCATGAAGGAGGACAGATGG - Intronic
1129256913 15:74338943-74338965 TGGTGGGTAAGGATTACAGAGGG - Intronic
1129582253 15:76824359-76824381 TTGTGTGTCAGGAGGACAAAGGG - Intronic
1129772278 15:78209863-78209885 TTGTGAGGAAGCAGTTCAGATGG - Intronic
1131665169 15:94563549-94563571 TTATGATAAAGGAGGAGAGAAGG + Intergenic
1132000324 15:98172960-98172982 TTGAGAGGAAGCAGGAGAGAAGG - Intergenic
1132057276 15:98661901-98661923 TTGTGGGGAAGGAGGACTGGAGG - Intronic
1133492108 16:6280278-6280300 TTGTGAGAAGCGAGGACGGAGGG - Intronic
1135882338 16:26270093-26270115 TTTTGCGTAATGAGGACATACGG + Intergenic
1136043127 16:27595972-27595994 TGGTGGGAGAGGAGGACAGAGGG + Intronic
1136999342 16:35215914-35215936 TTGTGTGGAAGATGGACAGAGGG + Intergenic
1137445611 16:48530092-48530114 TGGGGAGCTAGGAGGACAGAAGG - Intergenic
1140781989 16:78305340-78305362 TTGTGAGCAAGGAGGCCGGAGGG - Intronic
1143171363 17:4932468-4932490 ATGGGAGTAGGGAGGACAGGAGG + Intronic
1143506606 17:7369319-7369341 TGGTCAGTGAGAAGGACAGAAGG + Intergenic
1143739611 17:8942541-8942563 GTGGGAGGAAGGAAGACAGAGGG + Intronic
1143765235 17:9133397-9133419 CTGGGAGCAAGGAGGAGAGATGG - Intronic
1145043892 17:19597057-19597079 GTGTGAGTTGGGAGGGCAGAAGG + Intergenic
1147506406 17:41021853-41021875 TTGTGGGTCAGGAGTACAGCAGG - Intergenic
1148384990 17:47228002-47228024 GTGTGAGTAAGTGGGCCAGAAGG + Intergenic
1149100185 17:52896447-52896469 TTGTAAGTGAAGAGCACAGAAGG - Intronic
1149752823 17:59162546-59162568 TTGGGAGTCAGGATTACAGAGGG - Intronic
1150244103 17:63660935-63660957 TTGTGAGGAATGAAGACAGAAGG - Intronic
1150288429 17:63967076-63967098 GTGTGATGAAGGAGGACAGGGGG + Intronic
1152052272 17:77989838-77989860 TTGAGAGTAAACAGGAAAGAGGG - Intergenic
1153345850 18:4025022-4025044 ATGGGAGGCAGGAGGACAGAGGG - Intronic
1153474266 18:5480891-5480913 TTCAGAGTAAAGAGGAAAGAAGG + Intronic
1155276193 18:24189829-24189851 CTGTGAGGACTGAGGACAGAAGG - Intronic
1157319423 18:46622892-46622914 TTGAGAGTAAGGAGCAGAAATGG + Intronic
1158683989 18:59596214-59596236 TTGGCAGCAAGGAGGACACAGGG + Intronic
1159484125 18:69031409-69031431 TTGTAAGTAAGGAGAACACAAGG - Intronic
1159973768 18:74685441-74685463 TGCTGAGGAGGGAGGACAGAGGG - Intronic
1160113052 18:76052107-76052129 TTGTGAGTGAGCAGGAGGGAAGG - Intergenic
1160244396 18:77145497-77145519 CTCTGAGGAAGCAGGACAGATGG - Intergenic
1160313329 18:77818427-77818449 TTGAGAGAAAGAAGGAAAGATGG - Intergenic
1160505028 18:79422332-79422354 CTGTGAGTAATAATGACAGATGG + Intronic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1160847938 19:1174539-1174561 TTCTGAGGAAGGAGGAAAAAAGG - Intergenic
1162156387 19:8680934-8680956 GAGTGAGTAAGGGGGAGAGAGGG + Intergenic
