ID: 1170861056

View in Genome Browser
Species Human (GRCh38)
Location 20:20104138-20104160
Sequence CCCTTGTCACCAAGTCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170861056 Original CRISPR CCCTTGTCACCAAGTCATCC AGG Intronic
901527866 1:9835515-9835537 CCCTTGTCAACAAGGCTTGCTGG - Intergenic
901731629 1:11284396-11284418 CCCTTATCAACCACTCATCCTGG - Intronic
901775374 1:11557029-11557051 CACTTGTCACCTAGGCTTCCTGG + Intergenic
902131316 1:14263522-14263544 CTCTTGTCATCACGTCAGCCAGG + Intergenic
904042914 1:27594464-27594486 CCCTTGGCACCTGGTCATCCTGG - Intronic
904610997 1:31726295-31726317 CCCCTGGCACCAAGCCAGCCTGG + Intergenic
906876740 1:49547383-49547405 CCATAGTCACCAAAACATCCTGG - Intronic
907637725 1:56153070-56153092 CCCTTCTCATCCAGTCAACCTGG + Intergenic
917916039 1:179703025-179703047 TCCTTGTCACCTAGGCATTCAGG - Intergenic
918109908 1:181446327-181446349 CCCTTGGCACCAAGCAAGCCTGG - Intronic
919448656 1:197743079-197743101 CCCTTGTCAGTCAGTCATCCTGG - Intronic
919470171 1:197968687-197968709 CCCTTGGCACTAATTCATCCTGG - Intergenic
919877841 1:201883505-201883527 CCCTGGTCACCAAGGCTCCCTGG + Exonic
923722325 1:236477570-236477592 CCCTTTCCACGAAGTCTTCCCGG - Intronic
1064670301 10:17707069-17707091 CCCTTTTCACAAACTCATCACGG + Intronic
1064852851 10:19729668-19729690 CAGTTGTCACCAAGTAGTCCAGG + Intronic
1073270023 10:102254850-102254872 CCCTTGTCACAAGGTCATAAAGG - Intronic
1076803225 10:132842437-132842459 CCCTTGTCATCTTGTCTTCCAGG + Intronic
1076979076 11:195763-195785 CCCCTGTAACCAAGTCCTCCAGG - Intronic
1084856770 11:71994270-71994292 CCCTTGTCACCAAACCAACATGG + Intronic
1087534893 11:99430821-99430843 CCCTTTTCACTAAGGCAGCCTGG - Intronic
1090734314 11:129598168-129598190 CACTGGTAACCAAGGCATCCGGG + Intergenic
1092795197 12:12103974-12103996 CCTCTGTCACCCAGTCACCCAGG - Intronic
1093013780 12:14135961-14135983 CCCTTGTCCCCAAGTCCAACAGG + Intergenic
1093519537 12:20032443-20032465 CCCCTTTCACCAACTCATCAAGG + Intergenic
1093524873 12:20093992-20094014 CCCTTTTCACCAAATGATGCTGG + Intergenic
1098023851 12:66182529-66182551 CCATTGTCACCATGTCCTTCAGG + Intergenic
1098729429 12:74014561-74014583 CTCTTGTCACCAAAGCTTCCTGG - Intergenic
1103917610 12:124384129-124384151 GCCCTGCCCCCAAGTCATCCTGG + Intronic
1105615557 13:22008989-22009011 CCCTTGTAACCAGCTCACCCGGG + Intergenic
1111552882 13:89838815-89838837 CCCTTGTCACCAGGTGTGCCAGG + Intergenic
1113816071 13:113172050-113172072 TCCTTGTCACCAAGGTCTCCAGG + Exonic
1114287908 14:21262638-21262660 CCCCTGGCTCCAGGTCATCCTGG + Intronic
1115119785 14:29926811-29926833 TCCTTGTCTCCAGGTCATTCCGG + Intronic
1116315121 14:43376341-43376363 CCCTTGGCATAATGTCATCCAGG - Intergenic
1122838981 14:104445429-104445451 GCCTTGGCACCAAGTCTTCTAGG + Intergenic
1124075409 15:26439179-26439201 TCCTTTGCACCAAGTCATCTAGG + Intergenic
1127404833 15:58631708-58631730 CTCTTCTCCCCAAGTCATCTTGG - Intronic
1128372105 15:67047965-67047987 GCATTGTCACCCAGTCACCCAGG - Intergenic
1128797611 15:70477097-70477119 CCCTTGTGACTGACTCATCCTGG - Intergenic
