ID: 1170861095

View in Genome Browser
Species Human (GRCh38)
Location 20:20104563-20104585
Sequence ACGTATCTACAGGGTGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170861092_1170861095 -6 Left 1170861092 20:20104546-20104568 CCAAACAGGACTGGAGCACGTAT 0: 1
1: 0
2: 1
3: 2
4: 56
Right 1170861095 20:20104563-20104585 ACGTATCTACAGGGTGTGTTAGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170861095 Original CRISPR ACGTATCTACAGGGTGTGTT AGG Intronic
902994150 1:20210855-20210877 AGGTATCTTCAGGCTGTGTGAGG + Intergenic
905101799 1:35530751-35530773 ATGTATCTACAGTGTTGGTTGGG + Intronic
909240127 1:73202366-73202388 AATTATCTACAAGTTGTGTTAGG + Intergenic
912757795 1:112339072-112339094 ATCTATCTCCAGGGTGTCTTAGG + Intergenic
915096719 1:153468114-153468136 CTGAATCTACAGGTTGTGTTTGG + Intergenic
924673955 1:246156696-246156718 AAATATCTACAAGGTGTTTTGGG + Intronic
1065893848 10:30144011-30144033 ATGTATTAACAGGGTTTGTTGGG + Intergenic
1067300408 10:45002643-45002665 ACTTCTCTACAGGGAGTGGTAGG - Intronic
1080593514 11:33746319-33746341 AAGAATCTACAGTGTGCGTTTGG - Intronic
1081029959 11:38067445-38067467 AGGTATCTACATGGTCTTTTAGG + Intergenic
1083300879 11:61739086-61739108 ACTCAACTCCAGGGTGTGTTTGG + Intronic
1087730546 11:101773704-101773726 ACATGTCTACAGGGTGAGATAGG + Intronic
1088359499 11:108975967-108975989 ATGTGTGTACAGGGTGTGCTGGG + Intergenic
1089561253 11:119344381-119344403 ACCTCTCTACAGGGTGTGGGGGG - Exonic
1099497164 12:83363392-83363414 ACATTTCTACAGAGTGTGCTGGG - Intergenic
1101591880 12:106132106-106132128 ACGTATATCCAGGGTTTGTCAGG - Intronic
1101877236 12:108603846-108603868 ACATAGATACAGGGTGTGTAGGG - Intergenic
1106784441 13:33092862-33092884 ACTTATCTATAGGGTGTGGCTGG - Intergenic
1108736573 13:53290180-53290202 AGGTATCTACAGGCTGGGTGTGG + Intergenic
1112865644 13:103893470-103893492 ACGTATCCAAAGAGTGTATTAGG + Intergenic
1118674371 14:68167376-68167398 AAGTATATACAGGGTATGATGGG - Intronic
1120578433 14:86214789-86214811 ACGTATGTACAATGTGAGTTAGG + Intergenic
1124395324 15:29295483-29295505 ACGTATCCACTGGGGGTCTTAGG - Intronic
1131820903 15:96272465-96272487 AAGTATCTATAGAGTGTTTTGGG - Intergenic
1150128132 17:62652119-62652141 AAGTGTCTACAAGGTGTGTGGGG - Intronic
1155053273 18:22165859-22165881 ACGTTTCTAAAGAGTGTTTTTGG + Intergenic
926037505 2:9646864-9646886 ACGTATCTCTGGGGAGTGTTTGG + Intergenic
934137785 2:89014768-89014790 AGGTATATACAAGGTGTGTTGGG + Intergenic
936454387 2:112660556-112660578 ACTTACCTAGAGGGTGTGATCGG - Exonic
939654076 2:144801067-144801089 ACAGATTTACAGGGTTTGTTTGG - Intergenic
945656961 2:212635946-212635968 AAGTCTCTCCAGGGTGTTTTTGG + Intergenic
1168858128 20:1024111-1024133 ACGTATATATATGGTGTGTCAGG - Intergenic
1170861095 20:20104563-20104585 ACGTATCTACAGGGTGTGTTAGG + Intronic
1173889031 20:46489376-46489398 ACATATCTTCAGGGTGGGTGTGG + Intergenic
1174599563 20:51713269-51713291 GTGTTTCTACAGGTTGTGTTTGG - Intronic
953245586 3:41188411-41188433 ACTTGTCTACAGGGTGTGGGTGG + Intergenic
957733964 3:84181689-84181711 ACTTATCTAAATGGTGAGTTTGG + Intergenic
983835283 4:172377121-172377143 ACCAATCAACAGGATGTGTTTGG - Intronic
988386429 5:30572325-30572347 AAGTATCTTCAGGGCCTGTTGGG + Intergenic
991421893 5:66450657-66450679 AAGAATCTACAGGGTTTGTCTGG + Intergenic
991942234 5:71864026-71864048 AATTATTTATAGGGTGTGTTAGG - Intergenic
994716219 5:103324343-103324365 AGGTATTTACAGAGTGTTTTTGG - Intergenic
995896849 5:117022932-117022954 ACATATTTAAAGGGTGTGTAAGG - Intergenic
997864601 5:137450037-137450059 AGGTATCTACCATGTGTGTTTGG - Intronic
1003210739 6:4063532-4063554 AGGTTTCTACAGGGTAAGTTGGG - Intronic
1005361322 6:25033731-25033753 AAGTACCTACAGGATGTGTTGGG - Intronic
1008296114 6:49779916-49779938 ACATATATAAAGGGTATGTTTGG + Intergenic
1008585240 6:52942826-52942848 GCTTATCTACAGGATCTGTTAGG - Intergenic
1009563090 6:65274080-65274102 AAGTAACCACAGGGTGTGTCTGG - Intronic
1020234548 7:6345693-6345715 AAGTGTCTACAGGCTGTATTTGG - Intronic
1024492004 7:49996304-49996326 AAGTAACCACAGGGTGGGTTTGG + Intronic
1025854746 7:65267196-65267218 TCCTATCTCCACGGTGTGTTAGG - Intergenic
1029843715 7:103391981-103392003 ATTTATGTAGAGGGTGTGTTTGG - Intronic
1033918360 7:146356408-146356430 ACTTATCCACAGGCTATGTTCGG - Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1036155783 8:6340704-6340726 TGGTACCTAGAGGGTGTGTTGGG - Intergenic
1044407855 8:91850490-91850512 TCATATCTACAAGGTGTTTTGGG + Intergenic
1045799343 8:106083804-106083826 ATGTTTCTACAGTTTGTGTTTGG + Intergenic
1047291149 8:123531582-123531604 ACGTATCCACAGGGTGGGCTCGG + Intronic
1185943936 X:4353498-4353520 ACATATCTACAGGCTGGGTGTGG - Intergenic
1189397669 X:40637833-40637855 AGGTACCTACAGGTTATGTTAGG - Intronic
1191686148 X:63892774-63892796 ATGTATCTACAATGTTTGTTGGG - Intergenic
1193608515 X:83598373-83598395 AAGTATATACAGTGTGTGATGGG + Intergenic
1195070059 X:101270458-101270480 ACCTATCTATAGGGGGTGGTGGG - Intronic
1195915256 X:109929111-109929133 ACATATCCACAGGGTGTCGTGGG - Intergenic
1197594216 X:128447984-128448006 ATGTATCTACAGTGTTAGTTTGG + Intergenic
1198570230 X:137947091-137947113 ATGGAACTACAGGTTGTGTTAGG - Intergenic