1163319247 19:16563368-16563390 CTGTGTGTAATAAGGACAGAGGG + Intronic
1163625940 19:18389695-18389717 TTTTGAGGAATGAGGAAAGATGG - Intergenic
1164851970 19:31491473-31491495 TTCCGAGTAAGTAGGACTGAGGG - Intergenic
1164921967 19:32095054-32095076 TTGGAAGTAAGGAGGAGAGCTGG + Intergenic
1166320518 19:42015771-42015793 TTGCCAGGAGGGAGGACAGAGGG - Intronic
925281833 2:2690419-2690441 GTGTGAGTAGGGAGGAGAGAGGG - Intergenic
925923571 2:8654434-8654456 TTGTGAGTAAGGAGTGCATAAGG + Intergenic
927635681 2:24814603-24814625 GTGTGAGTGATGAGGGCAGAGGG - Intronic
928939507 2:36713384-36713406 TCGTGAGAAATGAGAACAGAAGG + Intronic
929947511 2:46381952-46381974 CTGGGAGTAAGAAGGGCAGATGG - Intronic
929950137 2:46403496-46403518 TTGTGACAAAGACGGACAGAAGG + Intergenic
930089781 2:47523362-47523384 GTGTGAGCAAGGATGACTGATGG - Intronic
932175792 2:69600322-69600344 TTGTGAATAAAGAGGAAAAAAGG + Intronic
933091809 2:78129197-78129219 TTTTGAGGAAGTAGGATAGATGG - Intergenic
933486871 2:82935325-82935347 TAATGAGTAAGGAGGGCAGCTGG - Intergenic
933529157 2:83484165-83484187 TTGTGTGTAAGAAGTAAAGAAGG - Intergenic
935419175 2:102848931-102848953 TTGTGAGGAAGCAGGAAAGGGGG - Intergenic
935625592 2:105169832-105169854 TAGTGAGCAAGGGGGACTGATGG + Intergenic
936629743 2:114189394-114189416 TTGTGAGAATGAAGCACAGATGG + Intergenic
937226393 2:120372354-120372376 TTGAGAGAAAGCAGGAGAGAGGG + Intergenic
937395763 2:121533250-121533272 GTGTCAGCCAGGAGGACAGAAGG + Intronic
938181633 2:129189886-129189908 GTGTGAGGCAGGGGGACAGAGGG + Intergenic
938570318 2:132556768-132556790 TTGTGCTTAATTAGGACAGAAGG - Intronic
939962549 2:148578217-148578239 CTGTGAGTAAAGAGGTCAGTAGG - Intergenic
940589932 2:155710077-155710099 TTTGGGGTAAGGAAGACAGAGGG + Intergenic
940683032 2:156810036-156810058 CTGTGGATAAGGAGGACATACGG - Intergenic
941254807 2:163215080-163215102 TTGTGGGTACTGATGACAGAAGG + Intergenic
944860237 2:203809396-203809418 GTGAGAATAAGGAGGCCAGAAGG + Intergenic
945962217 2:216147309-216147331 TTGTGAGTGAGGAGAACAAGTGG + Intronic
946644839 2:221822183-221822205 TTGATAGTAAAGAGGACTGAGGG - Intergenic
947011249 2:225569419-225569441 TTGAGAGAAAGGAGGAGTGAGGG + Intronic
947339648 2:229124290-229124312 TTGTGGGAAGGCAGGACAGATGG - Intronic
947339669 2:229124524-229124546 TTGTGATTAGGGAGAACTGAGGG - Intronic
947871005 2:233438006-233438028 TTGTGAATGTGGAGGTCAGATGG + Intronic
948563262 2:238867771-238867793 TGGTGAGTTAGGAGGCCAGGAGG + Intronic
1169104635 20:2984220-2984242 ATGTGAGTGAGGTGGACAGATGG - Intronic
1170743939 20:19081677-19081699 TAGGGAGTAAGGGGGTCAGATGG - Intergenic
1170857867 20:20074092-20074114 TTGTGAGTAAGGAGGACAGAAGG + Intronic
1170953108 20:20954590-20954612 TTGTGAGGTAGGAGATCAGAGGG - Intergenic