1128910486 15:71509321-71509343 CCCTTGTCTCCAAGTCCACAGGG - Intronic
1131090307 15:89619874-89619896 CACTTCTCACCAAGTCAGCACGG - Intronic
1131941076 15:97566067-97566089 CCCATGTCTCCAAGTCAGGCAGG + Intergenic
1132927756 16:2440252-2440274 ACCTGGTCACCAAGTCATCCAGG + Intronic
1135591478 16:23708043-23708065 TCCTTGTCACAAAGTCCTCACGG + Intronic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1141515315 16:84540259-84540281 CCCTTGTCCCCAAGTCCCACAGG + Intronic
1142466566 17:140581-140603 CCCCTGTAACCAAGTCCTCCAGG - Intergenic
1143203648 17:5128948-5128970 CCACTGTCCCCAAGTCAGCCTGG - Exonic
1146547368 17:33750526-33750548 CCCTCGGCACTAAGTCATCTTGG - Intronic
1147632238 17:41939631-41939653 CCAATGTCATCAAGTCCTCCTGG - Intronic
1151534426 17:74730642-74730664 CGCCTGGCACCAGGTCATCCTGG - Intronic
1151616251 17:75214294-75214316 CCCTTATGAACAAGTCATCATGG + Intronic
1159741500 18:72176801-72176823 CCCTTGTTACCAAAACATCAGGG + Intergenic
1163155885 19:15439752-15439774 TCTTTGGCACCAATTCATCCAGG - Intronic
1165420770 19:35720957-35720979 CCCGTGTCATCAAGACACCCCGG + Exonic
1167698349 19:51027705-51027727 CCCTTGTCCCCACGTCATAAGGG - Intronic
1168239769 19:55083234-55083256 CACTTTTCACCAAGTCCTGCCGG - Intronic
1168584475 19:57582021-57582043 CCCTCCTCCCCAAGTTATCCAGG + Intronic
925277712 2:2662222-2662244 GCCTTGGCACCAAGTCTTCTGGG - Intergenic
929262082 2:39876961-39876983 CCCCTGACCTCAAGTCATCCAGG + Intergenic
939392000 2:141580054-141580076 ACCTTGTCACCAAGTTCTTCTGG + Intronic
940157200 2:150670197-150670219 CCCTTTTCAACAAGTGATGCTGG + Intergenic
944287903 2:197973041-197973063 CCCTTGTCCTCAAGTCTTCTTGG + Intronic
948315189 2:237023114-237023136 CCCTTCCCACCAACTCTTCCAGG + Intergenic
1168797613 20:622034-622056 TCCTAGTCTTCAAGTCATCCTGG + Intergenic
1169358600 20:4928505-4928527 TCCCTGACACCAAATCATCCTGG + Intronic
1169840828 20:9935318-9935340 CCCTAGTCACCAAGACAGCAAGG - Intergenic
1169871736 20:10255058-10255080 CCCTTCTCCCCAAGCCATCAGGG + Intronic
1170280094 20:14636607-14636629 GCCTGGTCACCTAGTCAACCTGG - Intronic
1170566941 20:17612880-17612902 CCCTTCTCACAATGTCGTCCTGG + Intergenic
1170861056 20:20104138-20104160 CCCTTGTCACCAAGTCATCCAGG + Intronic
1170936564 20:20815059-20815081 CTCTTGTCAGAAAGTCAGCCAGG + Intergenic
1171180463 20:23087328-23087350 ACCTTCTCAGCAAGTCATCATGG - Intergenic
1176000332 20:62828751-62828773 CCCTTGTCCCCAGGGCATGCCGG + Exonic
1177174039 21:17684726-17684748 CCCTTTTCAACAAATGATCCTGG - Intergenic
1178143885 21:29716524-29716546 CACTTGTGACCAAGTCAGCCTGG - Intronic
1179025363 21:37675006-37675028 CCCCTGTCCCCAAGCCTTCCAGG + Intronic
1182056325 22:27358166-27358188 CCCTTCTCCCAAAGTCAGCCTGG + Intergenic
954629850 3:52041924-52041946 CCCTAGCCACCAAGACCTCCAGG + Intergenic
955212970 3:56959269-56959291 CCCTTGTCACACAGACATGCTGG + Intronic
960777504 3:121274771-121274793 CCCCTGGGACCAAGTCATCATGG - Intronic
960945562 3:122964054-122964076 CCTCTGTCTCCATGTCATCCAGG + Intronic
961355745 3:126339026-126339048 CCCTGCTCTCCAAGCCATCCTGG - Intergenic
