ID: 1170863488

View in Genome Browser
Species Human (GRCh38)
Location 20:20130749-20130771
Sequence ATTTGTTCCACAGGTCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170863488_1170863491 -9 Left 1170863488 20:20130749-20130771 CCCAGGGGACCTGTGGAACAAAT No data
Right 1170863491 20:20130763-20130785 GGAACAAATCTCCTACAGTGTGG No data
1170863488_1170863493 18 Left 1170863488 20:20130749-20130771 CCCAGGGGACCTGTGGAACAAAT No data
Right 1170863493 20:20130790-20130812 GCTGAACTGCCATGCTAATTTGG No data
1170863488_1170863495 30 Left 1170863488 20:20130749-20130771 CCCAGGGGACCTGTGGAACAAAT No data
Right 1170863495 20:20130802-20130824 TGCTAATTTGGAGTCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170863488 Original CRISPR ATTTGTTCCACAGGTCCCCT GGG (reversed) Intronic