1172323350 20:34015175-34015197 TTCTGAATAAGGGGGACAGGTGG - Intronic
1172768926 20:37366252-37366274 GTGAGAGTGAGGAGAACAGAGGG - Intronic
1173047118 20:39523139-39523161 TTATGAGTCAAGAGGACAGTTGG - Intergenic
1173682806 20:44898199-44898221 TTGTGAGTGAAGATGTCAGATGG + Intronic
1174772718 20:53316185-53316207 TTGTGAGTGGGGATGACTGAGGG - Intronic
1175010514 20:55729830-55729852 TTGTGGGTGAGGAGGAGACAAGG + Intergenic
1175689203 20:61053440-61053462 ATGTCAGGAAGGAGGACGGAAGG + Intergenic
1178685521 21:34707722-34707744 TTGTGAATACGGAGCACAAAGGG - Intronic
1179271561 21:39855344-39855366 TTTTGAGTATGGAAGACAAATGG + Intergenic
1180729380 22:17970186-17970208 TGGTGAGAAGGGAGGACAGATGG + Intronic
1181844891 22:25699157-25699179 TTGTGAGGAAGTAGAACAGGTGG - Intronic
1184924195 22:47625930-47625952 GTGGGAGTATGGAGGGCAGAGGG - Intergenic
950141815 3:10620924-10620946 CTGTGAGTGAGGAGGACACAGGG - Intronic
951245847 3:20340860-20340882 TTGGGAGGATGGAAGACAGAAGG - Intergenic
952531460 3:34266450-34266472 TTGGGAGAAAGGAGGGAAGAAGG - Intergenic
952917035 3:38254451-38254473 TTGGGAGTTAGGAGGAGAGTAGG + Exonic
953127029 3:40101017-40101039 TGGTGTGTAAGGAGCACAGATGG - Intronic
953617707 3:44507020-44507042 GTGTAAGTAAGGAGGACACTGGG + Intronic
954879077 3:53821812-53821834 CTGTGAGTCAGGAGAACAGCTGG - Intronic
955271921 3:57508757-57508779 TTGTGAGTAAGGCAGAGTGATGG + Intronic
955463955 3:59216631-59216653 CAGTGACTAAGGAGGTCAGAGGG - Intergenic
956946801 3:74232504-74232526 GAGTGAGTAAGGAGGAGGGAAGG + Intergenic
957767119 3:84639556-84639578 GTGTGAGTAAGGAGAGCATATGG - Intergenic
958021171 3:87998052-87998074 TTGGGACCAAGGAGGACAGTGGG - Intergenic
959567202 3:107844610-107844632 TTCTGAGGGAGGAGGACAAAGGG - Intergenic
960077780 3:113507422-113507444 TTGGGAGTAAGGGGGTCAGCTGG - Intronic
960134606 3:114092557-114092579 TTGTGAGGAATGAGAACAAAAGG - Intergenic
960156121 3:114298575-114298597 TCTGGAGTAAAGAGGACAGATGG - Intronic
963352029 3:144163755-144163777 TCGTGAGGAAGGAGTACACATGG - Intergenic
963609620 3:147450094-147450116 TTGTCACTATGGAGGACAAATGG - Intronic
966716918 3:183021970-183021992 TTGTGGGGAAGGTGGACAGTAGG - Intronic
969206454 4:5650844-5650866 TTTTGAGACAGTAGGACAGATGG - Intronic
970430855 4:15987774-15987796 TTGTGGGAAGGGAGGACACAAGG - Intronic
971828453 4:31659083-31659105 TTGTTAGCCAGGAGGACAGAAGG + Intergenic
974025724 4:56731748-56731770 TTGAGAGTTAGGAGGACAAGGGG - Intergenic
974390421 4:61259678-61259700 GTGTGAGAAAGGAGGAAAGCAGG + Intronic
974806633 4:66889011-66889033 TTGCTAGTAAAGAGGACAGAAGG - Intergenic
974940239 4:68459206-68459228 TTGTGAGTAATGTGGAAAGGTGG + Intronic