962401457 3:135062919-135062941 CCCTTTTCAACAAATCATCCTGG - Intronic
963056436 3:141190094-141190116 CCCTTGTCACCAAAGCACCAAGG + Intergenic
968842878 4:3021082-3021104 CCCTTGTCACCTTGTAAGCCTGG + Intronic
969044398 4:4326309-4326331 GGCTTGCCACCAGGTCATCCTGG - Intergenic
972228599 4:37043863-37043885 CCCTTGATATCCAGTCATCCTGG - Intergenic
972333903 4:38088528-38088550 CCCTTGTCAACAAGGCAGCAAGG + Intronic
981588940 4:146335359-146335381 CCCTTGTCCCCAAGTCAAGCAGG + Intronic
990083456 5:51945236-51945258 CCTTTGACTCCATGTCATCCAGG - Intergenic
990471757 5:56122279-56122301 CCCTGGCCATCAGGTCATCCTGG + Intronic
992294744 5:75316879-75316901 CACCTGTTACCAAGTCATCTGGG + Intergenic
994590274 5:101762307-101762329 CCCTTGGCCCCCAGTGATCCTGG - Intergenic
997235084 5:132268011-132268033 CCCTCCCCACCACGTCATCCTGG - Intronic
1000248355 5:159469175-159469197 CCTTTGTCCCCAGTTCATCCTGG - Intergenic
1001577209 5:172772008-172772030 CCCTTGGCTCCAAGTCTTCCGGG - Intergenic
1002906606 6:1454198-1454220 CCCTTGCGACCTGGTCATCCTGG + Intergenic
1003115428 6:3280840-3280862 CCCTTAACCCCAGGTCATCCTGG + Intronic
1007625906 6:43246300-43246322 CCTTGGTCAGCAAGTCTTCCTGG + Intronic
1008308781 6:49938940-49938962 CCATTGTAACTAAGTTATCCTGG + Intergenic
1011189325 6:84713662-84713684 CCATTGTCACCCTGTAATCCTGG + Intronic
1012496825 6:99842869-99842891 CCCTTGTCCCCAAGTCCTATGGG - Intergenic
1021570937 7:22064744-22064766 CTCTTGTCTCCAAGGAATCCAGG + Intergenic
1022843694 7:34189772-34189794 TACTTGTCAGCAAGACATCCAGG + Intergenic
1023018582 7:35989160-35989182 CCCTGGTCCCAAAGTCATCTTGG + Intergenic
1027162189 7:75811019-75811041 CCCTTGTCCCCAAGACAGCATGG + Intergenic
1028752910 7:94402110-94402132 CCCTTTTCTCAAAGTCATCCAGG + Intronic
1033541286 7:142358281-142358303 CCCTTGACACCAAGGCTGCCAGG - Intergenic
1047765947 8:127990115-127990137 CACCTATCACCAAGTCAGCCTGG + Intergenic
1050630900 9:7557375-7557397 CCGATGTCACCAAGTCACCTAGG + Intergenic
1051806259 9:20995993-20996015 CCATTGTCACCAAGTGGTTCTGG - Intergenic
1052066713 9:24031137-24031159 CCCTGGTCCCCTAGTCAACCAGG - Intergenic
1053052955 9:34976766-34976788 CCCTTGTCACCCAGTATCCCAGG - Intronic
1054090343 9:60839911-60839933 CCCTTGCCTCCAAGTCCTCTGGG + Intergenic
1054111754 9:61115468-61115490 CCCTTGCCTCCAAGTCCTCTGGG + Intergenic
1055499956 9:76893462-76893484 CCCTGATCACCATGTCACCCTGG - Intronic
1056919572 9:90774334-90774356 CCACTGTCCCCAAGGCATCCTGG + Intergenic
1057489486 9:95510395-95510417 CCAGTGTCACCAAGGCATCCCGG + Intronic
1059002878 9:110368163-110368185 CCCATGTCACCACCTCTTCCAGG - Intronic
1059895074 9:118855617-118855639 CACTGGTAACCAAGGCATCCAGG + Intergenic
1062629088 9:137455599-137455621 CCTTAGGCACCAAGTCATACAGG + Intronic
1189588745 X:42489298-42489320 CCCTGGTGACCAAGTCTTCTGGG + Intergenic
1189994731 X:46627553-46627575 ACCTTGTCACCAAGCCCTTCAGG + Intronic
1198423791 X:136495547-136495569 CCCATGTCACCCAGCCATCCTGG - Intergenic
1200568721 Y:4801796-4801818 CCCCTCCCACCAAGTCCTCCAGG + Intergenic