ID: 1170863489

View in Genome Browser
Species Human (GRCh38)
Location 20:20130750-20130772
Sequence GATTTGTTCCACAGGTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170863489_1170863491 -10 Left 1170863489 20:20130750-20130772 CCAGGGGACCTGTGGAACAAATC No data
Right 1170863491 20:20130763-20130785 GGAACAAATCTCCTACAGTGTGG No data
1170863489_1170863495 29 Left 1170863489 20:20130750-20130772 CCAGGGGACCTGTGGAACAAATC No data
Right 1170863495 20:20130802-20130824 TGCTAATTTGGAGTCTCCTTTGG No data
1170863489_1170863493 17 Left 1170863489 20:20130750-20130772 CCAGGGGACCTGTGGAACAAATC No data
Right 1170863493 20:20130790-20130812 GCTGAACTGCCATGCTAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170863489 Original CRISPR GATTTGTTCCACAGGTCCCC TGG (reversed) Intronic