975119575 4:70713810-70713832 TTTTGAGGAAGGAAGAGAGATGG - Intronic
975371991 4:73599758-73599780 TTCTGAGCAAAGAGGAGAGATGG - Intronic
975811211 4:78171792-78171814 ATGTGAGGAGGGAGGAAAGAAGG - Intronic
976847803 4:89510312-89510334 TTGTGAGGAAGGAGAAGAAATGG + Intergenic
977707165 4:100085139-100085161 TTTTGAGTCAGAAGGATAGATGG + Intergenic
979404106 4:120287768-120287790 TTGTGAGAAAGGACTACTGATGG - Intergenic
979466337 4:121042829-121042851 TTGTGTGAAATGAGAACAGAAGG - Intronic
979558171 4:122074652-122074674 TTGAGAGTGAGGAGGACAAAAGG + Intergenic
979607073 4:122650015-122650037 CTGTAAGTAAGTAGGACAGTTGG - Intergenic
980069555 4:128229056-128229078 TGTTAATTAAGGAGGACAGATGG - Intergenic
981365920 4:143903027-143903049 TTCTGGGAAAAGAGGACAGAAGG - Intronic
981386550 4:144138199-144138221 TTCTGGGAAAAGAGGACAGAAGG - Intronic
981464472 4:145052102-145052124 CTGGGAGTAAGGGGGACAGTTGG + Intronic
981467383 4:145088884-145088906 CAGTGAGTAAGGAGGAGAAATGG - Intronic
981913522 4:150009306-150009328 TTAGGAGAGAGGAGGACAGATGG + Intergenic
982236314 4:153254077-153254099 GTGTGACTAGGGAGGACAGAAGG + Intronic
982398820 4:154943259-154943281 TTGTGAGTCAAAAGCACAGAAGG - Intergenic
983672490 4:170254412-170254434 GAGGGAGTAAGGAGGACAGAAGG - Intergenic
983976220 4:173937233-173937255 TTGTGTGTCAGGAGGTAAGAAGG - Intergenic
984094099 4:175412536-175412558 TTATGAGTAATGAGAAAAGAAGG - Intergenic
984607599 4:181803632-181803654 TAGTGAGCATGGAGGTCAGAGGG + Intergenic
988414264 5:30926213-30926235 TTGTGAGGAAGTAGGGAAGAGGG - Intergenic
988591018 5:32549576-32549598 TTGAGAGGAAGGAGGAATGAGGG - Intronic
990526676 5:56634995-56635017 ATGTGAGTAGGGAGTACAAAAGG + Intergenic
990561747 5:56990506-56990528 GTGAGAGGAAGGAGGAAAGAAGG - Intergenic
992575647 5:78108261-78108283 TTATGAGTAATGAAGGCAGATGG - Intronic
992872761 5:81023068-81023090 TTGTGAGTGCGGAGGGTAGAGGG + Intronic
996339089 5:122416382-122416404 GGCTGAGGAAGGAGGACAGAAGG - Intronic
996605625 5:125318013-125318035 TTGTGACTAATGTGAACAGATGG + Intergenic
996848282 5:127924894-127924916 TTGTGAGATAGGAGTAAAGAGGG - Intergenic
997744096 5:136283644-136283666 TTGTGAGAAAGGAGGTGAAAAGG + Intronic
1000724248 5:164749317-164749339 CTCTGAGTAAGGAGGAGAGAAGG - Intergenic
1001549913 5:172595315-172595337 TTGAGAGGCAGAAGGACAGATGG + Intergenic
1003336030 6:5173171-5173193 TTGAAAGAAAGAAGGACAGATGG - Intronic
1003436318 6:6091731-6091753 GTGTGAGTGAGGAGCTCAGATGG + Intergenic
1004383582 6:15153023-15153045 TTCAGAGAAAGGAGGGCAGAGGG - Intergenic
1005563803 6:27068708-27068730 TAGTGAGGAATGAGGACTGAAGG + Intergenic
1008810266 6:55488139-55488161 TTTTGGGCTAGGAGGACAGAGGG + Intronic
1010371124 6:75108515-75108537 TTGTGAGTAATGGGGTCAGCTGG + Intronic
1011439404 6:87371541-87371563 TTAAGAGTAAGGCAGACAGATGG - Intronic
1012053880 6:94380142-94380164 TTGTGAACAAGCAGGAAAGATGG - Intergenic
1012488833 6:99754862-99754884 TTGTGAGTAAAAATCACAGAAGG + Intergenic
1015182554 6:130376524-130376546 TTGTGAGTCCCAAGGACAGATGG - Intronic
1016013780 6:139164164-139164186 CTGGAAGTAAGGAGGCCAGAGGG - Intronic
1018078660 6:160239620-160239642 ATGGCAGGAAGGAGGACAGAGGG + Intronic
1018964476 6:168473841-168473863 GTGTGAGGAAGGAGGGCAGGGGG + Intronic
1020621164 7:10520977-10520999 TTGTGTGTTGGAAGGACAGAAGG + Intergenic
1023279592 7:38555965-38555987 TTGTGGGGAAGGAGGAGGGAAGG + Intronic
1023394008 7:39735534-39735556 TTGGGAATAGTGAGGACAGAGGG - Intergenic
1023488288 7:40710430-40710452 TGGTGAGTAAGGGGCACTGAGGG + Intronic
1024191968 7:47021394-47021416 GTGTGAGTAAGGAGAAGATAGGG + Intergenic
1024405108 7:48970016-48970038 TTCTGAGTATGGAGTATAGAGGG - Intergenic
1027127269 7:75565665-75565687 GTGAGAGTTGGGAGGACAGAGGG - Intronic
1027509186 7:79057833-79057855 TTATGAGAAAGGAAGAAAGATGG + Intronic
1027725644 7:81802185-81802207 TTAGGGGTAAGGAGGAGAGAAGG + Intergenic
1028897585 7:96059736-96059758 CTGTGAAGATGGAGGACAGAGGG + Intronic
1029274708 7:99397235-99397257 TGGTGAGGAGGCAGGACAGATGG + Intronic
1030000525 7:105054974-105054996 TTGTGAGTGAGGATGATGGAAGG + Intronic
1032277599 7:130473195-130473217 TTGTGAAAAAGGAAGACAGATGG + Intergenic
1032720885 7:134550118-134550140 AGGTGAGTAAGGAGGTCAGCAGG - Intronic
1034750462 7:153563538-153563560 TTATTATTAAGGAGGAAAGAGGG + Intergenic
1034955841 7:155334119-155334141 CTGAGAGTAATGAGGACTGAGGG - Intergenic
1035044072 7:155952650-155952672 TAGTGAGTAAGGAGCCCAGGAGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035964577 8:4176473-4176495 TAGTGAGTGAGGAGGTTAGAAGG - Intronic
1037870096 8:22486216-22486238 TTGTTTGTAAGGAAGACAGAGGG - Intronic
1038119567 8:24597613-24597635 TTGTGAGTTAGGAAGACATACGG - Intergenic
1039141993 8:34400954-34400976 TTGGGAGGAAGGTGGACAAAAGG - Intergenic
1039720473 8:40158934-40158956 TTGTGTGTAAGGAGTACAGAGGG - Intergenic
1041320985 8:56612266-56612288 TGGTGAGTGTGGAGGACACAGGG + Intergenic
1041521536 8:58762207-58762229 ATGTAAATAAGGAGGACTGACGG - Intergenic
1042497607 8:69472254-69472276 TGGTGAGCCAGGAGGAAAGAAGG - Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043141967 8:76602013-76602035 TAGTGACTAAGGAGGAGAGATGG + Intergenic
1043914015 8:85899096-85899118 GTGGGAGTAAGGATGGCAGATGG - Intergenic
1044450374 8:92329335-92329357 ATGGTGGTAAGGAGGACAGATGG - Intergenic
1044458913 8:92421817-92421839 TTGTGAGAGATGAGGTCAGAAGG - Intergenic
1047025693 8:120821431-120821453 TTGCTACTAAGGAAGACAGAAGG + Intergenic
1047164415 8:122421193-122421215 TTGGGGGCAGGGAGGACAGAGGG + Intergenic
1047497999 8:125422275-125422297 ATGTGAGGAGGGAGGAGAGAGGG + Intergenic
1048047793 8:130789849-130789871 TTCTGAGTCAGTAGGACTGAAGG - Intronic
1049659154 8:143811950-143811972 TTGTCTGTAGGGAAGACAGATGG - Intronic
1049674858 8:143884904-143884926 TGGTGAGTGAGGGGGGCAGATGG - Intergenic
1050159164 9:2699054-2699076 TTGGGAGGAAGGAAGACACAGGG - Intergenic
1050467271 9:5940689-5940711 TTGGGGGTAGGGAGGACAAATGG + Intronic
1050493478 9:6214653-6214675 TTGTGAGTAATGAAGAAAGATGG - Intergenic
1052228647 9:26120359-26120381 TGGTGAACAAGGAGGAGAGAAGG + Intergenic
1053595026 9:39551818-39551840 TAGTGAGAAAAGAGGAAAGAGGG - Intergenic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053852808 9:42306846-42306868 TAGTGAGAAAAGAGGAAAGAGGG - Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053861322 9:42388899-42388921 TTGTCAGGACGGAGGACACAGGG - Intergenic
1055726957 9:79240727-79240749 TTATGAATAAGGAGGACTGCAGG + Intergenic
1056381703 9:86062449-86062471 GGGAGAGAAAGGAGGACAGAGGG + Intronic
1057408447 9:94794848-94794870 TTCTGAGTGAGGATGACAGGTGG + Intronic
1057730412 9:97603387-97603409 GTGTGAGTATGAAGGAGAGAGGG - Intronic
1058027713 9:100160760-100160782 TTGGGACTGAGGAAGACAGAAGG - Intronic
1058186556 9:101862193-101862215 AGGTGAGAAAGGAGGACATAGGG - Intergenic
1059326657 9:113507797-113507819 TTCTTGGTAGGGAGGACAGATGG + Intronic
1061412493 9:130429141-130429163 TGGTGAGAAAGGAGGAAAGGCGG - Intronic
1061642839 9:131973205-131973227 TTGTTCATAAGGAGGAAAGAGGG - Intronic
1185511412 X:667703-667725 TTGTGAGGAAAGAGGAAATAGGG - Intergenic
1186347828 X:8712659-8712681 TTGTCAGTGAGATGGACAGATGG - Intronic
1188529223 X:31120346-31120368 TTGTAAGTAAGTAAGAAAGAAGG - Exonic
1189900340 X:45699973-45699995 TTGTGAGTGGGGAGTACAGAAGG + Intergenic
1192749744 X:73977322-73977344 ATGGGAGTAAGAAGGACACAAGG + Intergenic
1193609333 X:83610138-83610160 TTGTGTGTAAGGAGTAAAGAAGG + Intergenic
1196185954 X:112745169-112745191 TTGTGAGCAAGCAGGACAGTGGG - Intergenic
1196757349 X:119169640-119169662 TTATGAATAAAGAGGAGAGAAGG - Intergenic
1200073006 X:153538206-153538228 TTGTGTCTGAGGAGGACTGAGGG - Intronic
1200184168 X:154170849-154170871 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200189821 X:154207977-154207999 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200195574 X:154245786-154245808 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200201227 X:154282907-154282929 TCGTGGGTCAGGAGGAAAGAAGG - Intronic
1201018435 Y:9626840-9626862 GTGTGAGTGAGGATGGCAGAGGG - Intergenic
1201237811 Y:11928483-11928505 TTGGGAGAAAGGATGACACAGGG - Intergenic